You Shall Love the Lord Your God

AAC Accepts, published online ahead of print on 16 September 2013
Antimicrob. Agents Chemother. doi:10.1128/AAC.01504-13
Copyright © 2013, American Society for Microbiology. All Rights Reserved.
1
Multidrug Resistant Transporter Mdr1p Mediated Uptake of a Novel
2
Antifungal Compound
3
4
Affiliations:
5
1 Georgetown University Medical Center, Department of Microbiology & Immunology,
6
7
8
9
10
Washington, DC, 20057, USA.
2 Department of Biostatistics, Bioinformatics and Biomathematics, Lombardi Comprehensive
Cancer Center, Georgetown University Medical Center, Washington
DC, 20057, USA.
3 Chinese Academy of Sciences Key Laboratory of Pathogenic Microbiology and Immunology,
Institute of Microbiology, Beijing, 100190, China.
11
12
By
13
Nuo Sun1, Dongmei Li1, William Fonzi1, Xin Li2, Lixin Zhang3, and Richard Calderone1*
14
*To whom correspondence should be addressed. E-mail: [email protected]
15
16
17
Running title: Overcoming MDR resistance in Candida albicans
18
Key words: Efflux, fluconazole, resistance, MDR, candidiasis
19
20
21
Abstract
22
The activity of many anti-infectious drugs has been compromised by the evolution of
23
multidrug resistant (MDR) pathogens. For life-threatening fungal infections, such as those
24
caused by Candida albicans, overexpression of MDR1, which encodes an MDR efflux pump of
25
the major facilitator superfamily (MFS), often confers resistance to chemically unrelated
26
substances, including the most commonly used azole antifungals. As the development of new
27
and efficacious antifungals has lagged far behind the growing emergence of resistant strains, it is
28
imperative to develop strategies to overcome multidrug resistance. Previous advances have been
29
made mainly to deploy combinational therapy to restore azole susceptibility, which, however,
30
requires coordination of two or more compounds. We observed a unique phenotype in which
31
Mdr1p facilitates the uptake of a specific class of compounds. Among them, we describe a novel
32
antifungal small molecule, Bis [1,6-a:5',6'-g] quinolizinium 8-methyl-salt (BQM) (US Patent
33
Application Serial No.61/793,090,2013) that has potent and broad antifungal activity. Notably,
34
BQM exploits the MDR phenotype in C. albicans to promote the inhibitory effect. Rather than
35
causing an antagonism of MDR strains, it exhibits a highly potentiated activity against a
36
collection of clinical isolates and lab strains that overexpress MDR1. The activity of BQM
37
against MDR1 overexpressed isolates is due to its facilitated intracellular accumulation.
38
Microarray comparisons showed an extensive upregulation of MDR1 as well as polyamine
39
transporters in a fluconazole resistant strain. We then demonstrated that the polyamine
40
transporters augment the accumulation of BQM. Importantly, BQM had greater activity than
41
fluconazole and itraconazole against various fungal pathogens, including MDR A. fumigatus.
42
Thus, our findings offer a paradigm shift to overcome MDR and the promise of improving
43
antifungal treatment, especially in MDR pathogens.
2
44
Introduction
45
Fungi that cause invasive infections are now referred to as the “hidden killers” (1). Mortality
46
due to these infections is similar to drug resistant TB and exceeds malaria (1). Of these
47
pathogens, Candida species have emerged among the top three causes of microbial nosocomial
48
infectious diseases in humans, resulting in 46-75% mortality, and A. fumigatus is the most deadly
49
and frequent mold infection of humans (1, 2). The incidence of candidiasis has increased sharply
50
over the past few decades primarily due to hospital interventions such as cancer chemotherapy,
51
surgery, organ/bone marrow transplantation, and indwelling devices (3). The cost in the US of
52
treating candidiasis infections is ~$2.0 billion per year (4, 5). However, current therapies have
53
led to only modest success in reducing the high mortality rates of invasive fungal infections, in
54
part due to drug toxicity (amphotericin B), a narrow spectrum of activity (echinocandins), or, in
55
the case of the fungistatic triazoles, the selection of CDR1,2, MDR1, or ERG11 over expression
56
or ERG11 mutations in isolates caused by an overdependence of these therapies (6-8).
57
Reduced intracellular accumulation of drugs by genes encoding drug transporters is a
58
prominent mechanism of resistance in Candida strains. Drug transporters, such as the ABC
59
(ATP-binding cassette) transporters, CDR1, CDR2 (Candida Drug Resistance) and an MFS
60
transporter, MDR1 (Multi-Drug Resistance), play key roles in azole resistance as deduced by
61
their high level of expression in the majority of azole-resistant clinical C. albicans isolates (9-
62
11). While ABC transporters depend on ATP as an energy source, MDR1, encoding Mdr1p, is a
63
member of the MFS transporters that use the proton gradient across the cytoplasmic membrane
64
to supply energy for transport (12-14). Mdr1p exports a variety of structurally unrelated
65
compounds, such as fluconazole, benomyl, cerulenin, and brefeldin A (9, 14-16). In drug-
66
susceptible C. albicans strains, MDR1 is expressed at low levels. However, clinical isolates
3
67
consistently overexpressed MDR1 when the patient was continuously treated with fluconazole (8,
68
9, 17). Deletion of MDR1 in these resistant isolates reversed the drug resistance phenotype (18,
69
19). Moreover, engineered overexpression of MDR1 increased resistance (19, 20). In C. albicans,
70
MDR1 overexpression results mainly from gain-of-function mutations in the transcription factor
71
Mrr1p (14, 21).
72
The development of new antifungal therapeutics is crucial. Unfortunately, the antifungal
73
pipeline has slowed down considerably. Most new triazoles are remodeled older versions that do
74
not address the emergence of resistance. With an already narrow list of antifungal drugs,
75
alternate choices become problematic if resistance to triazoles develops during therapy. We
76
believe there is a great need for paradigm shift to exploit the resistant mechanisms for more
77
efficient therapy. In part, our data address this need. We hypothesized that the MDR phenotype
78
conferred by caMDR1 overexpression could be harnessed through the use of MDR1-dependent
79
cytotoxic agents for effective antifungal strategies.
80
81
Materials and Methods
82
83
Strains, strain maintenance, and plasmids
84
All strains used in the present study are listed in Table S1 and were maintained as frozen stocks
85
in 96-well plates and propagated on yeast extract-peptone-dextrose (YPD) agar when needed
86
(1% yeast extract, 2% peptone, 2% glucose, 2% agar).
87
Antifungal susceptibility testing
88
BQM (NSC156627) and all other NSC compounds were provided by the Developmental
89
Therapeutics Program of NIH/NCI. Drug susceptibility testing was carried out in flat bottom, 96-
4
90
well microtiter plates (Greiner Bio One) using the broth microdilution protocol according to the
91
Clinical and Laboratory Standards Institute M-27A methods. Growth inhibition of all strains was
92
evaluated in the presence of drugs and reported as a % inhibition of untreated cells as previously
93
described (22). In brief, overnight cultures were prepared in YPD, washed and ~103 cells/100µl
94
were inoculated into microtiter wells. Growth was evaluated by measuring cell density OD595
95
after 24h of incubation at 30°C. Experiments were repeated at least three times. Data were
96
averaged and statistical significance among treatments determined. MIC determinations were
97
also done with lab stock cultures of azole susceptible and resistant strains. For these experiments,
98
the compounds were tested at the indicated concentrations. Strains were grown as described
99
above. Relative growth was calculated based on OD595 data and visualized using a heatmap.
100
Drop plate assays
101
Growth inhibition was visualized by plating 5 µl of ten-fold serial dilutions of cells onto YPD
102
agar plates containing BQM at the indicated concentrations. Cells were grown overnight in YPD
103
broth at 30°C, washed with saline, and standardized by hemocytometer counts. Plates were
104
photographed and evaluated after 48 h of incubation at 30°C.
105
Accumulation assays of BQM
106
All C. albicans strains were grown at 30°C overnight in YPD medium and washed twice with
107
phosphate-buffered saline (PBS) (pH 7.0). Cells were diluted with RPMI 1640 medium (2%
108
glucose without bicarbonate and buffered with 0.165 M MOPS to pH 7.0) to 108 cells/ml, as
109
determined by hemocytometer and confirmed by plate count. BQM was added at the
110
concentrations indicated in Tables or Figures. 1-ml of each sample was removed after incubation
111
at 200 rpm (30°C) at 0, 15, 30, 45 and 60 min, centrifuged, washed, and suspended in 1ml PBS.
112
200 l of cell suspensions were transferred into 96-well microplates with clear bottoms (Greiner,
5
113
Germany) to measure fluorescence intensity of BQM. To measure requirement for proton
114
gradients, one set of cell suspensions was treated with 20 g/ml CCCP or not treated for 30min
115
before introducing BQM.
116
RNA preparation and microarray
117
All C. albicans strains were grown at 30°C overnight in YPD medium and washed twice with
118
PBS (pH 7.0). Cells were suspended with RPMI 1640 medium. As previously described (23),
119
total RNA was extracted and, the integrity and purity of total RNA were assessed using an
120
Agilent Bioanalyzer (Aglient Technologies) and OD260/280. One-color microarray-based gene
121
expression analysis was done using the Agilent Low Input Quick Amp Labeling kit. C. albicans
122
cDNA synthesis was carried out using 100 ng total RNA, and all other methods were carried out
123
using the manufacturer’s instructions. Hybridization was carried out for 17 h in an Agilent
124
SureHyb hybridization chamber and the microarrays were scanned with an Agilent SCAN
125
Microarray Scanner System using the AgilentHD_GX_1-color 5 M protocol. The microarrays
126
used in this study were designed from assembly 21 of the C. albicans genome using eArray from
127
Agilent Technologies (design ID 017942). A total of 6101 genes (including 12 mitochondrial
128
genes) are represented by two sets of probes, both spotted in duplicate. Probes are randomly
129
distributed. Eight copies of each array were printed on a single slide (8×15,000) and hybridized
130
individually. For each microarray analysis, three independent biological replicates are
131
performed. Tiff format image files were analyzed by Agilent Feature Extraction software.
132
Cyanine 3 intensities were then logarithmically transformed and statistically normalized. BRB
133
Array-Tools was then used for the differential test. In this analysis, we adopted the cutoff for the
134
parametric p-value <0.05 and [fold change] > 2 to determine the significant gene lists, and using
135
FDR as a reference. Genes that were up- or downregulated 2.0 fold were selected and considered
6
136
to be differentially expressed. Gene ontology analysis was performed at the Candida genome
137
database (CGD, www.candidagenome.org).
138
Quantitative real-time PCR
139
We used previously published methods for these experiments (23, 24). Approximately 1 µg of
140
the total RNA was subjected to first-strand cDNA synthesis (QuantiTect Reverse Transcription,
141
Qiagen). Real-time PCR assays were performed with 20-µl reaction volumes that contained 1x
142
iQ SyBR green Supermix (Bio-Rad), including a 0.2 µM concentration of each primer and 8 µl
143
of a 1:8 dilution of each cDNA from each strain. The transcription level of each gene was
144
normalized to 18S rRNA levels. Data are presented as the means ± standard deviations (SD)
145
from three biological replicates. The 2–
146
was used to determine the fold change in gene transcription. The primers used for real-time PCR
147
expression analysis were the following: for 18S rRNA, CGCAAGGCTGAAACTTAAAGG
148
(forward) and AGCAGACAAATCACTCCACC (reverse); For MRR1, ACA CCC AGG GCT
149
AGT ATA GAC (forward) and ACG ACA TCT CCA GAA ACA GAC (reverse).
150
Evaluation of BQM in G. mellonella assays
151
Injection of fungal pathogens and antifungal drugs was performed as described (25, 26). In brief,
152
larvae were obtained from Vanderhorst, Inc.. Sixteen larvae (330±20 mg) were used per group.
153
Each injection of 10 l of C. albicans cells, BQM, or control was performed via a distinct proleg.
154
Larvae were incubated at 37°C, and the number of dead larvae was scored daily. C. albicans
155
inoculum was prepared from overnight cultures grown in YPD. Cells were washed three times in
156
PBS. Cell densities were determined by hemocytometer. Kill curves were plotted and analyzed
157
by the Kaplan-Meier method (GraphPad Prism).
CT
(where CT is the threshold cycle) method of analysis
158
7
159
Results
160
C. albicans overexpressing MDR1 exhibit highly increased susceptibility to a novel small
161
molecule compound, Bis [1,6-a:5',6'-g] quinolizinium 8-methyl-salt with acetic acid (BQM)
162
Clinical isolates consistently overexpressing MDR1 generally demonstrated a multidrug
163
resistant phenotype to azoles including fluconazole as well as an Mdr1p specific substrate,
164
cerulenin (14, 19, 27). However, we have observed that the MDR1 overexpressed strains,
165
compared to drug susceptible isolates, exhibit highly increased susceptibility (~20 fold) to a class
166
of isoquinoline derivatives (Figure S1). Among them, we identified BQM with the most potent
167
antifungal activity (Figure S1). To validate if BQM is active against clinically drug resistant
168
strains, we initially screened 47 isolates of C. albicans listed in Table S1, many of which have
169
mutations in their ERG11 azole target gene or overexpress drug efflux transporters. As expected,
170
isolates with ERG11 mutations or overexpression of transporter (drug efflux) genes, either
171
CDR1/2 and/or MDR1, showed high levels of fluconazole resistance (Figure 1). These strains
172
grew at 32 g/ml fluconazole or higher (Figure 1). Meanwhile, most isolates were susceptible to
173
micafungin at 0.02-0.08 µg/ml. BQM had potent antifungal activity against most of the clinical
174
isolates at a dosage of 3.2µg/ml. Interestingly, we found that many fluconazole-resistant C.
175
albicans strains failed to grow even at 0.2µg/ml of BQM (Figure 1). Consistent with our
176
observation, those strains that were inhibited strongly by BQM uniformly displayed fluconazole
177
resistance associated with MDR1 overexpression. This data indicated that BQM may have an
178
MDR1-overexpression-selective inhibitory property.
179
The hypersusceptibility of these strains to BQM seems counterintuitive as CaMdr1p is a
180
multidrug transporter that causes efflux of a variety of structurally unrelated compounds (14, 19).
181
Conversely, our data indicate that efflux of BQM by CaMdr1p seemed unlikely since MDR
8
182
strains were hypersusceptible to BQM. We hypothesized that enhanced antifungal activity
183
resulted from increased intracellular accumulation of BQM in MDR1 overexpressed isolates. To
184
test this hypothesis, we compared intracellular levels of BQM with its MIC50 values of all
185
isolates described in Figure 1. After a 1 h incubation with 2 g/ml BQM, isolates that showed
186
increased susceptibility to BQM had accumulated more intracellular BQM, suggesting a
187
significant correlation (R2=0.8962) between BQM uptake and susceptibility (Figure 2).
188
189
BQM activity is facilitated by MDR1 overexpression and regulated by the Mrr1p
190
transcription factor
191
We then determined if BQM activity and uptake were MDR1-dependent by comparing the
192
drug susceptibility of a matched pair of fluconazole-susceptible (strain CaS) and fluconazole-
193
resistant (CaMDR) clinical C. albicans isolates. CaS has minimal levels of MDR1 and was
194
initially isolated from an HIV patient with oral candidiasis, while strain CaMDR was isolated
195
from the same patient after a two-year treatment with fluconazole and overexpressed MDR1 (14,
196
19, 27). CaMDR demonstrated a multidrug resistant phenotype. It was resistant to both
197
fluconazole (Figure 3A) and cerulenin (Figure 3B) due to high levels of MDR1 expression.
198
Deletion of MDR1 from CaMDR, strain Camdr , reversed the fluconazole and cerulenin
199
resistant phenotypes (Figure 3A and 3B), while deletion of MRR1 (Camrr ), an activated
200
transcription factor conferring MDR1 overexpression in CaMDR, lead to a greater fluconazole
201
and cerulenin susceptibility (Figure 3A and 3B), consistent with previous findings that MDR1
202
overexpression due to MRR1 gain of expression contributes to fluconazole resistance in CaMDR
203
(14, 18). Both null mutants were susceptible to fluconazole, whereas resistance was partially
204
recovered in the MDR1 reconstituted strain (19).
9
In addition, MDR1 transporter activity
205
correlated well with susceptibility to cerulenin, a Camdr1p specific substrate, as Camdr
and
206
Camrr
207
BQM susceptibility was the precise inverse. BQM showed significantly elevated activity against
208
strains CaMDR and Camdr +MDR compared to CaS (Figure 3C).
completely lost their resistance to cerulenin (Figure 3B). Intriguingly, the pattern of
209
To determine if the hypersusceptibility is associated with intracellular accumulation in these
210
strains, the accumulation of BQM was evaluated in each strain over time. We observed that
211
CaMDR and Camdr +MDR accumulated 70% more BQM than strains deleted of MDR1 or
212
MRR1 (Figure 4). As CaMdr1p utilizes the proton gradient across the plasma membrane as
213
energy for transport (28, 29), we also explored whether BQM uptake was driven by a proton
214
gradient.
215
chlorophenylhydrazone (CCCP) significantly reduced the accumulation of BQM by CaMDR
216
(Figure S2), suggesting that the proton gradient played an important role in the uptake of BQM.
217
Moreover, BQM accumulation was concentration-dependent in CaMDR (Figure S3).
218
Collectively, while MDR transporters expel substrates like fluconazole and cerulenin, we found
219
that BQM had greater activity against MDR C. albicans. The observation correlated with a much
220
higher accumulation of BQM in strains that overexpress MDR1.
Exposure
to
20 g/ml
of
the
uncoupling
agent
carbonyl-cyanide-m-
221
222
MRR1 regulation of MDR1 and polyamine transporters confer the hypersusceptibility to
223
BQM
224
It is noteworthy that in the preceding experiments, disruption of MDR1 did not completely
225
restore BQM susceptibility to strain CaS (Figure 3C). However, strain Camrr was similarly
226
susceptible as CaS to BQM (Figure 3C). Also, like CaS, Camrr accumulated 20% less BQM
227
than Camdr (Figure 4), indicating that in addition to MDR1, MRR1 may regulate other genes
10
228
that contribute to BQM susceptibility. Gain-of-function mutations in MRR1 are the major
229
mechanism of MDR1 overexpression in fluconazole-resistant strains (14). Transcriptional
230
profiling of in vivo DNA binding studies showed that a constitutively active Mrr1p binds to and
231
upregulates numerous direct target genes in addition to MDR1 (14). Indeed, CaMDR had a
232
higher level of MRR1 expression compared to CaS and Camrr
233
expression of the activated allele of MRR1 is sufficient to confer resistance to fluconazole
234
(Figure 6A) and cerulenin (Figure 6B), but resulted in hypersusceptibility to BQM (Figure 6C),
235
indicating that Mrr1p plays a central role in BQM activity. Besides MDR1, other genes are
236
regulated by Mrr1p (14, 30). Therefore, it is more than likely that mechanisms in addition to the
237
MDR1 transporter are involved in the regulation of BQM activity.
(Figure 5). In addition, the
238
To address the role of additional genes in BQM susceptibility, we compared CaS and CaMDR
239
strains by microarray analysis. A total of 409 genes were downregulated in CaMDR compared to
240
CaS (Figure 7 and Table S2), while upregulation of 452 genes was detected in CaMDR,
241
including MDR1 and MRR1 (Figure 8 and Table S3) (cut-off of 2.0 fold, P-value <0.05 and
242
FDR<0.2, n=3). Consistent with previous data (14, 30), a large number of genes with
243
oxidoreductive functions (15%, GOID: 16491, P-value 1.17×10-10), such as IFD6, orf19.7306
244
and CSH1 (all belonging to the aldo-keto reductase family), were upregulated together with
245
MDR1. These genes are involved in the regulation of intracellular redox homeostasis and
246
intracellular levels of reactive oxygen species (ROS). However, the precise function of these
247
genes is currently unknown, and their potential involvement in an oxidative stress response
248
remains speculative (14).
249
Moreover, fifty genes in addition to MDR1 with transmembrane transporter activity were
250
upregulated (11%, GOID: 22804, P-value 9.38 × 10-8) (Figure 8). Strikingly, among these
11
251
transporters, amine/polyamine transmembrane transporters were highly enriched (Figure 8), the
252
majority of which serve as importers for essential nutrients. Notably, many of the
253
amine/polyamine transporters are regulated by Mrr1p (30).
254
Polyamines (such as putrescine, spermidine, and spermine) are essential organic cations
255
required for protein and nucleic acid synthesis and therefore cell growth (31). Fungal cells tightly
256
regulate polyamine homeostasis with polyamine transport (both uptake and efflux) (31).
257
However, much less is known about polyamine transporter proteins and their regulation in C.
258
albicans compared to Saccharomyces cerevisiae, in which the TPO (Transporter of POlyamines)
259
genes have important roles in detoxification and polyamine excretion (32). It is noteworthy that
260
the four TPO genes belong to the Drug: H+ Antiporter-1 (12-transmembrane Spanner; DHA1)
261
family of MFS (32). Remarkably, the CaMDR1 ortholog, ScFLR1 is structurally closely related
262
to the TPO family members, TPO1-TPO4; therefore, caMDR1 and polyamine transporters are
263
very likely related (32). In fact, ten of the S. cerevisiae DHA1 genes have C. albicans orthologs,
264
including the TPO1-TPO4 (Table 1). Polyamine uptake is repressed by high intracellular levels
265
of polyamines (31). Growth in the presence of spermidine led to reduced activity and uptake of
266
BQM (Figure 9), implicating polyamine transporters in the uptake of BQM. In addition,
267
spermine uptake in yeast is thought to be regulated by phosphorylation and dephosphorylation of
268
serine/threonine protein kinases such as scPTK1 and scPTK2 (polyamine transport kinases 1 and
269
2) (33, 34). We found that the C. albicans null mutant of PTK2 conferred increased resistance to
270
BQM (Figure 10). However the ptk2∆ remained susceptible to fluconazole (data not shown).
271
We anticipate that CaMDR1 will exhibit similar functional characteristics with TPO genes in
272
polyamine transport in spite of the fact that substrate specificity varies. In fact, CaMDR was
273
more resistant to spermine compared to Camdr (Figure S4), suggesting that CaMdr1p may act
12
274
in the efflux of excess polyamines. In addition, the ortholog of MDR1 in Schizosaccharomyces
275
pombe
276
(http://www.pombase.org). Collectively, these results indicate that activated Mrr1p promotes
277
expression of MDR1 and multiple polyamine transmembrane transporter genes, which together
278
lead to hypersusceptibility of CaMDR to BQM. However, whether the CaMdr1p transports BQM
279
directly remains to be determined. Additional BQM importers deserve further investigation.
(SPAC17C9.16c)
encodes
a
putative
polyamine
transport
protein
280
281
BQM potently inhibits clinical fungal pathogens
282
Although C. albicans is the leading cause of invasive candidiasis, infections caused by other
283
Candida species have been increasing. These include C. glabrata, C. krusei, and C. parapsilosis,
284
which are inherently more resistant to trizoles. Moreover, A. fumigatus is the most deadly and
285
frequent mold infection of humans (1). We measured antifungal activity of BQM and its
286
derivatives on a range of yeast pathogens, including C. albicans, clinical isolates of C.
287
guilliermondii, C. glabrata, C. tropicalis, C. parapsilosis, C. lusitaniae, C. apicola, C. krusei,
288
and two C. neoformans isolates (Table 2). We determined that BQM showed potent activity
289
against these common invasive fungal pathogens, including a C. krusei strain, which is highly
290
resistant to fluconazole (Table 2). Markedly, these compounds strongly inhibited a number of
291
itraconazole resistant A. fumigatus, the chief cause of invasive aspergillosis (IA). A. fumigatus is
292
intrinsically resistant to fluconazole, while drug-resistant A. fumigatus strains are resistant to
293
itraconazole MIC> 100 g/ml (Table 2). The therapeutic index of BQM activity against our
294
panel of pathogens is about 130-215-fold more active than against mammalian cell lines,
295
implying the mammalian cells may tolerate BQM. Included in our assays are related compounds
296
that also were effective against pathogens but less so against mammalian cell lines. Furthermore,
13
297
consistent with the in vitro data, BQM demonstrated a stronger protective effect against CaMDR
298
infection than CaS (Figure S5) in the wax moth Galleria mellonella infection model (25, 35). A
299
major translational implication of these data is applying BQM as a lead compound to develop
300
antifungal agents in treatment of life-threatening fungal infections as drug resistance is common.
301
Our study reveals a novel function of MDR1 in raising the susceptibility of drug-resistant
302
fungal pathogens to some compounds, such as BQM. Thus, the drug resistance phenotype
303
conferred by a gain-of-function mutation of the transcription factor MRR1 and therefore MDR1
304
overexpression could be harnessed through the use of MDR1-facilitated cytotoxic agents like
305
BQM for effective antifungal strategies. The findings reported here may represent a novel
306
strategy to overcome multidrug resistance, not only in fungal pathogens but also perhaps in
307
bacterial pathogens or even human diseases such as drug resistant cancers.
308
309
Discussion
310
The emergence of multidrug resistance is a global problem that renders current drugs
311
ineffective, which is exacerbated by the shrinking pipeline of antimicrobial agents. Extensive
312
studies on mechanisms of drug resistance indicate difficulties that are not easy to overcome
313
therapeutically. Towards solving the current drug resistance problem, a straightforward option
314
that could extend the usefulness of antimicrobials such as the triazoles is to develop compounds
315
that reverse drug resistance. In fact, the search for inhibitors of MDR pumps has been suggested
316
previously against bacterial and fungal pathogens and human cancers (36-39). Although we
317
found BQM could exploit the drug transporter Mdr1p to increase accumulation, we do not know
318
if efflux pumps are inhibited by BQM.
14
319
An important point resides in the possibility that Mdr1p mediates the direct influx of BQM.
320
ScTPO1, encoding a polyamine transporter of the DHA1 family catalyzes the uptake of
321
polyamines at high pH and excretion at lower pH (40). It is possible that Mdr1p mediates bi-
322
directional transport according to different substrates. However, crystal structure information and
323
detailed functional studies of this transporter are needed to validate this idea. Several indirect
324
effects of overexpression or deletion of CaMdr1p can be imagined such as co-expression of other
325
genes regulated by Mrr1p, modification of membrane permeability, and induction of BQM-
326
influx symporters. Transcriptional profiling of C. albicans indicated that transporter genes were
327
upregulated in an MDR isolate. A closer look at these data revealed that upregulation also
328
included the family of polyamine transporters. Like CaMDR1, these proteins are fungal-specific
329
(41) and amendable to development of new drug targets. Our data provide a unique paradigm to
330
explore the function of distinct drug importers, such as the polyamine transporter, which has
331
been shown to be involved in histatin 5 uptake (31). Interestingly, our data demonstrate that
332
while the ptk2∆ is resistant to BQM, it is susceptible to fluconazole. Compounds directed
333
against these transporters, like BQM should be identified in drug discovery approaches.
334
A final important point resides in the mechanism of action of BQM. We observed that BQM
335
interacted with mitochondria, and induced ROS production. We have also observed that
336
fluorescent BQM co-accumulates in mitochondria with the mitochondrial stain, mitotracker (data
337
not shown). We also observed that several mitochondrial mutants, such as the goa1 and ndh51
338
null mutants (22, 42, 43) showed increased resistance to BQM compared to the wild type control
339
(data not shown). The role of mitochondria in fluconazole susceptibility among Candida spp has
340
been discussed (22, 44). Mitochondrial mutants of Candida glabrata are either resistant or have
341
increased susceptibility to azoles. Thus, it appears that specific mitochondrial mutations
15
342
determine the levels of resistance/susceptibility. The requirements of several mitochondrial
343
proteins in growth, morphogenesis and virulence of C. albicans suggest a promising avenue for
344
further research on their exploitation as drug targets (23, 24, 42, 43, 45). Further mechanistic
345
studies on mitochondria should attract great interest.
346
347
348
349
Figure legends
350
Figure 1. Clinical isolates of Candida albicans overexpressing MDR1 exhibit highly
351
increased susceptibility to BQM. The activity of BQM is compared to fluconazole in 47
352
isolates of C. albicans, many with drug resistance phenotypes. The relative growth was
353
calculated by normalizing cultures to an OD595 after 24 h and compared to the DMSO only
354
control wells. Susceptibility profiles are indicated as color changes from no growth (black) to
355
growth (yellow) for each inhibitor (average of three independent experiments). MDR1
356
overexpressed isolates (in red rectangle) are hypersusceptible to BQM although resistant to
357
fluconazole. Right: strains are clustered according to their susceptibility, source, and/or
358
resistance mechanisms.
359
Figure 2. A scatter plot of intracellular BQM accumulation and MIC50 values of 47 clinical
360
isolates. The x axis represents the MIC50 values of each isolate in g/ml, and the y axis indicates
361
relative accumulation of BQM (measured by its fluorescence) normalized with CaMDR (average
362
of three independent experiments). The MDR1 overexpressing strains are indicated in red. Each
363
point in the scatter plot represents one isolate. R square represents the Pearson correlation of
364
MIC50 and accumulation.
16
365
Figure 3. The susceptibility to BQM and its accumulation in MDR1 overexpressing C.
366
albicans strains is partially MDR1 dependent and regulated by MRR1. (A). MDR1
367
overexpression confers fluconazole resistance. Relative growth of strains CaMDR (MDR1
368
overexpression), and Camdr +MDR (reconstituted from Camdr
369
resistant to fluconazole, while CaS, Camdr
370
(the regulator of MDR1, MRR1 null derived from CaMDR) are more susceptibile to fluconazole.
371
Relative growth is calculated by normalizing cultures to an OD595 after 24 h and compared to the
372
no drug control wells (Mean ± s.d. of three independent experiments). (B) Strain CaMDR and to
373
a lesser extent, Camdr +MDR, are resistant to cerulenin compared to CaS, Camdr , and
374
Camrr . All strains were grown in the presence of varying concentrations of cerulenin and
375
growth recorded as a % of control cultures (mean ± s.d., n=3). (C) Fluconazole-resistant strains
376
are, conversely, hypersusceptible to BQM. Data are presented as the percentage of growth
377
compared with untreated cells (mean ± s.d. of three independent experiments).
378
Figure 4. Increased accumulation of BQM in the MDR1 overexpressing strain CaMDR is
379
abolished in the MRR1 knockout, a null strain lacking the MRR1 gain-of-function allele that is a
380
known regulator of MDR1. Cell samples were removed at 0, 15, 30, 45, and 60 min and each was
381
normalized to an equivalent number of CaMDR cells at 60 min. The value of CaMDR at 60 min
382
was designated as 100%. Mean values from three independent experiments are shown. Error bars
383
indicate standard deviation.
384
Figure 5. Relative expression levels of MRR1 by qRT-PCR measurements (Mean ± s.d. of three
385
independent experiments). N.D., not detected.
386
Figure 6. (A) MRR1gain-of-function confers fluconazole resistance. The strain (mrr1+MRR1*)
387
contains the constitutively activated MRR1 (G997V) and is resistant to fluconazole, while the
with MDR1), which are
(MDR1 null derived from CaMDR), and Camrr
17
388
wild type (MRR1) and mrr1
are susceptible to fluconazole. (B) A Gain-of-function in MRR1
389
confers cerulenin resistance. Data are presented as the percentage growth of strains. Strain
390
mrr1 +MRR* (containing a mutated and overexpressed MRR1) is resistant to cerulenin
391
compared to the mrr1 and a wild type strain containing the non-mutated MRR1 (mean ± s.d. of
392
three independent experiments).
393
BQM. Data are presented as the percentage of growth compared with untreated cells (mean ± s.d.
394
of three independent experiments).
395
Figure 7. Microarray analysis of CaMDR/CaS. Data are presented as a pie chart of functional
396
gene categories (Gene Ontology Term analysis) of downregulated genes in CaMDR compared to
397
CaS. A total of 409 genes were downregulated, defined by a minimum 2-fold decrease of gene
398
expression (cut-off of 2.0 fold, P-value <0.05 and FDR<0.2 of three independent experiments).
399
Figure 8. 452 upregulated genes in CaMDR presented as a pie chart including transmembrane
400
transporters (11%), of which, 5% are polyamine transporters.
401
Figure 9. Spermidine (2mM), a substrate for polyamine transporters reduces BQM accumulation
402
and leads to reduced activity. Spermidine increases the resistance of C. albicans SC5314 to
403
BQM presented as the percentage of growth (left) and reduces the accumulation of BQM (right).
404
Data represent the mean ± s.d. of three independent experiments.
405
Figure 10. The ptk2 null mutant is resistant to BQM, compared to wild type C. albicans SC5314.
406
Relative growth and accumulation shows the PTK2 mutant (PTK2 ) is resistant to BQM (mean
407
± s.d., n=3). Lower panel, drop plate assays (ten-fold serial dilutions of each strain). A
408
representative graph of three independent experiments is shown.
(C) MRR1 gain-of-function confers hypersusceptibility to
409
410
18
411
Table 1. The polyamine transporter family of S. cerevisiae (left) and C. albicans. Orthologs of
412
the latter species are indicated.
S. cerevisiae
C.albicans orthologs
Systematic Name
Standard Name
YBR008C
FLR1
YBR043C
QDR3
orf19.136
YBR180W
DTR1
orf19.553
YHR048W
YHK8
NONE
YIL120W
QDR1
orf19.6992, orf19.508 (QDR1)
YIL121W
QDR2
NONE
YGR138C
TPO2
YLL028W
TPO1
orf19.7148 (TPO2), orf19.341, orf19.6577 (FLU1)
YNL065W
AQR1
orf19.6992, orf19.508 (QDR1)
YNR055C
HOL1
orf19.2517, orf19.1582, orf19.2991 (HOL1), orf19.4889
YOR273C
TPO4
orf19.473 (TPO4)
YPR156C
TPO3
orf19.4737(TPO3), orf19.7148(TPO2)
orf19.5604 (MDR1)
orf19.4737 (TPO3), orf19.6577
413
414
415
416
417
418
419
19
420
Table 2. BQM is active against various fungal pathogens with low toxicity in human cells. MIC
421
values of indicated compounds are shown against a variety of fungal pathogens, including
422
itraconazole-resistant A. fumigatus (lower part of the table). Toxicity is evaluated with three
423
human cells lines. FLC, fluconazole; ITC, itraconazole.
Species
FLC
ITC
403831 BQM
156624 157108 160459
MIC ( g/ml)
C.albicans (SC5314)
0.25
1
0.4
2
1
4
C. guilliermondii
2
1
0.4
2
2
2
C. glabrata
2
0.25
<0.2
1
0.25
0.5
C. tropicalis
0.5
1
0.4
2
2
2
C. parapsilosis
1
2
0.8
4
2
4
C. lusitaniae
2
0.5
<0.2
1
0.5
1
C. apicola
0.25
1
0.4
2
1
2
C.krusei
32
2
0.4
2
2
2
C. neoformans (H99)
4
0.5
0.8
4
1
4
C. neoformans (JEC-21)
2
0.5
<0.2
1
0.25
0.5
A.fumigatus (H11-20)
0.5
1
0.2
2
1
2
A.fumigatus (AF293)
0.5
1
0.2
2
1
2
MDR A.fumigatus RIT2
>100
1
0.2
2
1
2
MDR A.fumigatus RIT3
>100
1
0.2
2
1
2
MDR A.fumigatus RIT5
>100
1
0.2
2
1
2
MDR A.fumigatus RIT8
>100
1
0.2
2
1
2
MDR A.fumigatus RIT10
>100
1
0.2
2
1
2
MDR A.fumigatus RIT11
>100
1
0.2
2
1
2
MDR A.fumigatus RIT14
>100
1
0.2
2
1
2
HepG2 liver cell
80
26
75
64
52
NIH/3T3 Fibroblast cell
96
43
>100
90
80
293T kidney cell
80
24
75
70
60
424
20
425
Acknowlegements
426
We thank Stephen White and the Developmental Therapeutics Program (DTP) of NIH/NCI for
427
providing the research compounds. The authors wish to thank Joachim Morschauser, Theodore
428
White, Dominique Sanglard, Patrice LePape, David Perlin and the Fungal Genetics Stock Center
429
for providing the C. albicans and A. fumigatus strains. We thank David Goerlitz, of the
430
Microscopy & Imaging and the flow cytometry facility at the Georgetown University Lombardi
431
Cancer Center for technical help. This research was supported in part by bridge funds provided
432
by the Georgetown University Biomedical Graduate Organization (BGRO). N.S received a
433
Georgetown University Medical Center (GUMC) Graduate Student Organization (MCGSO)
434
grant to support this research.
435
436
References
437
438
439
440
441
442
443
444
445
446
447
448
449
450
451
452
453
454
455
456
457
458
459
460
461
462
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
Brown GD, Denning DW, Gow NA, Levitz SM, Netea MG, White TC. 2012. Hidden killers: human
fungal infections. Sci Transl Med 4:165rv113.
Chauhan N, Latge JP, Calderone R. 2006. Signalling and oxidant adaptation in Candida albicans and
Aspergillus fumigatus. Nat Rev Microbiol 4:435-444.
Miceli MH, Diaz JA, Lee SA. 2011. Emerging opportunistic yeast infections. Lancet Infect Dis 11:142151.
Miller LG, Hajjeh RA, Edwards JE, Jr. 2001. Estimating the cost of nosocomial candidemia in the
united states. Clin Infect Dis 32:1110.
Gomez J, Garcia-Vazquez E, Espinosa C, Ruiz J, Canteras M, Hernandez-Torres A, Banos V,
Herrero JA, Valdes M. 2010. Nosocomial candidemia at a general hospital: prognostic factors and impact
of early empiric treatment on outcome (2002-2005). Med Clin (Barc) 134:1-5.
Ostrosky-Zeichner L, Casadevall A, Galgiani JN, Odds FC, Rex JH. 2010. An insight into the
antifungal pipeline: selected new molecules and beyond. Nat Rev Drug Discov 9:719-727.
Alexander BD, Johnson MD, Pfeiffer CD, Jimenez-Ortigosa C, Catania J, Booker R, Castanheira M,
Messer SA, Perlin DS, Pfaller MA. 2013. Increasing Echinocandin Resistance in Candida glabrata:
Clinical Failure Correlates With Presence of FKS Mutations and Elevated Minimum Inhibitory
Concentrations. Clin Infect Dis 56:1724-1732.
White TC. 1997. Increased mRNA levels of ERG16, CDR, and MDR1 correlate with increases in azole
resistance in Candida albicans isolates from a patient infected with human immunodeficiency virus.
Antimicrob Agents Chemother 41:1482-1487.
White TC, Marr KA, Bowden RA. 1998. Clinical, cellular, and molecular factors that contribute to
antifungal drug resistance. Clin Microbiol Rev 11:382-402.
Tsao S, Rahkhoodaee F, Raymond M. 2009. Relative contributions of the Candida albicans ABC
transporters Cdr1p and Cdr2p to clinical azole resistance. Antimicrob Agents Chemother 53:1344-1352.
Anderson JB. 2005. Evolution of antifungal-drug resistance: mechanisms and pathogen fitness. Nat Rev
Microbiol 3:547-556.
21
463
464
465
466
467
468
469
470
471
472
473
474
475
476
477
478
479
480
481
482
483
484
485
486
487
488
489
490
491
492
493
494
495
496
497
498
499
500
501
502
503
504
505
506
507
508
509
510
511
512
513
514
515
516
517
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
Cowen LE, Anderson JB, Kohn LM. 2002. Evolution of drug resistance in Candida albicans. Annu Rev
Microbiol 56:139-165.
Cowen LE. 2008. The evolution of fungal drug resistance: modulating the trajectory from genotype to
phenotype. Nat Rev Microbiol 6:187-198.
Morschhauser J, Barker KS, Liu TT, Bla BWJ, Homayouni R, Rogers PD. 2007. The transcription
factor Mrr1p controls expression of the MDR1 efflux pump and mediates multidrug resistance in Candida
albicans. PLoS Pathog 3:e164.
Hiller D, Stahl S, Morschhauser J. 2006. Multiple cis-acting sequences mediate upregulation of the
MDR1 efflux pump in a fluconazole-resistant clinical Candida albicans isolate. Antimicrob Agents
Chemother 50:2300-2308.
Rognon B, Kozovska Z, Coste AT, Pardini G, Sanglard D. 2006. Identification of promoter elements
responsible for the regulation of MDR1 from Candida albicans, a major facilitator transporter involved in
azole resistance. Microbiology 152:3701-3722.
White TC, Holleman S, Dy F, Mirels LF, Stevens DA. 2002. Resistance mechanisms in clinical isolates
of Candida albicans. Antimicrob Agents Chemother 46:1704-1713.
Wirsching S, Michel S, Morschhauser J. 2000. Targeted gene disruption in Candida albicans wild-type
strains: the role of the MDR1 gene in fluconazole resistance of clinical Candida albicans isolates. Mol
Microbiol 36:856-865.
Hiller D, Sanglard D, Morschhauser J. 2006. Overexpression of the MDR1 gene is sufficient to confer
increased resistance to toxic compounds in Candida albicans. Antimicrob Agents Chemother 50:13651371.
Cowen LE, Nantel A, Whiteway MS, Thomas DY, Tessier DC, Kohn LM, Anderson JB. 2002.
Population genomics of drug resistance in Candida albicans. Proc Natl Acad Sci U S A 99:9284-9289.
Dunkel N, Blass J, Rogers PD, Morschhauser J. 2008. Mutations in the multi-drug resistance regulator
MRR1, followed by loss of heterozygosity, are the main cause of MDR1 overexpression in fluconazoleresistant Candida albicans strains. Mol Microbiol 69:827-840.
Sun N, Fonzi W, Chen H, She X, Zhang L, Calderone R. 2013. Azole Susceptibility and Transcriptome
Profiling in Candida albicans Mitochondrial Electron Transport Chain Complex I Mutants. Antimicrob
Agents Chemother 57:532-542.
Chen H, Calderone R, Sun N, Wang Y, Li D. 2012. Caloric restriction restores the chronological life
span of the goa1 null mutant of Candida albicans in spite of high cell levels of ROS. Fungal Genet Biol.
Li D, Chen H, Florentino A, Alex D, Sikorski P, Fonzi WA, Calderone R. 2011. Enzymatic dysfunction
of mitochondrial complex I of the Candida albicans goa1 mutant is associated with increased reactive
oxidants and cell death. Eukaryot Cell 10:672-682.
Cowen LE, Singh SD, Kohler JR, Collins C, Zaas AK, Schell WA, Aziz H, Mylonakis E, Perfect JR,
Whitesell L, Lindquist S. 2009. Harnessing Hsp90 function as a powerful, broadly effective therapeutic
strategy for fungal infectious disease. Proc Natl Acad Sci U S A 106:2818-2823.
Fuchs BB, O'Brien E, Khoury JB, Mylonakis E. 2010. Methods for using Galleria mellonella as a model
host to study fungal pathogenesis. Virulence 1:475-482.
Franz R, Kelly SL, Lamb DC, Kelly DE, Ruhnke M, Morschhauser J. 1998. Multiple molecular
mechanisms contribute to a stepwise development of fluconazole resistance in clinical Candida albicans
strains. Antimicrob Agents Chemother 42:3065-3072.
Cannon RD, Lamping E, Holmes AR, Niimi K, Baret PV, Keniya MV, Tanabe K, Niimi M, Goffeau
A, Monk BC. 2009. Efflux-mediated antifungal drug resistance. Clin Microbiol Rev 22:291-321, Table of
Contents.
Mansfield BE, Oltean HN, Oliver BG, Hoot SJ, Leyde SE, Hedstrom L, White TC. 2010. Azole drugs
are imported by facilitated diffusion in Candida albicans and other pathogenic fungi. PLoS Pathog
6:e1001126.
Schubert S, Barker KS, Znaidi S, Schneider S, Dierolf F, Dunkel N, Aid M, Boucher G, Rogers PD,
Raymond M, Morschhauser J. 2011. Regulation of efflux pump expression and drug resistance by the
transcription factors Mrr1, Upc2, and Cap1 in Candida albicans. Antimicrob Agents Chemother 55:22122223.
Kumar R, Chadha S, Saraswat D, Bajwa JS, Li RA, Conti HR, Edgerton M. 2011. Histatin 5 uptake
by Candida albicans utilizes polyamine transporters Dur3 and Dur31 proteins. J Biol Chem 286:4374843758.
22
518
519
520
521
522
523
524
525
526
527
528
529
530
531
532
533
534
535
536
537
538
539
540
541
542
543
544
545
546
547
548
549
550
551
552
553
554
555
556
557
558
559
560
561
562
563
564
565
566
567
568
569
570
571
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
Gbelska Y, Krijger JJ, Breunig KD. 2006. Evolution of gene families: the multidrug resistance
transporter genes in five related yeast species. FEMS Yeast Res 6:345-355.
Igarashi K, Kashiwagi K. 1999. Polyamine transport in bacteria and yeast. Biochem J 344 Pt 3:633-642.
Kaouass M, Audette M, Ramotar D, Verma S, De Montigny D, Gamache I, Torossian K, Poulin R.
1997. The STK2 gene, which encodes a putative Ser/Thr protein kinase, is required for high-affinity
spermidine transport in Saccharomyces cerevisiae. Mol Cell Biol 17:2994-3004.
Ryan O, Shapiro RS, Kurat CF, Mayhew D, Baryshnikova A, Chin B, Lin ZY, Cox MJ,
Vizeacoumar F, Cheung D, Bahr S, Tsui K, Tebbji F, Sellam A, Istel F, Schwarzmuller T, Reynolds
TB, Kuchler K, Gifford DK, Whiteway M, Giaever G, Nislow C, Costanzo M, Gingras AC, Mitra
RD, Andrews B, Fink GR, Cowen LE, Boone C. 2012. Global gene deletion analysis exploring yeast
filamentous growth. Science 337:1353-1356.
Lewis K. 2001. In search of natural substrates and inhibitors of MDR pumps. J Mol Microbiol Biotechnol
3:247-254.
Tegos G, Stermitz FR, Lomovskaya O, Lewis K. 2002. Multidrug pump inhibitors uncover remarkable
activity of plant antimicrobials. Antimicrob Agents Chemother 46:3133-3141.
Holmes AR, Keniya MV, Ivnitski-Steele I, Monk BC, Lamping E, Sklar LA, Cannon RD. 2012. The
monoamine oxidase A inhibitor clorgyline is a broad-spectrum inhibitor of fungal ABC and MFS
transporter efflux pump activities which reverses the azole resistance of Candida albicans and Candida
glabrata clinical isolates. Antimicrob Agents Chemother 56:1508-1515.
Tan KW, Li Y, Paxton JW, Birch NP, Scheepens A. 2013. Identification of novel dietary
phytochemicals inhibiting the efflux transporter breast cancer resistance protein (BCRP/ABCG2). Food
Chem 138:2267-2274.
Uemura T, Tachihara K, Tomitori H, Kashiwagi K, Igarashi K. 2005. Characteristics of the polyamine
transporter TPO1 and regulation of its activity and cellular localization by phosphorylation. J Biol Chem
280:9646-9652.
Braun BR, van Het Hoog M, d'Enfert C, Martchenko M, Dungan J, Kuo A, Inglis DO, Uhl MA,
Hogues H, Berriman M, Lorenz M, Levitin A, Oberholzer U, Bachewich C, Harcus D, Marcil A,
Dignard D, Iouk T, Zito R, Frangeul L, Tekaia F, Rutherford K, Wang E, Munro CA, Bates S, Gow
NA, Hoyer LL, Kohler G, Morschhauser J, Newport G, Znaidi S, Raymond M, Turcotte B, Sherlock
G, Costanzo M, Ihmels J, Berman J, Sanglard D, Agabian N, Mitchell AP, Johnson AD, Whiteway
M, Nantel A. 2005. A human-curated annotation of the Candida albicans genome. PLoS Genet 1:36-57.
Bambach A, Fernandes MP, Ghosh A, Kruppa M, Alex D, Li D, Fonzi WA, Chauhan N, Sun N,
Agrellos OA, Vercesi AE, Rolfes RJ, Calderone R. 2009. Goa1p of Candida albicans localizes to the
mitochondria during stress and is required for mitochondrial function and virulence. Eukaryot Cell 8:17061720.
McDonough JA, Bhattacherjee V, Sadlon T, Hostetter MK. 2002. Involvement of Candida albicans
NADH dehydrogenase complex I in filamentation. Fungal Genet Biol 36:117-127.
Shingu-Vazquez M, Traven A. 2011. Mitochondria and fungal pathogenesis: drug tolerance, virulence,
and potential for antifungal therapy. Eukaryot Cell 10:1376-1383.
Vellucci VF, Gygax SE, Hostetter MK. 2007. Involvement of Candida albicans pyruvate dehydrogenase
complex protein X (Pdx1) in filamentation. Fungal Genet Biol 44:979-990.
Fonzi WA, Irwin MY. 1993. Isogenic strain construction and gene mapping in Candida albicans. Genetics
134:717-728.
Morio F, Loge C, Besse B, Hennequin C, Le Pape P. 2010. Screening for amino acid substitutions in the
Candida albicans Erg11 protein of azole-susceptible and azole-resistant clinical isolates: new substitutions
and a review of the literature. Diagn Microbiol Infect Dis 66:373-384.
MacCallum DM, Coste A, Ischer F, Jacobsen MD, Odds FC, Sanglard D. 2010. Genetic dissection of
azole resistance mechanisms in Candida albicans and their validation in a mouse model of disseminated
infection. Antimicrob Agents Chemother 54:1476-1483.
Richards TS, Oliver BG, White TC. 2008. Micafungin activity against Candida albicans with diverse
azole resistance phenotypes. J Antimicrob Chemother 62:349-355.
572
23
Figure 1
BQ M
Figure 1. C linical isolates of C andida albicans overexpressing M D R 1
exhibit highly increased susceptibility to B Q M . The activity of BQM is
compared to fluconazole in 47 isolates of C . albicans, many with drug
resistance phenotypes. The relative growth was calculated by normalizing
cultures to an OD595 after 24 h and compared to the DMSO only control wells.
Susceptibility profiles are indicated as color changes from no growth (black) to
growth (yellow) for each inhibitor (average of three independent experiments).
M D R 1 overexpressed isolates (in red rectangle) are hypersusceptible to BQM
although resistant to fluconazole. Right: strains are clustered according to their
susceptibility, source, and/or resistance mechanisms.
R elative accum ulation
ofBQ M (% )
Figure 2
100
R 2= 0.8962
50
0
0.1
1
BQ M M IC 50 (g/m l)
10
Figure 2. A scatter plot of intracellular BQM accumulation and MIC50 values of
47 clinical isolates. The x axis represents the MIC50 values of each isolate in
g/ml, and the y axis indicates relative accumulation of BQM (measured by its
fluorescence) normalized with CaMDR (average of three independent
experiments). The M D R 1 overexpressing strains are indicated in triangles. Each
point in the scatter plot represents one isolate. R square represents the Pearson
correlation of MIC50 and accumulation.
Figure 3A
R elative grow th (% ofC ontrol)
Fluconazole
C aS
C aM D R
C am dr
100
C am dr+M D R
C am rr
50
0
0.1
1
10
100
1000 ( g/m l)
Figure 3. The susceptibility to BQM and its accumulation in MDR1 overexpressing C.
albicans strains is partially MDR1 dependent and regulated by MRR1. (A). MDR1
overexpression confers fluconazole resistance. Relative growth of strains CaMDR (MDR1
overexpression), and C
MDR (reconstituted from C
resistant to fluconazole, while CaS, C
C
with MDR1), which are
(MDR1 null derived from CaMDR), and
(the regulator of MDR1, MRR1 null derived from CaMDR) are more susceptibile
to fluconazole. Relative growth is calculated by normalizing cultures to an OD595 after 24
h and compared to the no drug control wells (Mean ± s.d. of three independent
experiments).
R elative grow th (% ofC ontrol)
Figure 3B
C erulenin
C aS
C aM D R
100
C am dr
C am dr+M D R
C am rr
50
0
0.1
1
10
100
1000 ( g/m l)
(B) Strain CaMDR and to a lesser extent, C
compared to CaS, C
and C
MDR are resistant to cerulenin
. All strains were grown in the presence
of varying concentrations of cerulenin and growth recorded as a % of control
cultures (mean ± s.d., n=3).
R elative grow th (% ofC ontrol)
Figure 3C
BQ M
C aS
100
C aM D R
C am dr
C am dr+M D R
C am rr
50
0
0.01
0.1
1
10 ( g/m l)
(C) Fluconazole-resistant strains are, conversely, hypersusceptible to BQM. Data
are presented as the percentage of growth compared with untreated cells (mean ±
s.d. of three independent experiments).
Figure 4
R elative accum ulation
ofBQ M (% )
C aS
C aM D R
100
C am dr
C am dr+M D R
C am rr
50
0
0
15
30
45
Tim e (m in)
60
Figure 4. Increased accumulation of BQM in the M D R 1 overexpressing strain
CaMDR is abolished in the M R R 1 knockout, a null strain lacking the M R R 1
gain-of-function allele that is a known regulator of M D R 1. Cell samples were
removed at 0, 15, 30, 45, and 60 min and each was normalized to an
equivalent number of CaMDR cells at 60 min. The value of CaMDR at 60 min
was designated as 100%. Mean values from three independent experiments
are shown. Error bars indicate standard deviation.
C
am
am
aM
C
am
dr
+
M
C
C
R
rr

D
dr

R
aS
D
C
R elative expression
Figure 5
10
M RR1
5
N.D.
0
Figure 5. Relative expression levels of M R R 1 by qRT-PCR measurements
(Mean ± s.d. of three independent experiments). N.D., not detected.
R elative grow th (% ofC ontrol)
Figure 6A
Fluconazole
M RR1
100
m rr1
m rr1+M R R 1*
50
0
0.1
1
10
100
1000 ( g/m l)
Figure 6. (A) M R R 1gain-of-function confers fluconazole resistance. The
strain (m rr1+M R R 1*) contains the constitutively activated M R R 1 (G997V)
and is resistant to fluconazole, while the wild type (M R R 1) and mrr1 are
susceptible to fluconazole.
R elative grow th (% ofC ontrol)
Figure 6B
C erulenin
100
M RR1
m rr1
m rr1+M R R 1*
50
0
0.1
1
10
100
1000 ( g/m l)
(B) A Gain-of-function in M R R 1 confers cerulenin resistance. Data are
presented as the percentage growth of strains. Strain mrr1 +MRR* (containing
a mutated and overexpressed M R R 1) is resistant to cerulenin compared to the
mrr1 and a wild type strain containing the non-mutated M R R 1 (mean ± s.d. of
three independent experiments).
R elative grow th (% ofC ontrol)
Figure 6C
BQ M
M RR1
100
m rr1
m rr1+M R R 1*
50
0
0.01
0.1
1
10 ( g/m l)
(C) M R R 1 gain-of-function confers hypersusceptibility to BQM. Data are
presented as the percentage of growth compared with untreated cells (mean ±
s.d. of three independent experiments).
Figure 7
Figure 7.Microarray analysis of CaMDR/CaS. Data are presented as a pie chart
of functional gene categories (Gene Ontology Term analysis) of downregulated
genes in CaMDR compared to CaS. A total of 409 genes were downregulated,
defined by a minimum 2-fold decrease of gene expression (cut-off of 2.0 fold, Pvalue <0.05 and FDR<0.2 of three independent experiments).
Figure 8
Figure 8. 452 upregulated genes in CaMDR presented as a pie chart
including transmembrane transporters (11%), of which, 5% are polyamine
transporters.
Figure 9
B Q MM
BBH
100
SC 5314
100
SC 531 
2m M sperm idine
50
0
0.01
R elative accum ulation
ofBBH
B Q MM (% )
R elative grow th (% ofC ontrol)
P<0.0001
50
0
0.1
1
10 ( g/m l)
SC 5314
SC 5314+
2m M sperm idine
Figure 9. Spermidine (2mM), a substrate for polyamine transporters reduces
BQM accumulation and leads to reduced activity. Spermidine increases the
resistance of C . albicans SC5314 to BQM presented as the percentage of
growth (left) and reduces the accumulation of BQM (right). Data represent the
mean ± s.d. of three independent experiments.
Figure 10
BBBH
Q MM
w ild type
100
PTK 2
50
0
0.01
0.1
10 ( g/m l)
1
100
R elative accum ulation
ofBBH
B Q MM (% )
R elative grow th (% ofC ontrol)
P<0.001
50
0
w ild type
C aM D R
PTK 2
YPD
B Q M 8 g/ml
w ild type
PTK 2
Figure 10. The ptk2 nullmutant is resistant to BQM, compared to wild type C .
albicans SC5314. Relative growth and accumulation shows the PTK2 mutant
(PTK2 ) is resistant to BQM (mean ± s.d., n=3). Lower panel, drop plate assays
(ten-fold serial dilutions of each strain). A representative graph of three
independent experiments is shown.
`