Document 444505

Mutations of the N-ras Gene in Juvenile Chronic Myelogenous Leukemia
By Jun Miyauchi, Minoru Asada, Michiko Sasaki, Yukiko Tsunematsu, Seiji Kojima, and Shuki Mizutani
Juvenile chronic myelogenous leukemia (JCML), a myelostitutions involvingcodons 12.13, or 61 in six of 20 patients
proliferative disorderofchildhood,isdistinct
from adult(30%).Four of six patients with mutations were in chronic
(CML) and bears resem- phase andthe other two in blast crisis, indicating no appartype chronic myelogenous leukemia
(CMMoL). Since
blanceto chronic myelomonocytic leukemia
ent correlation with disease stage.Most of the patients with
mutations in the N-ras gene have been found at high fremutations were in the older age groupwith poor prognosis,
quencies in CMMoL, but only rarely in CML, we analyzed
although onepatient in the younger age group also harbored
mutations activating the N-ras gene in 20 patients with
the mutation. These data suggest
that N-res gene mutations
JCML. We used the strategy for analysisof gene mutations
may be involved in the pathogenesis andlor prognosis of
based on in vitro DNA amplification by polymerase chain
JCML and provide further evidence that JCML is an entity
reaction (PCR) followed by single-strand conformation poly- distinct from CML.
morphism (SSCP) analysis andlor direct sequence analysis.
0 1994 by The American Societyof Hematology.
Nucleotide sequence analysis showed single nucleotide sub-
J
UVENILE CHRONIC myelogenous leukemia (JCML)
is a rare myeloproliferative disorder of early childhood.
JCML apparently arisesfrom multipotenthematopoietic
stem cells.”3 Although, as its name indicates, this disorder
shares some other clinical findings with adult-type chronic
myelogenous leukemia (CML) withPhiladelphia chromosome (Phl) abnormality,
it is considered to be
a distinct entity
because of the many differences and its uniquefeatures’: (1)
peripheral blood leukocytosis that is not as severe as in CML
andaccompanies monocytosis; (2) elevatedmarrowblast
counts at diagnosis; (3) anemia with increased synthesis of
hemoglobin F and fetal-type erythropoie~is,~possibly
through hypersensitivity to erythropoietin5; (4) thrombocytopenia; (5) elevated serum levels of lysozyme, vitamin B,,,
andimmunoglobulins;(6)
normal karyotype in mostinstances: and, if present, no consistent chromosomal abnormalitieswitha
slight preponderance tomonosomy 7 and
trisomy 8,’ but uniformly no Ph’ chromosome;(7) spontaneous
macrophage-dominant
colony
formation
posin
sibly through autocrine orparacrine production of cytokines,
including interleukin (1L)- 1 andgranulocyte-macrophage
colony-stimulating factor (GM-CSF),9.’o orhypersensitivity
to GM-CSF”; (8) an association with skin rash and neurofibromatosis; (9) rapid progression of disease and poor prognosis; and (10)younger age distribution. These features overlap with those of chronic myelomonocytic leukemia
(CMMoL) and suggest that JCML is similar to, and may be
a variant form of, CMMOL’ or Ph’-negative CML,” which
also overlaps CMMoL.
From the Department of Virology, National Children’s Medical
Research Center, Clinical Laboratory and Department of Pediatrics,
National Children’s Hospital, Tokyo; Urawa Municipal Hospital,
Urawa, Saitama; and the Nagoya First Red Cross Hospital, Nagoya.
Aichi, Japan.
Submitted August 16, 1993; accepted December 8, 1993.
Address reprint requests to Jun Miyauchi, MD, Clinical Laboratory, National Children’s Hospital, 3-35-31 Taishido, Setagaya-ku,
Tokyo 154, Japan.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
“advertisement” in accordance with 18 U.S.C. section 1734 solely to
indicate this fact.
0 1994 by The American Society of Hematology.
0006-4971/94/8308-0030$3.00/0
2248
Among the oncogenes, the ras genes are the most commonly involved in human neoplasm^.'^,'^ It is well known
that, in hematological malignancies, abnormalities predominate in the N-ras gene, and that these are associated with
certain types of disorders. Point mutations of this gene have
been found in approximately 15% to 40% of patients with
acute myelogenous leukemia (AML),15-2‘)109o to 40% of
those with myelodysplastic syndrome (MDS),’6,21-23 and
10%
to
20%
of those
with
acute lymphoblastic leukemia
(ALL).’6.24.2sIn CMMoL, now categorized as a subtype of
MDS in the French-American-British (FAB) classification,
or in Ph’-negative CML, mutations of the N-ras gene have
been found to be a relatively common abnormality (20% to
6090),12.22,23,26,27while they have been only rarely detected in
CML.Ih.28.29 Furthermore, mutations of the N-rus gene have
been found to bean extremely rare abnormality in Ph’-positive acute leukemias,
including
which
suggests that
activation of the N-ras gene is not a major contributor to
the development of Phl-related leukemias.
These considerations raise a question whether activation
of the N-ras gene might play a role in JCML. Although only
smallnumbers
of patientswith
JCMLhave beenstudied19.27.”.’2 and mutations of this gene reported, indicating a
positive role of this gene in JCML, systematic investigations
withalargenumberofpatients
are lacking,presumably
because of the rarity of this disorder. To clarify more precisely the incidence and clinical significance of N-ras gene
mutations in JCML and to disclose the pathogenesis of this
peculiar disorder, DNA samples collected from 20 patients
with JCML, the largest seriesof patients ever studied, were
analyzed, and clinical parameters were correlated
with abnormalities of the N-vas gene.
MATERIALS AND METHODS
Patients. Twenty patients with JCML were studied. Clinical data
of the patients are listed in Table 1. The diagnosis of JCML was
based on a synthesis of data from physical and laboratory examinations,includinghepatosplenomegaly,increasedWBCcountswith
all stages of granulocytic differentiation and with monocytosis, increased ratio of hemoglobin F, elevated serum levels of lysozyme
and vitamin B,?, and absence of Phi-chromosome, because none of
these alone was specific or diagnostic for JCML. Since myeloproliferative disorders associated with monosomy 7 are known to overlap
JCML,”~” and since thereare no established criteria for differential
diagnosis, we included patients with JCML who had monosomy 7.
Blood, Vol 83, No 8 (April 15). 1994: pp 2248-2254
N-RASMUTATIONS IN JCML
2249
Table 1. Summary of Patients and Clinical Data
Liver/
Spleen
(cm)
Outcome
(stage)
[survival
after onset]
3115
4/9
W10
516
312
10115
7112
415
5/3
514
518
415
Alive(CP) I 3 vr.
_ .6 mol
Alive (CP) 15 yr, 1 mol
Alive (CP) I3 yr. 7 mol
Alive (CP) 11 yr, 0 mol
Dead (BC) I10 mol
Dead (CP) l1 yr. 2 mol
Dead (EL) 12 mol
Dead (CP) I3 yr, 10 mol
Dead (CP) I1 yr, 1 mol
Dead (BC! I 8 mol
Dead (BC) 11 yr. 0 mol
Alive (CP) 11 yr. 5 mol
10110
814
Dead (BC) I8 mol
Dead (CP) 16 mol
4/7
5f2
215
12/8
210
Dead (BC) l2 yr, 2 mol
Dead (BC) I2 yr, 6 mol
Dead (BC) 14 mol
Dead (BC) I10 mol
Dead (CP) 14 mol
Peripheral Blood
Patient
No.
Age/Sex
(onset)
l*
2
3
4
5
6
7
8
9'
11
12
2 mo1M
2 mom
2 mo1F
3 mo1M
7 mo1M
8 mo1F
10 mo1F
1 yr/F
1 yrlF
2 yr/F
2 yr1M
2 yr1M
364
347
304
452
351
259
277
443
140
394
40 1
39 1
40 5131.2
1.1
29
2 43.34.5
10 2100.0
4.9
31 69.1 5.0
18 72.218.4
20 44.0 1.3
13
3.5
36.0
24
7.4 1 12.2
6 64.3
2.4
3 59.42.5
53
5.3
40.2
32
2 45.21.7
13'
14
3 yr/M
3 yrlM
456
343
61
35
15
16*
l?*
18
19
20
4 yrlM
4 yrfM
4 yrlM
4 yr1M
5 yr/M
5 vr/F
406
359
254
278
303
226
31
58
89
1
8
3
lo*
RBC PLT
HbF
(%)
(xlO')
WBC
( ~ 1 0 ' ) (xlO')
Mb
Mono
(%l
(%l
LAP
Score
17
16
14
14
12
13
8
8
17
56
17
7
19.3
94
212
31.0
103
126
282
91
223
70
43.0
171
9
103
40.7
73
1
7
22
5
5
4
7
2
0
0
2
1
14
3
2
9.2
61.6
0
0
9 9.2 224
17
28
59.9
31.3
5.8
10.0
6.0
16.8
1.3
11.8
2.4 4 45.7
2.3 2 32.2
5
3
8
0
15
18
26
14
8
38
5.5
3.5
Bone
Marrow
Mb(%)
226
12.6
207
35.0
203
ND
24.6
100
213
5
10
4
9
0
8
4
1
5
25
27
2
Serum
Lysozyme
(pg/mL)
19.2
31.4
57.5
ND
11.3
86.8
ND
20.8
21.1
24.8
10.8
~
Chromosome
Normal
Normal
Normal
Normal
45, XY. -7
ND
Normal
Normal
Normal
ND
Normal
46, XY, del(7)
(q22)
Normal
46, XY, inv(4)
(~14~16)
Normal
Normal
Normal
45, XY. -7
Normal
29.6
Patients with mutations of the N-ras gene.
Source of DNA. Peripheral blood or bone marrow was obtained
after receiving informed consent, and mononuclear cells were isolated by density sedimentation. Total DNA was prepared by lysis
of the cells with sodium dodecyl sulfate (SDS) and digestion with
proteinase K at 37°C overnight followed by phenollchloroform extraction and ethanol precipitation. Because patients no. 5, 7, 10, 11,
16, and 17 were autopsy cases and fresh cells were not available,
DNA was extracted from formalin-fixed paraffin-embedded 10-pm
thick tissue sections according to the method described by Goelz et
al.'4 Lymph nodes with diffuse leukemic cell infiltration at autopsy
and, when available, those obtained by biopsy in chronic phase were
used. The DNA extracted from paraffin-embedded tissue sections
was purified by using a silica-binding product (Geneclean; Bio 101,
La Jolla, CA) before applying it for polymerase chain reaction
(PCR).
PCR arnpl$cation. Two genomic regions encompassing codons
12/13 and 61 in exons 1 and 2, respectively, were amplified by PCR
using two sets of 20-bp synthetic oligodeoxynucleotide primer^.'^
The primers used for these amplifications were sense S'CTGGTGTGAAATGACTGAGT3' and antisense S'GGTGGGATCATATTCATCTA3' for exon 1, and sense 5'GlTATAGATGGTGAAACCTG3' and antisense 5'ATACACAGAGGAAGCClTCG3' for exon
2. Biotinylated primers were also used instead of one of theunlabeled
primers. These biotinylated primers, prepared according to the published sequences,35 are sense S'GCTCGCAATTAACCCTGATTAC3' for exon 1 and antisense S'GAClTGCTATTATTGATGGCAA3' for exon 2. A total of 500 ngof genomic DNA was
amplified in a 25-pL reaction buffer containing 20 pm01of each
primer, 200 pmol/L of deoxynucleotide triphosphate, 1.5 mmoVL of
MgCI,, and 1 U of Taq polymerase (AmpliTaq; Takara Biomedicals,
Kyoto, Japan). DNA was denatured at 97°C for 7 minutes, then
quickly chilled on ice and Taq polymerase added. Reactions were
performed for 30 cycles of denaturation at 94°C(30 seconds), annealing at 58°C (30 seconds), and extension at 72°C (1 minute), followed
by final elongation at 72°C for 12 minutes in athermal cycler (Perkin
Elmer Cetus, Norwalk, CT). Some samples gave undesired reaction
products with different molecular sizes in addition to target products.
The target PCR products from these samples were gel-purified using
a silica-binding product (Geneclean). Approximately 100bp of target
DNA sequences thus obtained was used for subsequent single-strand
conformation polymorphism (SSCP) and/or direct sequence analyses.
SSCP analysis. SSCP analysis was performed according to the
method previously described by Orita et al.%One microliter of the
amplifiedPCR products was subjected to 18 additional cycles of
E R ina 25-pL solution containing 200 pmoVL each of MTP,
dGTF', and dTTP, 1 pL of [a-'*P]dCTP (Amersham, Buckinghamshire, UK; 10 mCi/mL), 20 pmol of sense and antisense primers, 10
~ o U of
L Tris-HC1 (pH 8.3), 50 ~ ~ o of
U KCl,
L 1.5 ~ ~ o of
V L
MgC12, and 1 U of Taq polymerase in a thermal cycler. PCR was
performed under thermal conditions identical to those used for the
first PCR. After amplification, 1 p L of the reaction product was
mixed with 19 pL of a solution of 0.1% SDS and 10 mmoyL of
EDTA. Then, 2 pL of the diluted product was mixed with 2 pL of
a solution of formamide, 20 mmoVL of EDTA, 0.05% bromophenol
blue, and 0.05% xylene cyanol, denatured at 8WC,and directly
applied to a 6% polyacrylamide gel containing 90 mmoVL of Trisborate (pH 8.3), 4 m m o a of EDTA, and 10% glycerol at 4°C.
Direct sequence analysis. For direct sequencing, 25 cycles of
asymmetric E R , using a 50 to 100 reduction of one of the primers
MlYAUCHl ET AL
2250
1 2 3 4 5 6 7 8 9 1 0 1 1 1 2 1 3 N C
Fig 1. SSCPanalysisof PCR products amplified for the region
encompassing codons12 and 13 ofthe N-ras gene. Samples are from
patients no. 6 (lane 11, 15 in chronic phase llane 2). 11 llane 3). 13
(lane 41.1 (lane 5),10 (lane 6). 8 (lane 71.2 (lane 8). 3 (lane 9). 18 (lane
101. 16 in chronic phase (lane 11). 14 (lane 121, and 19 (lane 13). N.
normal control; C, DNA double-strand control without heat denaturation; ds, double strand; ss, single strand.
and 1 pL of the initial PCR products,wereperformedunderthe
same thermal conditions as described earlier. The resulting singlestranded DNA was purified and sequenced by the dideoxynucleotide
terminator method described by Sanger et aL3' using a sequencing
kit (United States Biochemical, Cleveland, OH) and analyzed on a
polyacrylamidegelcontaining 7 moVLurea.Electrophoresis
was
performed at 35 W for 2 hours at roomtemperature, then thegel
wasdriedonfilterpaper
and autoradiography was performed. For
the PCR products amplified usinga set of biotinylated and unlabeled
primers, the single-stranded biotinylated PCR products were separatedfromtheunlabeled
PCR productsusingstreptavidin-coated
magnetic beads (Dynabeads M-280 Streptavidin: Dynal, Oslo, Norway).'* These single-stranded templates were sequenced by the dideoxy chain termination method using a Bca-BEST kit (Takara Biomedicals) and analyzed after polyacrylamide gel electrophoresisand
autoradiography as described earlier.
RESULTS
SSCP analysis of point mutations. For screening of mutations in exons 1 and 2 of the N-rus gene, amplified PCR
products were subjected to SSCP analysis. Figure 1 shows
the results of SSCP analysis on exon 1. A mobility shift of
the single-stranded PCR products was seen with samples
from patients no. IO and 13: normal bands were not evident
in either of these patients. The remaining patients showed a
migration pattern identical to that of normal controls. However, as described later, direct sequencing showed point mutations at codon 13 of the N-rus gene in patient no. 1, who
showed a normal migration pattern in SSCP analysis (Fig
l). This result in SSCP analysis was therefore considered to
be false-negative. Similar false-negativity was also present
in one (no. 17) of 14 patients examined for exon 2 (data
not shown). For this reason, direct sequence analysis was
performed for all samples.
Direct sequence analysis. Direct sequence analysis
showed point mutations at codons 12, 13, or 61 of the N ras gene in six patients. In patient no. I , single nucleotide
substitution at codon 13 from GGT to GAT (amino acid
substitution from glycine to aspartic acid) was detected with
concomitant normal sequences (Fig 2). although SSCP analysis did not disclose this mutation, as described earlier. Peripheral blood cells of this patient 3 years after the initial
examination had the same mutation at codon 13 (data not
shown), although the patient's hematologicalfindings remained well controlled within, or nearly within, the normal
limits during this period. In patient no. 13,a single nucleotide
substitution at codon 12 from GGT to TGT (amino acid
substitution from glycine to cystein) was identified withconcomitant normal sequences (Fig 2). The identical point mutation was also detected in patient no. IO (data not shown).
Two simultaneous point mutations were present at codons
12 and 13 in patient no. 9 (Fig 2).
Codon 61 mutation was identified in patient no. 17 as a
single nucleotide substitution from CAA to CTA
(amino acid
substitution from glutamic acid to leucine) with concomitant
normal sequences (Fig 3). The same point mutation atcodon
61 was also identified in patient no. 16 (data not shown).
Frequency and distribution of N-ras gene mutations in
JCML. The results of sequence analysis are listed in Table
2. The mutations were present in four patients in chronic
phase (no. l , 9, 13, and 16) and in two patients at blast crisis
(no. IO and 17). indicating no particular preponderance of
mutations at certain disease stages. Three patients (no. 7, 15,
and 16) were examined at both chronic-phase andblastcrisis stages. Among these three, onlypatientno. 16 had
the mutation, which was present in the chronic phasebut
disappeared at blast crisis. A comparison of the gene analysis
with clinical information showed no particular clinical parameters thatwere closely relatedtothepresence
of the
N-ras gene mutations (Table l). Regarding prognosis, our
patients could be categorized into two groups with relatively
poor or good prognosis, with a demarcating line in age between those older and younger than 6 months old, respectively: 15 patients excluding one in the older age group died
13 months on average after the onset, whereas four patients
in the younger age group are all alive at an average of 40
months after the onset. Although most (five of six) of the
patients with N-rus gene mutations were in the older age
group, one of the four patients in the younger age group also
harbored the mutation. The number ofpatients examined was
insufficient to allow a statistical analysis of the difference in
frequency of the mutations between the two groups, and the
relevance of the mutations to prognosis remains uncertain.
DISCUSSION
Mutations of the N-rus gene were detected in six of 20
patients (30%) with JCML in the present study. This frequency is similar to the incidence reported for AMLI5-l9or
C M M O L , ~ 'and
. ~ ~is clearly different from that reported for
CML, in which mutations have
been
detected
only
r a r e l ~ . ' ~ This
. ~ " ~result
~
indicates that abnormalities of this
gene are involved in a substantial proportion of patients with
JCML, and supports the view thatJCML is a disorder distinct
from CML and similar to, and possibly a variant of, CMMoL
or Ph'-negative CML. Regarding leukemias, mutations of
the N-ras gene have been reported to occur preferentially in
those that involve monocytic lineage, ie,M4andM5
of
2251
N-RASMUTATIONS IN JCML
Patient I
Normal
Patient 13
Patient 9
G A T C
G A T C
G A T C
C A
T C
3'
T
codon 13 G
Fig 2. Direct sequence analysis of PCR products corresponding t o codons 12 and 13 of the
N-rssgene. Arrowheads indicate
mutated sequences. (Results
shown in the figure were allobtained usinga set of biotinylated
and unlabeled primers).
~
G!
T
codon 12 G
G
A
C
I
G
S
AML in the FAB c l a s s i f i c a t i ~ n ' ~ ~ 'and
~ ' CMMOL.'"'~
~.'~~~~
Our present data on JCML are consistent with this observation, since JCML is a myeloproliferative disorder affecting
primarily the cells of myelomonocytic lineage; spontaneous
macrophage-dominant colony formation in vitro'."9is one
of the most characteristic and unique features of JCML. It
has been suggested that this in vitro spontaneous growth of
leukemia cells is caused by IL-Io or GM-CSF"' secreted in
autocrine or paracrine fashion and, more recently, hypersensitivity to GM-CSF has been suggested to playthe major
role in the pathogenesis of this disorder.'' On the other hand,
the rus genes are known to code for proteins that are associated with plasma membrane, have GTPase activity, and participate in the transduction of signals, including those induced by growth factors."." Taken together, thepoint
mutations in the N-rus gene might affect signal transduction
through GM-CSF and be involved in the establishment of
this unique feature of JCML, although activation of other
oncogenes that also affects GM-CSF signal transduction may
be involved in other patients without abnormalities in the
N-rus gene.
Mutations of the N-rus gene were detected in four patients
PB
in chronic phase and two patients at blast crisis, suggesting
3'
Normal
G A T C
Patient 17
G A T C
A
A
G
codon 61
A
A
C[
PB
CP
G
G
T
C
G
5'
Fig 3. Codon 61 point mutation of the N-ms gene in patient no.
17 detected by directsequence analysis with PCR-amplifiedproducts.
Arrowhead indicates the mutated sequence. (Results shown in the
figure were obtained using
unlabeled primers.)
that apparently there is no correlation between the presence
of N-rus gene mutations and progression to blast crisis. In
patient no. 16, a mutation was present at codon I3 in chronic
phase, but disappeared after blast crisis. The disappearance
of initially detected r n u t a t i ~ n s ' or
~ ~appearance
' ~ ~ ~ ~ ~of~ ~new
~~~
mutations at relapse'"'' has been reported in AML or ALL.
The recent studies reported by Bashey et aL3' who detected
mutations of the N-rus gene in varying proportions of, but
not all, leukemic colonies in vitro, and that reportedby Kubo
et al."" who found polyclonality of rus gene mutations in
AML, suggest that the whole population of cells in a leukemic clone does not harbor the mutations and, therefore, that
the mutations of the N-rus gene are not involved in the initial
step of leukemogenesis. In the case of patient no. 16, it is
Table 2. Summary of N-rssGene Mutations in JCML
Patient
No.
1
2
3
4
5
6
7
8
9
BC 10
11
PB 12
13
14
15
16
17
18
19
PB20
Stage
PB
CP
CP
CP
CP
BC
CP
CP
EL
CP
CP
BC
CP
PB CP
CP
BC
CP
BC
BC
CP
CP
CP
Material
N-ras Mutation
Codon 13, GGT1Glyl-t GATIAspl
BM
BM
LN
PB
LN
LN
BM
BM
LN
LN
-
-
-
Codon 12, GGTIGlyl
Codon 13, GGTIGlyl
Codon 12, GGTIGlyl
-
Codon 12, GGTIGlyl
BM
PB
LN
LN
LN
BM
BM
-
Codon 61, CAAIGlnl
Codon 61, CAAIGlnl
-
--
TGTICysl
GATIAspl
TGTlCysl
-.
TGTlCysl
-
CTAlLeul
CTAlLeul
-
Abbreviations: CP. chronic phase; BC, blast crisis; EL, erythroleukemic phase; PB, peripheral blood; BM, bone marrow; LN, lymph
node.
2252
possible that the disappearance of the cells with the mutation
at blast crisis was caused by the overgrowth of subclones
that did not harbor the mutation. In the case of patient no.
1, in contrast, the same point mutation at codon 13 of the
N-rus gene was detected 3 years after the initial examination,
during which the patient’s hematological features remained
well controlled. Therefore, the presence of mutations of the
N-rus gene alone may not be sufficient to cause aggressive
malignant disease. Evidence for this possibility has been
provided by Finney and Bishop:’ who showed that the activated H-rusl allele is not by itself dominant over the normal
allele, and requires other events, such as amplification of the
mutant allele, to transform cells, and by Cohen and Levinson:’
who demonstrated thatthe transforming activity of
the H-rus gene is regulated by a second single nucleotide
alteration in the last intron.
Clinical information from the patients was compared between those with and without mutations of the N-ras gene
(Table l), but no particular correlations between the presence
of mutations and clinical parameters were noted. Concerning
the prognosis of JCML, data have been provided by other
investigators that there are two subgroups of patients with
JCML, which differ in mortality rates43;these investigators
found that short-term survivors could be predicted based on
initial clinical characteristics, including older age ( 2 2 years).
Another group of investigators also reported a different prognosis between two groups of patients, namely, infants (< 1
year old) with good prognosis and children ( 21 year old)
with poor pr0gnosis.4~Regarding our patients, a clear distinctionwas made between those older and youngerthan 6
months of age, who showed poor and good prognosis, respectively, a finding in agreement with the data described
earlier that older patients have a poor prognosis. Althoygh
most (five of six) of the patients with N-rus gene mutations
were in the older age group, the number of patients was
insufficient for statistical analysis and did not allow a clearcut conclusion as to the prognostic role of N-ras gene mutations in JCML. Nevertheless, it remains possible that the
mutations might play a role in the establishment of a more
malignant nature of the disease in the older age group. On
the other hand, the younger age group may be heterogeneous,
as has been suggested by others: and may include patients
with nonleukemic perturbed hematopoiesis of unknown
cause. However, the presence of a patient with N-ras gene
mutation in the younger age group suggests that these two
age groups are not distinct and that the presence of mutations
of the N-rus gene by itself does not necessarily indicate poor
prognosis. JCML may affect a spectrum of patients ranging
from infants to older children, the former group having neoplasms of less developed malignant nature, possibly because
of a less frequent chance of a second hit to the genes that
cause more aggressive biological behavior.
It is well known that myeloproliferative disorders associated with monosomy7 closely resemble JCML and that there
is substantial overlap between the two.32,33
Although some
investigators suggested the usefulness of elevated fetal hemoglobin as a diagnostic criterion for JCML versus monosomy 7, there have been no widely accepted ways of distin-
MlYAUCHl ET AL
guishing between the two. We therefore includedthree
patients with JCML associated withmonosomy 7 in our
series. Although a slightly lower incidence of mutations of
the N-rus gene inmonosomy 7 syndrome hasbeen reported,” and none of our patients with chromosomal abnormalities including monosomy 7 and a related aberrant karyotype (deletion 7q22) harbored mutations, the significance of
the difference in the frequency of mutations of the N-rus
gene needs to be further clarified.
SSCP analysis detects nucleotide sequence alterations as
electrophoretic mobility shifts of single-stranded nucleic
acids caused by changes in their three-dimensional structure.
Although it has been considered that alterations in nucleotide
sequence may notnecessarily affect electrophoretic mobility,
a perfect concordance with the results of direct sequence
analysis has been d e m o n ~ t r a t e d . ” . However,
~ ~ . ~ ~ we found
false-negativity in SSCP analysis in two of 27 patient samples inthis study. The sensitivity of SSCP and direct sequence analyses, namely, the minimal proportion of abnormal cells detectable by these methods, has been estimated
to be similar, ie, less than 10%.’7”6A5”7”8
In patient no. 1, a
substantial proportion of abnormal cells was present as
judged from the density of mutated and wild-type bands
in direct sequence analysis (Fig 2), indicating that falsenegativity in SSCP analysis is unlikely to be ascribable to
sensitivity. It is known that the conformational changes of
a single-stranded DNA molecule are influenced by the physical environment in the gel, including temperature, concentrations of ions, and solvent^.^' Since we examined different
temperature conditions (room temperature versus 4°C) in our
preliminary experiments, and demonstrated higher resolution
under thelatter condition with our PCR products, electrophoresis was performed at 4°C in the subsequent experiments.
Other physical conditions of electrophoresis that we used,
including 6% acrylamide gel and 10% glycerol, have been
widelyusedby other investigator^.^^^^^.^^ These considerations suggest that the false-negativity that we found in SSCP
analysis is unlikely to be due to technical problems. On the
other hand, the fact that only positive cases in SSCP analysis
have been used for sequence analyses in most studies performed by other investigators suggests that, even if positive
cases yielded results concordant with sequence analyses,
they might have missed false-negative cases in SSCP analysis. In light of our present findings, false-negativity in SSCP
analysis maynot be as rare a phenomenon, as has been
considered, and the determination of nucleotide changes will
be necessary for a precise analysis of gene abnormalities.
ACKNOWLEDGMENT
TheauthorsthankDrs M. Ichikawa, R. Hanada, Y . Kaneko, Y.
Nasu, K. Horio, K. Hattori, and H. Hara for providing patient samples and clinical information.
REFERENCES
1. Altman AJ, Palmer CG, Baehner R L : Juvenile “chronic granu-
locytic” leukemia: A panmyelopathywithprominentmonocytic
involvement and circulating monocyte colony-forming cells. Blood
43:341, 1974
N-RAS MUTATIONS IN JCML
2. Inoue S, Shibata T, Ravindranath Y, Gohle N: Clonal origin
of erythroid cells in juvenile chronic myelogenous leukemia. Blood
69:975, 1987
3. Freedman MH, Estrov Z, Chan HSL: Juvenile chronic myelogeous leukemia. Am J Pediatr Hematol Oncol 10261, 1988
4. Weinberg RS, Leibowitz D, Weinblatt ME, Kochen J, Alter
B P Juvenile chronic myelogenous leukaemia: The only example of
truly fetal (not fetal-like) erythropoiesis. Br J Haematol76:307, 1990
5. Kojima S, Mimaya J, Tonouchi T, Kajitani S: Erythropoiesis
during an erythroblastic phase of chronic myeloproliferative disorder
associated with monosomy 7. Br J Haematol 65:391, 1987
6. Brodeur GM, Dow LW, Williams DL: Cytogenetic features of
juvenile chronic myelogenous leukemia. Blood 53:812, 1979
7. Puchkova GP, Prigogina EL, Feischmann EW, Drosdova TS,
Mayakova SA, Peterson IS: Chromosome abnormalities in chronic
myeloid leukemia in children. Hum Genet 64:257, 1983
8. Estrov Z, Grunberger T, Chan HSL, Freedman MH: Juvenile
chronic myelogenous leukemia: Characterization of the disease using
cell cultures. Blood 67:1382, 1986
9. Bagby GC, Dinarello CA, Neerhout RC, Ridgway D, McCall
E: Interleukin l-dependent paracrine granulopoiesis in chronic granulocytic leukemia of the juvenile type. J Clin Invest 82:1430, 1988
10. Gualtieri RJ, Emanuel PD, Zuckerman KS, Martin G , Clark
SC, Shadduck RK, Dracker RA, Akabutu J, Nitschke R, Hetherington ML, Dickerman JD, Hakami N, Castleberry RP: Granulocytemacrophage colony-stimulating factor is an endogenous regulator of
cell proliferation in juvenile chronic myelogenous leukemia. Blood
74:2360, 1989
11. Emanuel PD. Bates LJ, Castleberry RP, Gualtieri RJ, Zuckerman KS: Selective hypersensitivity to granulocyte-macrophage colony-stimulating factor by juvenile chronic myeloid leukemic hematopoietic progenitors. Blood 77:925, 1991
12. Cogswell PC, Morgan R, Dunn M, Neubauer A, Nelson P,
Poland-Johnston NK, Sandberg AA, Liu E: Mutations of the rus
protooncogenes in chronic myelogenous leukemia: a high frequency
of rus mutations in bcrlabl rearrangement-negative chronic myelogenous leukemia. Blood 74:2629, 1989
13. Barbacid M: rus Genes. Ann Rev Biochem 56:779, 1987
14. Bos JL: rus Oncogenes in human cancer: A review. Cancer
Res 49:4682, 1989
15. Farr CJ, Saiki RK, Erlich HA, McCormick F, Marshall CJ:
Analysis of RAS gene mutations in acute myeloid leukemia by polymerase chain reaction and oligonucleotide probes. Proc Natl Acad
Sci USA 85:1629, 1988
16. Ahuja HG, Foti A, Bar-Eli M, Cline MJ: The pattern of
mutational involvement of rus genes in human hematologic malignancies determined by DNA amplification and direct sequencing.
Blood 75:1684, 1990
17. Radich JP, Kopecky KJ, Willman CL, Weick J, HeadD,
Appelbaum F, Collins SJ: N-rus mutations in adult de novo acute
myelogenous leukemia: Prevalence and clinical significance. Blood
76:801, 1990
18. Vogelstein B, Civin CI, Preisinger AC, Krischer JP, Steuber
P, Ravindranath Y, Weinstein H, Elfferich P, Bos J: RAS gene mutations in childhood acute myeloid leukemia: A Pediatric Oncology
Group study. Genes Chromosomes Cancer 2:159, 1990
19. Farr C, Gill R, Katz F, Gibbons B, Marshall C: Analysis of
rus gene mutations in childhood myeloid leukaemia. Br J Haematol
77:323, 1991
20. Bartram CR, Ludwig W-D, Hiddemann W, Lyons J, Buschle
M, Ritter J, Harbott J, Frohrich A, Janssen JWG: Acute myeloid
leukemia: Analysis of rus gene mutations and clonality defined by
polymorphic X-linked loci. Leukemia 3:247, 1989
2253
21. Yunis JJ, Boot AJM, Mayer MG, Bos J L Mechanism of rus
mutation in myelodysplastic syndrome. Oncogene 4:609, 1989
22. Lyons J, Janssen JWG, Bartram C, Layton M, Mufti GJ:
Mutation of Ki-rus and N-rus oncogenes in myelodysplastic syndromes. Blood 71:1707, 1988
23. Padua RA, Carter G , Hughes D, Gow J, Farr C, Oscier D,
McCormick F, Jacobs A: rus mutations in myelodysplasia detected
by amplification, oligonucleotide hybridization, and transformation.
Leukemia 2303, 1988
24, Neri A, Knowles DM, Greco A, McCormick F, Dalla-Favera
R: Analysis of RAS oncogene mutations in human lymphoid malignancies. Proc Natl Acad Sci USA 859268, 1988
25. Terada N, Miyoshi J, Kawa-Ha K, Sasai H, Orita S , YumuraYagi K, Hara J, Fujinami A, Kakunaga T: Alteration of N-rus gene
mutation after relapse in acute lymphoblastic leukemia. Blood
75:453, 1990
26. Hirsch-Ginsberg C, LeMaistre A, Kantatjian H, Talpaz M,
Cork A, Freireich El, Trujillo JM, Lee MS, Stass SA: rus Mutations
are rare events in Philadelphia chromosome-negativdbcr gene rearrangement-negative chronic myelogenous leukemia, but are prevalent in chronic myelomonocytic leukemia. Blood 76:1214, 1990
27. Gaidano G , Guerrasio A, Serra A, Carozzi F, Cambrin GR,
Petroni D, Saglio G: Mutations in the p53 and rus family genes
are associated with tumor progression of bcrhbl negative chronic
myeloproliferative disorders. Leukemia 7:946, 1993
28. LeMaistre A, Lee MS, Talpaz M, Kantarjian HM, Freireich
ET, Deisseroth Ab, Trujilo JM, Stass SA: Rus oncogene mutations
are rare late stage events in chronic myelogenous leukemia. Blood
73:889, 1989
29. Collins SJ, Howard M, Andrews DF, Agura E, Radich J: Rare
occurrence of N-rus point mutations in Philadelphia chromosome
positive chronic myeloid leukemia. Blood 73:1028, 1989
30. Urbano-Ispizua A, Gill R, Matutes E, Levi S , Wiedemann
LM, Catovsky D, Marshall CJ: Low frequency of rus oncogene
mutations in Philadelphia-positive acute leukemia and report of a
novel mutation H61 Leu in a single case. Leukemia 6:342, 1992
31. Janssen JWG, Steenvoorden ACM, Collard JG, Nusse R: Oncogene activation in human myeloid leukemia. Cancer Res 45:3262,
1985
32. Neubauer A, Shannon K, Liu E: Mutations of the rus protooncogenes in childhood monosomy 7. Blood 77594, 1991
33. Sieff CA, Chessells JM, Harvey BAM, Pickthall VJ, Lawler
SD: Monosomy 7 in childhood: A myeloproliferative disorder. Br J
Haematol 49:235, 1981
34. Goelz SE, Hamilton SR, Vogelstein B: Purification of DNA
from formaldehyde fixed and paraffin embedded human tissue. Biochem Biophys Res Commun 130:118, 1985
35. Bashey A, Gill R, Levi S , Farr CJ, Clutterbuck R, Millar JL,
Pragnell IB, Marshall CJ: Mutational activation of the N-rus oncogene assessed in primary clonogenic culture of acute myeloid leukemia (AML): Implications for the role of N-rus mutation in AML
pathogenesis. Blood 79:981, 1992
36. Orita M, Suzuki Y, Sekiya T, Hayashi K: Rapid and sensitive
detection of point mutations and DNApolymorphism using the polymerase chain reaction. Genomics 5:874, 1989
37. Sanger F, Nicklen S , Coulson AR:DNA sequencing with
chain-terminating inhibitors. Proc Natl Acad Sci USA 745463, 1977
38. Hultman T, Stahl S, Homes E, Uhltn M: Direct solid phase
sequencing of genomic and plasmid DNA using magnetic beads as
solid support. Nucleic Acids Res 17:4937, 1989
39. Senn HP, Jiricny J, Fopp M, Schmid L, Moroni C: Relapse
cell population differs from acute onset clone as shown by absence
ofthe initially activated N-rus oncogene in a patient with acute
myelomonocytic leukemia. Blood 72:931, 1988
2254
40. Kubo K, Naoe T, Kiyoi H, Fukutani H, Kat0 Y, Oguri T,
Yamamori S , Akatsuka Y, Kodera Y, Ohno R: Clonal analysis of
multiple point mutations in the N-ras gene in patients with acute
myeloid leukemia. Jpn J Cancer Res 84:379, 1993
41. Finney R E , Bishop JM: Predisposition to neoplastic transformation caused by gene replacement of H-rasl. Science 260:1524,
1993
42. Cohen JB, Levinson AD: A point mutation in the last intron
responsible for increased expression and transforming activity of the
c-Ha-ras oncogene. Nature 334:119, 1988
43. Castro-Malaspina H,Schaison G, Passe S, Pasquier A, Berger
R, Bayle-weisgerber C, Miller D, Seligmann M, Bernard J: Subacute
and chronic myelomonocytic leukemia in children (juvenile CML):
Clinical and hematologic observations, and identification of prognostic factors. Cancer 54675, 1984
44. Inaba T, Hayashi Y, Kawakami T, Akuta N, Hanada R, Yamamoto K, Tsukimoto I, Okuyama T, Bessho F, Ogura Y, Shitara T,
MlYAUCHl ET AL
Nakahata T, Kaneko T, Oshiro T, Kojima S: Clinical and cytogenetic
analysis of juvenile chronic myelogenous leukemia: A comparison
between infants andyoung children. (Author’s translation) Jpn J
Pediatr Hematol 3:280, 1989
45. Corradini P, Ladetto M, Voena C, Palumbo A, Inghirami G,
Knowles DM, Boccadoro M, Pileri A: Mutational activation of Nand K-ras oncogenes in plasma cell dyscrasias. Blood 81 :2708, 1993
46. Gaidano G, Ballerini P, Gong JZ, Inghirami G, Neri A, Newcomb EW, Magrath IT, Knowles DM, Dalla-Favera R: p53 mutations
in human lymphoid malignancies: Association with Burkitt
lymphoma and chronic lymphocytic leukemia. Proc Natl Acad Sci
USA 885413, 1991
47. Hayashi K: PCR-SSCP: A simple and sensitive method for
detection of mutations in the genomic DNA. PCR Methods Applic
1:34, 1991
48. van Mansfeld ADM, Bos JL: PCR-based approaches for detection of mutated ras genes. PCR Methods Applic 1:21l , 1992
`