Clonal populations of CD4+ and CD8+ T cells in patients... myeloma and paraproteinemia

From www.bloodjournal.org by guest on November 24, 2014. For personal use only.
1996 87: 3297-3306
Clonal populations of CD4+ and CD8+ T cells in patients with multiple
myeloma and paraproteinemia
P Moss, G Gillespie, P Frodsham, J Bell and H Reyburn
Updated information and services can be found at:
http://www.bloodjournal.org/content/87/8/3297.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.
From www.bloodjournal.org by guest on November 24, 2014. For personal use only.
Clonal Populations of CD4+ and CDS+ T Cells in Patients With Multiple
Myeloma and Paraproteinemia
By Paul Moss, Geraldine Gillespie, Penny Frodsham, John Bell, and Hugh Reyburn
tions.The
patients show novel oligoclonalexpansions
Patients with paraproteinemia have abnormalities in their
within the CD4+ subsetand show an increased frequency of
T-cell subsets including inversion of the CD4:CD8 ratio and
increased expression of activation markers. Recently, distor- CD8’expansions. OligoclonalCD4+T cells belong to the
rare CD4+CD28- T-cell subset, a phenotype associated
with
tions in T-cell receptor (TCR) TCRAV and TCRBV gene seggranular morphology. CD45RA andC D l l b are expressed on
ment expression have been reported, although the signifimany of the CD8 T-cell expansions. Comparison of T-cell
cance of these observations is unclear given the finding of
receptor sequences from two T-cell clones in one patient
clonal populations of
CD8’ T cellsin healthy elderly individusuggests a possible role for a common peptide antigen in
of TCR V-region-speals. We have used an extensive range
the generation of the expansions. Further work is needed
cific monoclonal antibodies to assessTCRAV and TCRBV
to identifythe relevance ofsuch T cells to the B-cell proliieraexpression in patients with myeloma and paraproteinemia.
tion.
TCR sequence analysis was used to assess the clonality of
0 7996 by The American Society of Hematology.
expansions and 3-color fluorescence-activated cell sorting
analysis determined the phenotype of the expanded popula-
I
T IS NOW REALIZED THAT paraproteinemia is common in elderly people’ but that only a minority of such
patients go on to develop multiple myeloma (MM).’ This,
together with the typical pattern of a plateau phase during
chemotherapy for myeloma, has led to suggestions that immunoregulation may play a role in controlling the neoplastic
B-cell clone and that escape from such control may herald
development of disease relapse. Abnormalities in T-cell populations have been documented consistently in paraproteinemia and include an inversion of the normal CD4:CD8 ratio,3
coincident expansions of large granular lymphocytes,4’ and
increased expression of lymphocyte activation markers!
Whether these changes reflect an active response to the Bcell proliferation or are secondary to disordered immunoregulation is unclear at present.
Expansions of T cells bearing specific T-cell receptor
(TCR) V segments has been reported in patients with both
paraproteinemia and myeloma’ and was found to be particularly prominent before chemotherapy. The clonality of such
expansions was not determined, and the result has to be
viewed in the context of the finding of clonal populations
of CD8 T cells in apparently healthy elderly individuals.8”0
To investigate the significance of these T-cell expansions,
we have compared the T-cell repertoire in patients with paraproteinemia with that in healthy elderly individuals by assessing the frequency and clonality of T-cell expansions as
documented by TCR V segment expression. Three-color
fluorescence-activated cell sorting (FACS) analysis was used
to identify the membrane phenotype of the expanded populations.
MATERIALS AND METHODS
Subjects. Blood samples were taken from patients with paraproteinemia attending hematology clinics or from apparently healthy
individuals over the age of 60 years. The patient group included 10
patients withMM and 7 with benign paraproteinemia. Two MM
patients were undergoing primary treatment with melphalan (V.M.
and F.H.), 5 were in plateau phase (M.F., R.P.,E.F., M.B., and
H.M.), and 3 were being treated for relapse (R.A., D.B., and I.D.).
All subjects gave written consent to donate blood. The project was
approved by the local ethical committee.
Cell separation. Peripheral blood (PB) mononuclear cells were
isolated by centrifugation on FicolVHypaque and washed in RPM1
medium (GIBCO, Paisley, UK). CD4 and CD8 subsets were separated by incubation of PBMCs with magnetic beads (Dynal, Wirral,
Blood, Vol 87, No 8 (April 15). 1996: pp 3297-3306
UK) coated with antibodies to CD4 or CD8 followed by magnetic
selection.
FACS analysis. Aliquots of 2 X IO5cells were stained with first
layer antibodies followed by rabbit antimouse fluorescein-conjugated
F(ab’), fragments. Cells were washed again twice and resuspended
with anti-CD4 or anti-CD8 monoclonal antibodies (MoAbs; Dako,
High Wycombe, UK) directly conjugated to phycoerythrin. For 3color FACS analysis, Tricolor-labeled CD4 and CD8 MoAbs and
fluorescein isothiocyanate-conjugated MoAbs towards CD45RA.
CD45R0, HLA-DR, CD28, CDllb, and CD57 were used with
TCRBV-specific MoAbs stained with a phycoerythrin second layer
antibody. Analysis was performed on a FACScan (Becton Dickinson,
Mountain View, CA).
MoAbs. The MoAbs used were anti-TCRBVU23 (HUT-7; gift
from 0. Kanagawa), anti-TCRBV2 (MPB2/D5; gift from Prof A.
Boylston), anti-TCRBV3 (JOVI-3; gift from Dr M. Owen), antiTCRBV5.1 (LC4; gift from Prof A. Boylston), anti-TCRBV5.2/3
(4-2ACI; gift from Prof A. Boylston), anti-TCRBV6.7a (OT14J; gift
from Prof D. Posnett), anti-TCRBV7 (3C5), anti-TCRBV8 (MX6;
gift from Prof A. Boylston), anti-TCRBV9 (MKBP2/10; gift from
0. Kanagawa), anti-TCRBV11 (C21; gift from Dr A. Lanzavecchia),
anti-TCRBV12 (MCA997; Serok, Kidlington, UK), anti-TCRBV13.1
(H131; gift from P. Marrack), anti-TCRBV13.2 (H132; gift from P.
Marrack), anti-TCRBV13 (gift fromDr A. Krensky), anti-TCRBV17
(gift from S. Freidman), anti-TCRBV18 (BA-62; from Immunotech,
Marseille, France), anti-TCRAV2.3 (TM-19; gift from J. Grunewald), anti-TCRAV12.1 (6D6; gift from Prof M. Brenner), and antiTCRAV24 (C15; gift from Dr A. Lanzavecchia).
TCR sequencing. TCR sequences were determined by TCR Vregion-specific polymerase chain reaction (PCR) followed by
cloning into M13mp18 and sequencing. V-region-specific primers
Fromthe Molecular Immunology Group and Department of
Haematology, Institute of Molecular Medicine, The Churchill Radcliffe Hospital, Headington, Oxford, UK.
Submitted July 10, 1995; accepted November 24, 1995.
Supported by grants from theLeukaemia Research Fund,the
Medical Research Council, and the Wellcome Trust.
Address reprint requests to Paul Moss, MD, the Molecular Immunology Group and Department of Haematology, Institute of Molecular Medicine. The John Radclue Hospital, Headington, Oxford, UK
OX3 9DU.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
“advehsement” in accordance with 18 U.S.C. section 1734 solely to
indicate this fact.
0 1996 by The American Society of Hematology.
0006-4971/96/8708-02$3.00/0
3297
From www.bloodjournal.org by guest on November 24, 2014. For personal use only.
MOSS ET AL
3298
.
Table 1 TCRAV and TCRBV Repertoire in CD4 and CD8 T Cells From Control Individuals
CD4 repertoire
VB2
VB3
VB5.1
VB5.213
VB5.3(2)
VB6.7
VB7
VB8
VB9
VBll
VB12
VB13.1
VB13.2
VB13
VB17
VB18
VB23
Total TCRVB covered
in CD4
VA2.3
VA12.1
VA24
CD4+57’
CD8 repertoire
VB2
VB3
VB5.1
VB5.213
VB5.3(2)
VB6.7
VB7
VB8
VB9
VBll
VB12
VB13.1
VB13.2
VB13
VB17
VB18
VB23
Total TCRVB covered
within CD8
VA2.3
VA12.1
VA24
CD8 57 +
+
J.C.
J.M.
E.G.
A.G.
A.P.
D.W.
C.C.
B.S.
H.H.
D.R.
6.5
5.1
7.3
2.4
0.9
3.4
ND
3.5
ND
0.6
2.2
4.5
2.7
5.2
5.6
ND
ND
11.2
7
ND
3.7
0.7
3.1
1
6.9
ND
0.6
2.2
3.9
2.7
4.9
ND
ND
ND
6.9
3.3
8.2
ND
4.6
1.4
5.9
3.8
0.8
2.1
4.3
2.2
5.3
3.8
1.6
0.5
11.6
4.3
6.7
2.5
ND
5.6
1.8
4.6
ND
0.8
2.3
3.3
2.3
5.4
1.3
ND
1
8.7
0.9
7
3.6
0.6
4.2
1
5.5
ND
0.4
1.6
3.8
1.5
5
6.8
ND
ND
5.7
7.5
5.6
2.6
ND
2.1
0.8
5.3
3.8
1.1
2.7
4
1.1
6.1
5.6
ND
0.3
7.6
3.4
7.5
2.4
ND
5.1
1.4
5.6
3.2
0.6
1.3
4.1
2.3
5.9
5.6
ND
0.8
9.5
3.6
8.5
2.8
ND
2.4
1.4
9.6
ND
0.8
1.5
ND
1.2
6.9
5.8
5
0.9
9.6
1.4
3.9
3.1
ND
5.7
2.3
6.4
ND
0.4
1.9
4.6
2.5
6.7
8.3
0.4
2.3
9.8
3.5
5.2
ND
ND
3.8
0.8
0.7
0.4
0.7
2.2
2.2
3.3
3.7
11.9
ND
0.7
52.1
50.1
59
55.8
54.4
57.1
58.1
59.9
59.5
3.7
1.9
0.4
3.1
49.7
2.7
3.5
0.3
0.7
4.5
3
5.4
ND
ND
2.4
0.6
0.4
ND
ND
3
1.8
ND
ND
2.5
1.2
0.2
2.7
3.7
0.4
5
4.8
1.9
0.4
3.5
NO
3.1
0
3.6
6.8
3.6
2.8
2.6
0.9
0.9
ND
4.4
ND
1.2
1.2
4.2
4.2
2.5
5.3
ND
ND
8.5
5.1
ND
5.6
2.7
0.6
2.2
5.8
0
3
0.7
8.9
1.4
7.5
5.1
ND
ND
3.6
1.5
1.5
3.8
ND
1.6
0
1.9
1.7
1.6
0
7.3
1.4
9.4
7
0
1.9
8.1
2.3
2
3.8
ND
2.8
2.3
5.7
ND
0.5
1
4.1
2.9
5.9
4.5
0
1.9
8.6
0.5
0.5
1
5.6
2.3
3.2
3.2
ND
2.2
1
4
4.6
0
2.2
2.2
3.1
2.2
0.7
1.8
ND
0.5
1
0.4
ND
0.7
1.2
ND
1.1
5.5
1.2
1.3
2.4
ND
0
1.2
1.2
ND
1.2
0
ND
1.3
17.8
4.4
2.5
1.1
1.8
0
1.2
1.2
ND
0.9
0.5
0.5
ND
0
0.5
ND
5.5
0
0
0.9
1
2.1
5.2
4
ND
ND
10.8
5.3
0
7
ND
2
2.8
2
0
40.6
57.1
44.2
47.4
50.1
54.9
77
41.1
3.3
1.7
1.2
17.3
4.5
7.3
4.7
6.7
1.9
7.8
1.6
ND
ND
10
0
0.5
ND
3.4
0.5
38
ND
4
0
NO
ND
5.6
0
1
2.2
0.5
2.7
0.4
0.8
20
0
0
2.4
7.1
14
2
ND
0
11
-
15
19
-
1.5
3.6
1.1
7.2
A.B.
AVG
7.2. . . . . . . . .8.57
4.8. . . . . . . . .4.07
4.8. . . . . . . . .6.47
2.6. . . . . . . . .2.79
1.9. . . . . . . . .1.03
.
5.9 . . . . . . . . 4.17
0.6 ......... 1.25
4.3 . . . . . . . . .5.30
ND. . . . . . . . 2.80
.
0.3 . . . . . . . . .0.65
.
2.3 . . . . . . . . 2.03
.
5 . . . . . . . . 3.97
2.4. . . . . . . . .2.20
2 .........5.19
5.5. . . . . . . . .6.02
N D. . . . . . . . .2.33
ND. . . . . . . . .0.93
4.9. . . . . . . . .3.88
0.6. . . . . . . . .2.57
0.6 . . . . . . . . .1.05
.
N D. . . . . . . . 2.16
1.01
0.87
1.53
1.84
6.9
5.2
5.6
7.7
2.66
1.85
1.08
2.25
1.04
0.89
0.86
5.54
2.17
0.93
0.67
4.38
3.24
6.06
8.07
1.44
1.86
13.7
8.1
5.0
10.7
4.7
3.8
3.9
20.9
8.1
3.6
2.8
17.9
12.9
27.0
31.4
5.2
7.4
1.11
3.13
1.37
12.72
6.0
13.6
5.0
48.0
44
25.1
53.3
0
ND
1.2
0
7.7
14.4
10.1
11.1
4.3
2.8
8.2
2.8
11.9
7.7
1.3
3.3
6.3
4.2
49.6
0.7
2.3
2.5
ND
0.3
2
1.8
0.5
+ 3 x SD
9.3
14.3
9.5
2.9
0.5
17
2.7
0
2.6
1
AVG
1.94
2.02
1.53
0.52
0.60
1.33
0.52
2.21
1.62
0.23
0.41
0.78
0.68
1.38
2.76
2.39
0.65
4.2. . . . . . . . .5.68
4.2 . . . . . . . . 2 5 2
3.3 . . . . . . . . . 1.79
3.9. . . . . . . .3 9 9
2.2. . . . . . . . .1.58
0.4. . . . . . . . .1.13
1.4. . . . . . . . .1.34
1.3. . . . . . . . .4.28
N D. . . . . . . . .1.58
0.3 . . . . . . . . .0.77
0.3 . . . . . . . . .0.73
2.1. . . . . . . . .4.80
2.1. . . . . . . . 3.16
.
1.3. . . . . . . . .8.84
26 . . . . . . . . .7.19
N D. . . . . . . . .0.83
N D. . . . . . . . .1.79
15
-
SD
2.7. . . . . . . . .2.65
0 . . . . . . . . .4.22
0.6. . . . . . . . .0.93
N D.........9.&
The percentage staining of cells with individual V-region-specific MoAbs is shown in vertical columns . The total staining of all CD4 or CD8
T cells b y TCRBV-specific MoAbs and the percentage of CD57’ T cells within each group are also shown . The average staining with each M o A b
together with standard deviation (SD) and average plus 3 SDs is shown on the right of the figure.
Abbreviation: ND. not done .
. TCRBV6.7 (5’-ataagaatgcggccgcgagtttttaatttacttccaggcaaca. TCRBVl1 (5’-ataagaatgcggccgcgtcctatggagttaattccacagagaag3’). TCRBVI 3 (5‘.ataagaatgcggccgcgtccccaatggctacaatgtctccaga.3’).
TCRBC gene segment and contained a Sal I site at the 5‘ end. PCR
conditions were 94°C for 1 minute. 55°C for 2 minutes. and 72°C
for 2 minutes. repeated for 30 cycles. PCR products were cloned
into a modified M13mp18 vector that had been digested with No? I
and Sal I.” After transformation of Escherichia coli. individual
TCRBV23 (5’.ataagaatgcggccgcgagtttttaatttacttccaaggc~aca.3‘)
. The
constant region primer was complementary to the TCRAC or
plaques were picked for single-strand preparation followed by sequencing using T7 DNA polymerase.
incorporated a Not I restriction site in their 5’ end and were as
follows: TCRBV3 (5’-ataagaatgcggccgctctagagagaagaaggagcgc-
3’)
3’)
From www.bloodjournal.org by guest on November 24, 2014. For personal use only.
3299
CLONAL T CELLS IN PATIENTS WITH PARAPROTEINEMIA
Table 2. TCRAV and TCRBV Repertoire in CD4 and CD8 T Cells From Patients With Myeloma
R.A.
CD4 repertoire
VB2
VB3
VB5.1
VB5.213
VB5.312)
VB6.7
VB7
VB8
VB9
VB11
VB12
VB13.1
VB13.2
VB13
VB17
VB23
Total TCRBV coverage within CD4 subset
6.2
2.9
0
3.4
0.9
5.6
1.5
4.8
ND
0.6
ND
5
2.1
4.7
ND
ND
s3
3.7
0.9
0.6
1
VA2.3
VA12.1
VA24
CD4‘57’
CD8 repertoire
VB2
VB3
VB5.1
VB5.213
VB5.3(2)
VB6.7
VB7
VB8
VB9
VB11
VB12
VB13.1
VB13.2
VB13
VB17
VB23
Total TCRBV covered within CD8
4.7
3.6
0
2.4
0.5
3.1
1
3
ND
0.6
ND
3.4
1.1
8.7
2.9
ND
35
1.4
2.8
0.5
26
VA2.3
VA12.1
VA24
CD8+57+
I.D.
M.F.
D.B.
8
1.5
ND
0.4
1.5
4
28
8.2
6
ND
75
-
10.1
4.3
ND
1.5
0.8
4.3
1
6.1
ND
0.5
2.5
3.5
1.7
5.9
5.7
ND
51
7.5
5.8
ND
2.5
1.o
4.4
1.3
4.2
ND
1.0
1.7
4.5
2.1
4.4
6.4
ND
51
9.7
5.9
5.9
4.5
0.6
5.8
1.5
4.7
4.3
1.1
1.6
6.4
1.2
5.8
8.3
0.5
74
-
6.1
2.6
0.4
38
4.5
1.9
0.7
2.2
5.4
3
0.7
ND
ND
4.4
1.1
3.2
2.5
ND
1.3
0.4
0.4
0
3.3
ND
0
6.7
4
ND
1.8
0.6
1.3
0.6
5.5
ND
0.6
3.4
3.3
1.5
0.8
2.7
0.8
11
3.4
1.4
0.3
0.3
0.3
0.6
ND
0.3
0
17
0.8
12
1.1
ND
49
0.5
17
0.3
69
-
R.P.
0.8
ND
0.8
3.5
1.7
2.1
1.9
3.8
ND
21
1.8
1.2
3.8
11
ND
42
9.3
4.8
3
4.4
ND
1.9
2.4
4.5
3.1
0.6
1.4
7
0.7
7.7
7.5
2.5
61
1.3
3.2
0.4
49
3.6
4.8
0.6
40
ND
8.7
0.3
ND
-
E.F.
M.B.
V.M.
F.H.
H.M.
6.5
5.6
ND
1.8
0.6
2.8
0.6
6.9
ND
0.6
1.3
2.4
1.1
4.5
3.9
ND
8.7
3.5
5.4
2.5
ND
6.2
1.5
4.5
ND
0.6
1.7
2.9
3
2.5
41
8.7
6.9
2.3
1.8
0.6
4.6
1.2
4.1
ND
0.6
0.6
3.1
3.8
3.1
8.8
ND
53
ND
56
5.3
1.8
3.6
0.9
ND
0.9
0.9
2
ND
1
1.7
2.8
4.9
4.9
15
ND
46
-
7.6
4.8
5.5
3.7
ND
5
1.8
4.9
6.5
1.5
2.5
3.2
1.6
4.9
4.2
0.7
58
1.3
2.4
1.3
14
3.1
1.3
0.7
17
0.4
0.4
ND
1.8
2.9
2
5.8
47
ND
3.6
0
1.1
9.8
1.9
0.4
0.4
0.8
0.9
5.7
3.8
1.6
6.4
3.4
ND
53
0.4
0.8
ND
11
0.2
3.1
0.6
1.5
5.5
ND
53
4.7
7.5
1.6
2.9
0.8
2.1
1.5
4.1
ND
0.8
2
3.1
2.8
3.1
5.1
ND
42
2.6
5.5
2.3
3.9
ND
1.5
1.7
5.9
1.7
0
1.9
3.1
1.1
4.2
3.5
1.1
40
1.8
2.9
0
34
0.4
1.5
3
32
2.7
0.4
0.4
16
10
ND
4.6
0.9
0.9
2.4
8
ND
0
0.8
25
8.8
-
z1
0.9
ND
0.3
0.2
0.5
ND
1.3
0.2
4.5
0.2
5.3
4.6
ND
57
6.8
-
4
1.6
13
-
ND
6.2
2.7
2
The results are shown as in Table 1.
Protein electrophoresis. Serum or plasma samples were run on
cellulose-acetate gels followed by staining with Coomassie Blue,
using standard techniques.
RESULTS
TCR repertoire in elderly controls. ‘KR expression on CD4
and CD8 T cells was determined by 17 different MoAbs specific
for TCR V segments (Table 1). Within the CD4 subset, theE was
little variation in expression of individual V segments between
subjects. However, analysis of the CD8 subset showed a bimodal
distributionof TCRBV8, TCRBV13, and TCRBV17 expression
in subjects A.P., C.C., and A.B., respectively. It is now cleat
that the population distribution of TCRBV expression on CD8
T cells observes a bimodal pattern: and thus, these five values
represent CD8 expansions.
TCR repertoire in patieMs with paraproteinemia. V-region
expression within the CD4 subset of PB lymphocytes from patients showed a diffmnt picture than that which had been observed for the control group (Tables 2 and 3). A total of 16
values were above the mean plus 3 standard deviations (SD)
value derived from the control group, and 2 patients (M.M. and
M.J.) showed 3 or more significantly high values. Five of these
expansions represented over 10%of CD4 cells, including the
figure of 28% of CD4 cells bearing TCRBV13.2 in donor I.D.
The total TCRBV coverage within the CD4 population
From www.bloodjournal.org by guest on November 24, 2014. For personal use only.
MOSS ET AL
3300
Table 3. TCRAV and TCRBV Repertoire in CD4 and CD8 T Cells From Patients With Benign Paraproteinemia
G.L.
I.K.
H.R.
IS.
M.M.
CD4 repertoire
VB2
VB3
VB5.1
VB5.213
VB5.3(2)
VB6.7
VB7
VB8
VB9
VBll
VB12
VB13.1
VB13.2
VB13
VB17
VB23
Total TCRBV covered i n CD4 subset
7.6
5.1
ND
3
0.7
4.4
0.7
4.2
ND
0.8
2.5
3.9
1.4
7.3
6.7
ND
52
7.5
5.3
5.4
2.6
ND
5.6
1.1
4.3
3.8
0.7
2.3
2.9
2.1
6.5
6.2
0.4
60
6.9
3.4
5.2
2.4
ND
5.1
2.8
6.3
2.7
1
2.7
2.4
2.5
7.7
15
-
6.9
6.1
3.5
1.1
0.6
3.8
1.1
1.2
ND
0
1.2
2.4
3.3
3.4
3.7
ND
41
-
9.8
3.4
6.3
VA2.3
VA12.1
VA24
CD4'57'
ND
2.6
0.2
2.4
ND
2
0.4
3.6
ND
4.9
1.4
7.6
7.3
1.4
ND
2.2
0.7
0.8
0.4
0.2
1.2
ND
1.4
0.8
1
0.2
0
0.6
1.9
0.6
1.8
0.4
79
90.3
25
-
ND
1.1
0.2
ND
1.5
10.8
0.4
43
CD8 repertoire
VB2
VB3
VB5.1
VB5.213
VB5.3(2)
VB6.7
VB7
VB8
VB9
VBll
VB12
VB13.1
VB13.2
VB13
VB17
VB23
Total TCRBV covered in CD8 subset
1.8
1.6
ND
0
1.6
2.3
0.9
4.6
14
ND
39.1
3.6
2.1
2.1
1.4
ND
0.6
2
0
0
0.6
0
1.4
0.6
5.2
8.5
0.6
28.7
VA2.3
VA12.1
VA24
CD8+57+
ND
0.9
0
31
ND
1.2
0
34
0.8
70
-
3.5
1.7
1.1
9.4
4.4
1.9
1.4
0.7
12
1.5
1
ND
1.1
2.3
1.9
1.9
1.1
2.5
ND
58.2
M.J.
E.H.
2.8
ND
6.3
ND
1.8
1.7
3.3
1.5
3.9
7.4
ND
59
4.9
3.3
7
4.5
ND
9.5
1.2
3.2
ND
0
1.3
12
2.6
15
6
ND
83
-
9.8
8.7
5.4
3.3
ND
4.6
1.5
4.8
3.8
1
2.5
3.3
2.2
6.6
6.4
ND
64
-
2.6
0.8
0.7
1.2
ND
1.8
0.5
16
ND
3.4
0.6
ND
2.1
1.1
1.1
0.6
0
0
ND
1.2
ND
1.1
1
1.2
7.8
1
3.3
ND
21.5
2.3
1.9
0.9
1.1
ND
15
1.1
ND
ND
0.3
0.3
1.7
2.2
3
1
0.6
31.7
1.7
ND
0.7
0.9
5.4
ND
0
0.9
1.9
4.3
3.2
6.7
ND
38.6
1.2
1.2
2
ND
2
0.3
66
ND
10
0
ND
4.5
3.1
-
3.5
8.6
-
0.8
The results are shown as i n Table 1.
was also significant. A total of 4 patients decreased below
the 50% lower limit derived from controls, whereas, in 5
patients, the MoAbs collectively stained over 60% of CD4
cells, including a total of 83.1% of cells in donor M.J. It is
noteworthy that four TCRBV expansions were observed in
this patient.
There were frequent examples of T-cell expansions within
the CD8 population. Overall, 14 expansions were defined in
9 patients, with 8 of these caused by increased expression
of TCRBV3 or TCRBV6.7. The largest expansion was the
79% of T cells that stained with anti-TCRBV23 in a patient
with an IgM paraproteinemia, which is by far the largest
distortion in TCR repertoire that we, or others, have described.
The total percentage of CD8 T cells stained varied between 21.4% and 90%. Those patients with particularly low
values are likely to possess a TCRBV expansion not detected
by the MoAb. This has been proven in another patient with
myeloma who was found by anchored PCR to have a monoclonal expansion of CD8 cells not detectable by the available
MoAbs (P. Moss and A. Osterborg, unpublished data).
TCR sequences from V-regwn-&$ned T-cell expanswm.
Once T-cell expansions had been detected on the basis of increased expression of individual TCRAV or TCRBV segments,
From www.bloodjournal.org by guest on November 24, 2014. For personal use only.
CELLS
CLONAL T
IN PATIENTS WITH PARAPROTEINEMIA
Donor Date
a.
IS
%R
ID
Expanoion
10/92
CD8-VB3
(10%)
10/93 CD8-VB3
1/94CD8-VB3
(25%)
(25%)
(25%)
5/95
1/94
CD8-VB23
CD4-VB17
5/95
CD4-VB17(10%)
G
G
10/93 CD8-VA12.1
(17%)
10/93 CD8-VB13.1
(17%)
KP
10/93
CD8-VB3
YB
10/93
CD8-VB6.7
(25%)
WB
CD8-VB11
T
G
G
Y P RT D G
Q Y
24/32
ttatacccgagaggagatacgcagtat
20/29
L Y P R G D T Q Y
L Y P R GD
12/22
T Q Y
L L A GA
Q P Y N E Q F 7/22
ctactagcgggagcccaaccctacaatgagcagttc
G
A
R G
T
G T E A F
ttagcggggcggacagggggcactgaagctttc
L A G R T G G T E A F
I E V R S N Q P Q H
atagaggttcggagcaatcagccccagcat
I EV
R S N Q P Q H
15/15
Q K L L
gcggacggccagaagctgctc
P G G R A F TDT
Q Y
ccgggggggcgggcattcacagatacgcagtat
Y Q G S A E A F
taccaaggatccgccgaagctttc
11/22
(10%)
AG D
12/21
10/18
31/34
F V R T E A F
tttgtccgaactgaagctttc
13/18
P T G G T E A F
cccactggggggactgaagctttc
P T G G T E A F
ccgacagggggaactgaagctttc
15/23
(10.8%)
EDGP
Q Y F
cccgggggatgagcagttctt
8/23
21/22
b.
AB
CD8-VB17
(26%)
I GVD
S N T E A F
atcgatgtgggctcgaacactgaagctttc
~p
CD8-VB8
(20%)
Polyclonal
T
E
A
F
cccackggggggactgaagctttc
P
(51%)
(15%)
Prw.
L
L
1/94
CD8-VB23
(79%)
it was important to determine the clonality of these populations.
V-regionexpansionscan be eitherpolyclonal,oligoclonal, or
monoclonal, and such information can be valuable in determiningtheiretiology.V-region-specific
PCR wasusedtoclone
and
sequence
individual
TCR
transcripts.
on
Within the patient population, CD8 expansions were oligoclonal in all instances (Fig 1). In every case, a single Tcell clone made up at least 50% of the expansion, with
the largest proportion being contributed by a monoclonal
TCRBV23 expansion (patient H.R.)anda
clone in the
T
CDRB osquance
10/93
CD4-VB13.2
(28%)
Fig 1. Nucleotide
and
predicted amino acid sequences of
predominant
clones
within
TCRV-regionexpansionsin
(a)
patientsand (b) controls.The
hypervariable CDRB region sequence is shown between the
conserved serine atthe 3' end of
the Vsegmentand
the conservedphenylalanine at the 5'
endof the junctional segment.
The date of sampling, the V-region expansion detected, andits
percentage contributionto V-reaion
- remrtoire ere shown. The
frequency
column
shows
the
times
number
of
the sequences
detected were
as a proportion of
alltranscriptssequencedfrom
the sample.
Sequences
availare
able from GenBank.
P
3301
T
E
A
F
ccgacagggggaactgaagctttc
Fig 2. Nucleotide and predicted amino acid sequences of
the two
TCRBV6.7atranscriptsisolatedfrompatient
M.B. Thethreenucieotide differences
are
shown
in boldface
and
are
underlined.
14/16
TCRBVl1 expansion of patient M.B. that made up 95% of
all TCRBVI 1 cells at the initial time point studied. Sequential analyses showed that the expansions are stable over time,
with the longest study, which persisted for 15 months, being
the predominant TCRBV3 clone in patient I.S. Nevertheless, the relative contribution of clones within the expansion
did show some fluctuation, because, in this patient, a second
expanded TCRBV3 clone was detected at the third time
point. Although representing 30% of sequences at this time,
this clone hadonlybeen
found on 1 occasion from 32 sequences at the initial time point. When these two sequences
are aligned, they show no sequence homology at the amino
acid level. In the control subjects, we found examples of both
oligoclonal and polyclonal expansions. Specifically, subject
A.B. had a large oligoclonal expansion within the TCRBV17
population, whereas subject A.P. had a TCRBV8 ex]pansion
that was polyclonal.
TCR sequences were amplified from cDNA, and it is possible that the clonal T cells express increased levels of TCR
mRNAthatwould lead to an Overestimation of their fiequency by this method. Therefore, genomic DNAwas pre-
From www.bloodjournal.org by guest on November 24, 2014. For personal use only.
PHENOTYPE OF CLM VB 17 POSITIVE T CELLS ( PATIENT H.R)
2
A
VB 17
cD45 RA
CD45 RO
HLA DR
VB 17
CD28
CDIlb
CD57
PHENOTYPE OF CD4 VB2 POSITIVE T CELLS ( PATIENT H.R.)
B
104
ld
vB2
.
.
3 2
.',.:. . .
I
.;
'
,
'
.
.
id
CM5 RA
CM5 RO
HLA DR
I
I
I
I
CD28
CDllb
CD57
Fig 3. Three-color FACS analysis of (A) TCRVB17 CD4'. (B) TCRVBZ CD4+ (control), and (C) TCRVB23 CD8' T-cell expansions from patient
H.R. A gate was selected on CD4 or CD8 fluoresence plotted against forward scatter, and this population was further analyzed as shown.
From www.bloodjournal.org by guest on November 24, 2014. For personal use only.
CLONAL T CELLS IN PATIENTS WITH PARAPROTEINEMIA
3303
PHENOTYPE OF CDSVB23POSITlVE T CELLS (PATIENT H.R.)
C
VB23
cD45 RA
CD4S RO
HLA DR
CD28
CDllb
CD57
VB23
Fig 3. ICont'd).
pared from subject I.S. and was amplified with the TCRBV3specific primer followed by cloning and sequencing. A total
of 54% of sequences were the same as the predominant
transcript isolated from cDNA, thus showing that mRNA
levels are not increased in clonally expanded T cells.
Of the two CD4 expansions that were sequenced, two
were oligoclonal and one was polyclonal. Indeed, in the
TCRBV 13.2 expansion from patient I.D., a single transcript
made up over 90% of sequences.
Comparison of CDR3 region of TCRBV6.7a T cells from a
CD8 expansion. T cells that recognize the same major histocompatibility complex class-I-restricted peptide often show patterns of homology in their TCR sequences. Specifically, there
tends to be conservation of TCRBV usage and conserved amino
acids at critical positions within the hypervariable junctional
region. Comparison of the two transcripts that were expanded
in the TCRBV6.7 subset of patient M.B. is highly suggestive of
selection by antigen (Fig 2). These two transcripts together made
up all 23 sequences that were cloned from the TCRBV6.7 subset
and clearly originate from different T cells, because they have
three nucleotide differences in the hypervariable junctional region. However, the predicted amino acid sequence is exactly the
same in both cases, clearly implicating antigenic selection of
clones. Currently, we do not have information on the nature of
likely antigen.
Phenotype of expanded T cells. Three-color FACS anal-
ysis was used to assess the expression of a number of markers on the T-cell expansions. The markers chosen were
CD45RA and RO (markers of naive or memory phenotype,
respectively), CDl1b, CD28, CD57, and HLA-DR. Oligoclonal CD8' T cells have been previously reported to be
mainly CD45R0, CDI l b and CD57 positive.' As a direct
control, the same markers were studied on T-cell populations
from the same patient that had not shown a T-cell expansion.
Patient H.R. had oligoclonal expansions within both the
CD4 (TCRBV17) and CD8 (TCRBV23) subsets, and these
populations were examined by 3-color FACS analysis to
determine the expression of several other markers. The majority of the CD4' TCRBV17 population was clearly CD28(Fig 3A), whereas five control subsets from both this patient
and others were consistently CD28' (Fig 3B), a marker normally found on over 99% of all CD4' T cells. Two further
CD4 expansions have recently been shown to have an identical phenotype to this TCRBV17 expansion. In contrast to
the CD4' TCRBV17 cells of which the majority were
CD45RO', the CD8' TCRBV23 expansion was clearly
CD45RA' and CD45RO- (Fig 3C), which is similar to the
results of reports within control groups. This population is
also CD28-. Similar analyses of CD8' expansions from both
I control and 3 patients on six occasions showed reduced
expression of CD45RO and CD28. Nevertheless, there was
heterogeneity within the CD8' expansions, with I patient
From www.bloodjournal.org by guest on November 24, 2014. For personal use only.
3304
MOSS ET AL
showing little expression of CD45RA and a high percentage
of cells positive for C D l l b and CD57. Patient groups
showed increased levels of CD57' CD4 and CD8 cells.
DISCUSSION
During T-cell ontogeny, the genes for the T-cell receptor
a and p chains are assembled from the variable, joining,
diversity, and constant gene segments and the expression of
individual gene segments has been studied in the PB of
normal individuals. This profile is often termed the TCR
repertoire. The report of distortions in the TCR V-segment
repertoire of both CD4 and CD8 T cells in patients with
paraproteinemia represented one of the first examples of
disordered TCR repertoire in disease,' but it was not clear
if the increased subsets represented polyclonal expansions
of T cells bearing a particular TCR V segment, as is observed
after superantigen activation, or whether the expansions were
oligoclonal or monoclonal. Also, patients with paraproteinemia are generally over 60 years of age, and it is now clear
that clonal expansions of T cells occur in the CD8 subset in
healthy elderly individuals,'."' a finding that parallels the
results in old mice."
The results confirm that monoclonal expansions of CD8
T cells occur in apparently healthy individuals but show
that the expansions are more marked and more common in
patients with a paraproteinemia. In patient H.R., a monoclonal TCRBV23 expansion represented over 79% of CD8
T cells. Two patients had two simultaneous TCRBV expansions within the CD8 subset. The clonality of the T-cell
expansions was determined by sequencing of the TCR junctional region, which is specific for each individual T-cell
clone. Monoclonal or biclonal expansions were observed in
all cases, indicating expansion of individual T-cell clones
rather than a general stimulation of all T cells bearing a
particular V segment. The presence of a clonal T-cell population has been reported in 1 of 8 MM patients using a Southern
blot technique to detect monoclonal rearrangement of the
TCR.13 Our data show that the true incidence of monoclonal
T cells is much higher. The TCRBV-specific MoAbs used
in the study only cover approximately 60% of the total CD8
T-cell population and, therefore, are likely to miss a large
number of T-cell expansions. Also, not all TCRJ3V-specific
antibodies were available for staining on every patient.
The TCRs found on different T cells that are specific for
the same antigen often share gene segment usage and show
homology in the junctional region." When the TCR junctional regions of the expansions in the patients are aligned,
there is no clear homology between sequences. This is not
suprising, given that they are from both CD4 and CD8 T
cells and their antigen is unknown. If the expansions are
idiotype-specific, they will recognize different peptide sequences, presumably in the context of different major histocompatibility complex molecules. Nevertheless, the
TCRBV6.7a junctional sequences from the CD8 expansion
of donor M.B. suggest shared antigenic specificity. The
whole of the TCRBV6.7a expansion is derived from two
different TCR sequences and, therefore, two separate T-cell
clones. Although the nucleotide sequences of the two clones
differ by three bases, the translated amino acid sequence is
identical. The junctional region of the TCR includes nucleo-
tides added at random and is highly variable; thus, the
chances of this happening at random are extremely small.
This implies strongly that the conservation is the result of
selection for TCRs recognizing the same antigen. Whether
or not this antigen may be derived from the paraprotein is
unknown, but an example of conserved murine TCR sequences recognizing an Ig fragment has been reported.''
To gain some idea as to their possible function, we characterized the membrane phenotype of the T-cell expansions.
The expansions observed in normal individuals have been
mainly within the CD28-CDI lb" or CD45RO subset."' Although most expansions showed some heterogeneity, the majority expressed CD45RA rather than CD45R0, implying
that they may be derived from naive populations of T cells.
CDI l b was also regularly expressed, and CD8'CDI Ib' T
cells are known to be increased in paraproteinemia" and
appear to correlate with disease progression, being higher
in MM than in monoclonal gammopathy of undetermined
significance. CD57' expression was increased on both CD4
and CD8 T cells in patients, although the function of CD57'
T cells remains obscure.
Three of the patients with myeloma had expansions within
the CD4 subset. Sequence analysis showed that 2 were oligoclonal, with 91% of sequences derived from a single clone
in 1 case. Excluding malignant disease, clonal expansions of
CD4 T cells have only been reported in some large granular
lymphocyte proliferations and in a recent report of patients
with early rheumatoid a r t h r i t i ~ .Clonal
'~
expansions of CD4 +
T cells were not observed in the elderly control population
in this report or in the control groups in other studies,'.17
suggesting that the expansions may be directly related to the
paraproteinemia. It was initially felt that there were no clear
abnormalities in CD4 T-cell function in MM," although an
increase in the CD45RO subset occurs'' and is related to the
stage of disease.'" One report described CD4 cells able to
bind purified autologous F(ab')* fragments, although this was
ociated with any apparent clonal T-cell expansion."
More recently idiotype-reactive T cells were shown in stageI myeloma and were found to behave with properties suggestive of CD4Thl cells."
The membrane phenotype of the CD4 expansion within
patient H.R. is revealing because it is largely CD28-. This
unusual subset represents less than 1 .O% of CD4+ T cells in
normal individuals and has been shown to have a granular
phenotype and restricted TCR expression.23 Interestingly,
CD4' large granular lymphocyte expansions have been described in association with B-cell proliferation^.^^ The function of this subset is unknown, although the cells can proliferate in alloreactive stimulations and can bind to the K562
cell line, suggesting some relationship with natural killer
cells.*'
A recent report has suggested a mechanism that may explain the coexistence of expansions within the CD4 and
CD8 subsets observed in our patientsz6 CD8' T cells can
recognize and kill autologous CD4' T cells by recognition
of the TCR &chain; therefore, it is possible that the oligoclonal CD8 cells observed in patients are involved in suppressing the growth of the expanded, possibly idiotype-redctive, CD4 T cells. If the T-cell expansions are indeed related
to the paraproteinemia, it i s possible that some of the expan-
From www.bloodjournal.org by guest on November 24, 2014. For personal use only.
CLONAL T CELLS IN PATIENTS WITH PARAPROTEINEMIA
sions observed in apparently healthy individuals are also
related to occult paraproteinemia. The incidence of paraproteinemia in any population is related to the sensitivity of the
method used for detection. Recent reports have suggested
that up to 8% of people over 55 years old have a paraprotein
detectable by immunofixation.” Our healthy control population was screened for a paraprotein, and 1 individual had a
monoclonal IgG band without background immunosuppression. No T-cell expansion was detected in this subject, but
it is noteworthy that this was the only control individual that
had a CD4:CD8 ratio less than 1:1, emphasizing that an
inversion in this ratio is often observed in benign paraproteinemia. Nevertheless, it is likely that T-cell expansions
may also arise from prolonged exposure to antigens, particularly viruses.
It is not clear if the clonal CD8 T cells are classical cytotoxic cells or if they may act in an immunoregulatory or
myelosuppressive role. Mononuclear cells from MM can
suppress pokeweed mitogen-induced Ig synthesis,” and cells
of similar phenotype can suppress bone marrow hematopoie-
is.*^
We have shown that clonal expansions of CD4 and CD8 T
cells are observed in the PB of patients with paraproteinemia.
These expansions are relatively stable over time and, from
the evidence of one case, may show selection for a particular
antigen. At present, the function of these populations is unclear but is the subject of investigation by several groups.30
Once their role has been determined, it may be possible to
specifically expand or deplete such T-cell populations in
vivo to see whether this can influence the clinical course of
the paraproteinemias.
ACKNOWLEDGMENT
We thank Prof H. Wigzell, Dr J. Grunewald, and Dr A. Osterborg
(Karolinska Institute, Stockholm, Sweden) for sending blood samples for our preliminw studies, Drs Emerson, Wainscoat, Littlewood, and Bunch (Department of Haematology, Churchill Radcliffe Hospital, Oxford, UK) for allowing their patients to enter the
study, and Dr H. Chapel (Department of Immunology, Churchill
Radcliffe Hospital) for serum electrophoresis.
REFERENCES
1. Crawford J, Eye MK, Cohen HJ: Evaluation of monoclonal
gammopathies in the ‘well’ elderly. Am J Med 82:39, 1987
2. Kyle RA: Monoclonal gammopathy of undetermined significance. Blood Rev 8:135, 1994
3. Mills KHG, Cawley JC: Abnormal monoclonal antibody-defined helpedsuppressor T-cell subpopulations in multiple myeloma:
Relationship to treatment and clinical stage. Br J Haematol 53:271,
1983
4. Bassan R, Pronesti M, Buzzeti M, Allavena P, Rambaldi A,
Mantovani A, Barbui T: Autoimmunity and B cell dysfunction in
chronic proliferative disorders of large granular lymphocyteslnatural
killer cells. Cancer 63:90, 1989
5. Hanada T, Ishida T, Kojima H, Tsuchiya T: Granular lymphocyte leukaemia in association with multiple myeloma. Br J Haematol
80:127, 1992
6. Massaia M, Bianchi A, Attisano C, Peola S, Redoglia V, Dianzani U, Pileri A: Detection of hyperreactive T cells in multiple
myeloma by multivalent cross-linking of the CD3RCR complex.
Blood 78:1770, 1991
7. Janson CH, Grunewald J, Osterborg A, DerSimonian H, Bren-
3305
ner MB, Mellstedt H, Wigzell H: Predominant T cell receptor V
gene usage in patients with abnormal clones of B cells. Blood
77:1776, 1991
8. Posnett DN, Sinha R, Kabak S, Russo C: Clonal populations of
T cells in normal elderly humans: The T cell equivalent to “Benign
monoclonal gammopathy.” J Exp Med 179:609, 1994
9. Clarke GR, Humphrey CA, Lancaster FC, Boylston AW: The
human T cell antigen receptor repertoire: Skewed use of Vg gene
families by CD8’ T cells. Clin Exp Immunol 96:364, 1994
10. Hingorani R, Choi I-H, Akolkar P, Gulwani-Akolkar B, Pergolizzi R, Silver J, Gregersen PK: Clonal predominance of T cell
receptors within the CDS+CD45RO’ subset in normal human subjects. J Immunol 151:5762, 1993
11. Moss PAH, Moots RJ, Rosenberg WMC, Rowland-Jones SJ,
Bodmer HC, McMichael AJ, Bell JI: Extensive conservation of (Y
and p chains of the human T-cell antigen receptor recognising HLAA2 and influenza A matrix peptide. Proc Natl Acad Sci USA
88:8987, 1991
12. Callahan J E, Kappler J W, Marrack P Unexpected expansions of CD8-bearing cells in old mice. J Immunol 151:6657, 1993
13. Wen T, Mellstedt H, Jondal M: Presence of clonal T cell
populations in chronic B lymphocytic leukaemia and smouldering
myeloma. J Exp Med 171:659, 1990
14. Snodgrass HR, Fisher AM, Bruyns E, Bogen B: Restricted
ab receptor gene usage of idiotype-specific major histocompatibility
complex-restricted T cells: Selection for CDR3-related sequences.
Eur J Immunol22:2169, 1992
15. Omede P, Boccadoro M, Gallone G, Frieri R, Battaglio S,
Redoglia V, Pileri A: Multiple myeloma: Increased circulating lymphocytes carrying plasma cell-associated antigens as an indicator of
poor survival. Blood 76:1375, 1990
16. Dianzani U, Pileri A, Boccodora M, Palumbo A, Pioppo P,
Bianchi A, Camponi A, Fossati G, Battaglio S, Massaia M: Activated
idiotype-reactive cells in suppressor/cytotoxic subpopulations of
monoclonal gammopathies: Correlation with diagnosis and disease
status. Blood 72:1064, 1989
17. Goronzy JJ, Bartz-Bazzanella P, Hu W, Jendro MC, WalserKuntz DR, Weyland CM: Dominant clonotypes in the repertoire of
peripheral CD4+ T cells in rheumatoid arthritis. J Clin Invest
94:2068, 1994
18. Pem RT, Oken MM, Kay NE: Enhanced T cell suppression
is directed toward sensitive circulating B cells in multiple myeloma.
J Lab Clin Med 99:512, 1982
19. Serra HM, Mant MJ, Ruether BA, Ledbetter JA, Pilarski LM:
Selective loss of CD4+, CD45R’ T cells in peripheral blood of
multiple myeloma patients. J Clin Immunol 8:259, 1988
20. Pilarski LM, Andrews EJ, Seera HM, Ledbetter JA. Ruether
BA, Mant MJ: Abnormalities in lymphocyte profile and specificity
repertoire of patients with Waldenstrom’s macroglobulinaemia, multiple myeloma and IgM monoclonal gammopathy of undetermined
significance. Am J Hematol 30:53, 1989
21. Osterborg A, Janson CH, Bergenbrant S , Holm G, Lefvert
A-K, Wigzell H, Mellstedt H: Peripheral blood T lymphocytes in
patients with monoclonal gammopathies: Expanded subsets as depicted by capacity to bind to autologous monoclonal immunoglobulins or reactivity with anti-V gene-restricted antibodies. Eur J Haemato1 47:185, 1991
22. Osterborg A, Yi Q, Bergenbrant S, Holm G, Lefvert A-K,
Mellstedt H: Idiotype-specific T cells in multiple myeloma stage I:
An evaluation by four different functional tests. Br J Haematol
89:110, 1995
23. Morishita Y, Sao H, Hansen JA, Martin PJ: A distinct subset
of human CD4+ cells with a limited alloreactive T cell receptor
repertoire. J Immunol 143:2783, 1989
24. Gold JE, Louis-Charles A, Ghali V, Babu A, Little JR, Athan
E, Knowles DM, Zaluky R: T-cell chronic lymphocytic leukaemia.
From www.bloodjournal.org by guest on November 24, 2014. For personal use only.
3306
Unusual morphologic, phenotypic and karyotypic features in association with light chain amyloidosis. Cancer 70:86, 1991
25. Velardi A, Grossi CE, Cooper MD: A large subpopulation
of lymphocytes with T helper phenotype (Leu-3lT4') exhibits the
property of binding to NK cell targets and granular lymphocyte
morphology. J Immunol 134:58, 1985
26. Ware R, Liang H, Braunstein N, Kent J, Wiener E, Pemis B,
Chess L: Human CD8+ T lymphocyte clones specific for T cell
receptor Vp families expressed on autologous CD4' T cells. Immunity 2:177, 1995
27. Aguzzi F, Bergami MR, Gasparro C, Bellotti V, Merlini G:
Occurrence of monoclonal components in general practice: Clinical
implications. Eur J Haematol 48:192, 1992
MOSS ET AL
28. Broder S, Humphrey R, Durm M, Blackman M, Meade 8,
Goldman C, Strober W, Waldmann T: Impaired synthesis of polyclonal (non-paraprotein) immunoglobulins by circulating lymphocytes from patients with multiple myeloma. N Engl J Med 293:887.
1975
29. Vinci G , Vemant J P, Nakazawa M, Zohair M, Katz A, Henri
A, Rochant H, Breton-Gorius J, Vainchenker W: In vitro inhibition
of normal human haematopoiesis by marrow CD3+,CD8',HLADR+,HNKI+lymphocytes. Blood 72: 1616, 1988
30. Massaia M, Attisano C, Peola S, Montacchini L, Omede P,
Corradini P, Ferrero D, Boccadoro M, Bianchi A, Pileri A: Rapid
generation of anti-plasma cell activity in the bone marrow of myeloma patients by CD3 cross-linking. Blood 82: 1787, 1993
`