Document 4080

EE-EP 1 648 878 B1
PIPERIDIINIÜHENDID JA NEID SISALDAVAD RAVIMKOOSTISED
Käesolev patenditaotlus nõudleb eesõigust US esialgse patenditaotluse ees
numbriga 60/489,515, mis on esitatud 24. juulil 2003.
1. LEIUTISE VALDKOND
5
Käesolev
leiutis
käsitleb
piperidiiniühendeid,
piperidiiniühendit
efektiivses
koguses sisaldavaid koostisi ja haigusseisundi, nagu valu, ravimise või vältimise
meetodeid, mis hõlmavad piperidiiniühendi efektiivse koguse manustamist seda
vajavale loomale.
2. LEIUTISE TAUST
10
Valu on kõige sagedasem sümptom, mille puhul patsiendid otsivad meditsiinilist
abi ja ravi. Valu võib olla äge või krooniline. Kui äge valu möödub tavaliselt ise,
siis
krooniline
märkimisväärseid
valu
püsib
muutusi
3
kuud
patsiendi
või
kauem
isiksuses,
ning
elustiilis,
võib
põhjustada
funktsionaalsetes
võimetes ja üldse elukvaliteedis (K. M. Foley, Pain, Cecil Textbook of Medicine,
15
1996, 20th ed., 100-107 (J. C. Bennett and F. Plum eds.)).
Peale selle võib kroonilise valu jagada notsitseptiivseks või neuropaatiliseks.
Notsitseptiivne valu hõlmab koevigastustest põhjustatud valu ja põletikust tingitud
valu, nagu artriidiga seotud valu. Neuropaatiline valu on põhjustatud perifeerse
või kesknärvisüsteemi kahjustusest ja see püsib somatosensoorsete impulsside
20
aberrantse töötlemise tõttu. On palju tõendeid selle kohta, et valuimpulsside
töötlemine on seotud nii 1. rühma metabotroopsete glutamaadiretseptorite
(mGluR-de) (M. E. Fundytus, CNS Drugs, 2001, 15, 29-58) kui ka vanilloidiretseptorite aktiivsusega (V. Di Marzo et al., Current Opinion in Neurobiology,
2002, 12, 372-379). mGluR1 või mGluR5 inhibeerimine vähendab valu, nagu on
25
näidatud in vivo ravimisega kas mGluR1 või mGluR5 suhtes selektiivsete
antikehadega, mille tulemusena nõrgenes rottidel neuropaatiline valu (M. E.
EE-EP 1 648 878 B1
2
Fundytus et al., NeuroReport, 1998, 9, 731-735). Samuti on näidatud, et mGluR1
antisense oligonukleotiidi knockdown leevendab nii neuropaatilist kui ka põletikust
tingitud valu (M. E. Fundytus et al., British Journal of Pharmacology, 2001, 132,
354-367; M. E. Fundytus et al., Pharmacology, Biochemsitry & Behavior, 2002,
5
73, 401-410). mGluR5 väikesemolekuliste antagonistide kasutamist valu
leevendamiseks in vivo loommudelites käsitlevad näiteks K. Walker et al.
(Neuropharmacology, 2000, 40, 1-9) ja A. Dogrul et al. (Neuroscience Letters,
2000, 292, 115-118).
Notsitseptiivset valu on traditsiooniliselt ohjatud mitteopioidsete analgeetikumide,
10
nagu
atsetüülsalitsüülhape,
koliinmagneesiumtrisalitsülaat,
atseetaminofeen,
ibuprofeen, fenoprofeen, diflunisaal ja naprokseen, või opioidanalgeetikumide,
nagu morfiin, hüdromorfoon, metadoon, levorfanool, fentanüül, oksükodoon ja
oksümorfoon, manustamisega (samas). Lisaks eespool loetletud ravimitele on
neuropaatilist valu, mida võib olla raske ohjata, ravitud ka epilepsiavastaste
15
ainete (nt gabapentiini, karbamasepiini, valproehappe, topiramaadi, fenütoiini),
NMDA
antagonistide
(postherpeetilise
(nt
neuralgia
ketamiini,
puhul)
dekstrometorfaani),
ning
tritsükliliste
paikse
lidokaiini
antidepressantidega
(nt fluoksetiini, sertraliini ja amitriptüliiniga).
Kusepidamatus (UI) on kontrollimatu urineerimine, mis on üldiselt põhjustatud
20
põietühjendaja(lihase) ebastabiilsusest. UI mõjutab igas vanuses ja igasuguse
füüsilise tervisega inimesi, nii tervishoiuasutustes olevaid kui ka vabalt
ühiskonnas elavaid inimesi. Füsioloogilised põiekontraktsioonid on põhjustatud
suuresti atsetüülkoliini indutseeritud postganglionaarsete muskariinirsetseptorite
sidumiskohtade stimulatsioonist põie silelihastes. UI ravi hõlmab põit lõõgastava
25
toimega ravimite manustamist, mis aitavad kontrollida põietühjendaja(lihase)
üleaktiivsust. UI ravimiseks on kasutatud näiteks antikolinergilisi aineid, nagu
propanteliinbromiid ja glükopürrolaat, ning kombinatsioone silelihasrelaksantidega, nagu ratseemilise oksübutüniini ja ditsüklomiini või antikolinergilise aine
kombinatsioon (vt A. J. Wein, Urol. Clin. N. Am., 1995, 22, 557-577; Levin et al.,
30
J. Urol., 1982, 128, 396-398; Cooke et al., S. Afr. Med. J., 1983, 63, 3; R. K.
Mirakhur et al., Anaesthesia, 1983, 38, 1195-1204). Need ravimid ei ole aga
EE-EP 1 648 878 B1
3
efektiivsed
kõikidel
kontrollimatute
põiekontraktsioonidega
patsientidel.
Antikolinergiliste ravimite manustamine on sellist liiki ravi põhitoeks.
Mitte ühegi UI ravimiseks kaubanduses olemasoleva ravimiga ei ole aga
saavutanud täielikku edu kõikidel UI juhtudega patsientidel, samuti ei ole ravi
5
olnud ilma märkimisväärsete kõrvaltoimeteta. Näiteks võib sageli esineda
uimasust,
suukuivust,
kõhukinnisust,
nägemise
hägustumist,
peavalu,
tahhükardiat ja südamearütmiat, mis on seotud traditsiooniliste UI-vastaste
ravimite antikolinergilise toimega, ja mis mõjutab patsiendi nõustumist raviga.
Siiski,
10
vaatamata
paljudel
patsientidel
sageli
esinevatele
soovimatutele
antikolinergilistele toimetele kirjutatakse ka praegu UI-ga patsientidele välja
antikolinergilisi ravimeid
(The Merck Manual of Medical Information, 1997,
631-634 (R. Berkow ed.)).
Haavandid on haavakesed, mis tekivad siis, kui seedetrakti limaskest on
maohappe või seedemahlade toimel erodeerunud. Haavakesed on tavaliselt
15
hästipiiritletud ümmargused või ovaalsed kolded, mis esinevad peamiselt maos ja
kaksteistsõrmikus. Haavand tekib umbes ühel inimesel kümnest. Haavandid
tekivad tasakaaluhäire tõttu happesekretsiooni faktorite, mida tuntakse ka
“agressiivsete faktoritena”, nagu maohape, pepsiin ja Helicobacter pylori nakkus,
ning paiksete limaskesta kaitsvate faktorite, nagu vesinikkarbonaatioonide, lima ja
20
prostaglandiinide sekretsioon, vahel.
Haavandite ravimine hõlmab tavaliselt agressiivsete faktorite vähendamist või
inhibeerimist. Maohappe neutraliseerimiseks võib kasutada näiteks antatsiide,
nagu alumiiniumhüdroksiid, magneesiumhüdroksiid, naatriumvesinikkarbonaat ja
kaltsiumvesinikkarbonaat.
25
Kuid
antatsiidid
võivad
tekitada
alkaloosi,
mis
põhjustab iiveldust, peavalu ja nõrkust. Antatsiidid võivad mõjutada ka teiste
ravimite imendumist vereringesse ja põhjustada kõhulahtisust.
Haavandite ravimiseks kasutatakse ka H2-antagoniste, nagu tsimetidiin, ranitidiin,
famotidiin ja nisatidiin. H2-antagonistid soodustavad haavandi paranemist,
vähendades maohappe ja seedeensüümide sekretsiooni histamiini ning teiste
4
EE-EP 1 648 878 B1
H2-agonistide toimel maos ja kaksteistsõrmikus. Kuid H2-antagonistid võivad
põhjustada rinnanäärmete suurenemist ja impotentsust meestel, psüühikamuutusi
(eriti eakatel), peavalu, peapööritust, iiveldust, müalgiat, kõhulahtisust, löövet ja
palavikku.
5
Haavandite ravimiseks kasutatakse ka H+,K+-ATPaasi inhibiitoreid, nagu
omeprasool ja lansoprasool. H+,K+-ATPaasi inhibiitorid inhibeerivad ensüümide
produktsiooni, mida magu kasutab happesekretsiooniks. H+,K+-ATPaasi inhibiitorite kasutamisega kaasnevad kõrvaltoimed hõlmavad iiveldust, kõhulahtisust,
kõhukoolikuid, peavalu, peapööritust, unisust, nahalööbeid ja aminotransfe-
10
raaside aktiivsuse mööduvat suurenemist plasmas.
Haavandite ravimiseks kasutatakse ka sukraflaati. Sukraflaat kleepub epiteelirakkudele ja moodustab arvatavasti maopõhjas kaitsekihi, mis soodustab
haavandi paranemist. Kuid sukraflaat võib põhjustada kõhukinnisust, suukuivust
ja mõjutada teiste ravimite imendumist.
15
Kui haavandi tekkepõhjuseks on Helicobacter pylori, kasutatakse ravimiseks
antibiootikume. Antibiootikumravi kombineeritakse sageli vismutiühendite, nagu
vismutsubsalitsülaat ja kolloidne vismuttsitraat, manustamisega. Arvatakse, et
vismutiühendid suurendavad lima ja HCO3--ioonide sekretsiooni, inhibeerivad
pepsiini toimet ja toimivad H. pylori vastaste antibakteriaalsete ainetena.
20
Vismutiühendite kasutamine võib aga suurendada Bi3+-ioonide kontsentratsiooni
plasmas ja mõjutada teiste ravimite imendumist.
Prostaglandiini analoogid, nagu misoprostool, inhibeerivad happesekretsiooni ja
stimuleerivad lima ning vesinikkarbonaadi sekretsiooni ja neid kasutatakse samuti
haavandite ravimisel, eriti haavandite ravimisel patsientidel, kes vajavad
25
mittesteroidseid põletikuvastaseid ravimeid. Kuid prostaglandiini analoogide
efektiivsed suukaudsed annused võivad põhjustada kõhulahtisust ja kõhukrampe.
Peale selle kutsuvad mõned prostaglandiini analoogid esile aborti.
5
EE-EP 1 648 878 B1
Haavandite ravimisel võib kasutada ka mineralokortikoidi karbenoksolooni.
Karbenoksoloon näib muutvat lima koostist ja kogust, tugevdades seeläbi
limaskestabarjääri. Karbenoksoloon võib aga põhjustada Na+-ioonide ja vedeliku
retentsiooni, hüpertensiooni, hüpokaleemiat ja glükoositaluvuse häiret.
5
Muskariinseid kolinergilisi antagoniste, nagu pirensepiin ja telensepiin, võib
samuti kasutada happesekretsiooni vähendamiseks ja haavandite ravimiseks.
Muskariinsete kolinergiliste antagonistide kõrvaltoimed hõlmavad suukuivust,
nägemise hägustumist ja kõhukinnisust
(The Merck Manual of Medical
Information, 1997, 496-500 (R. Berkow ed.); Goodman and Gilman’s The
10
Pharmacological Basis of Therapeutics, 9th ed. 1996, 901-915 (J. Hardman and
L. Limbird eds.)).
Põletikuline soolehaigus (inflammatory bowel disease, IBD) on krooniline haigus,
mille puhul sool muutub põletikuliseks ning mis sageli põhjustab korduvaid
kõhukrampe ja kõhulahtisust. IBD kaheks tüübiks on Crohni tõbi ja haavandiline
15
koliit.
Crohni tõbi, mis võib hõlmata regionaalset enteriiti, granulomatoosset ileiiti ja
ileokoliiti, on sooleseina krooniline põletik. Crohni tõbi esineb võrdselt mõlemast
soost isikutel ja sagedamini Ida-Euroopa päritoluga juutidel. Crohni tõbi algab
enamikel juhtudel enne 30. eluaastat ning peamiselt algab 14. ja 24. eluaasta
20
vahel. Haigus mõjutab tavaliselt sooleseina kogu selle paksuses. Üldiselt
kahjustab haigus peensoole kõige alumist osa (niudesoolt) ja jämesoolt, kuid see
võib esineda ka mis tahes seedetrakti osas.
Crohni tõve varajasteks sümptomiteks on krooniline kõhulahtisus, krampidega
kaasnev kõhuvalu, palavik, söögiisu kaotus ja kehamassi langus. Crohni tõvega
25
kaasnevad tüsistused hõlmavad soolesulguse, ebanormaalsete ühenduskanalite
(fistulite) ja abstsesside teket. Crohni tõbe põdevatel inimestel suureneb
jämesoolevähi tekkerisk. Sageli kaasnevad Crohni tõvega teised haigused, nagu
sapikivid, toitainete väärimendumine, amüloidoos, artriit, episkleriit, aftoosne
stomatiit, sõlmjas erüteem, gangrenoosne püodermia, anküloseeriv spondüliit,
EE-EP 1 648 878 B1
6
sakroiliit, uveiit ja primaarne skleroseeriv kolangiit. Praegusel ajal ei tunta Crohni
tõvele ravi.
Crohni
tõvega
kaasnevaid
krampe
ja
kõhulahtisust
võib
leevendada
antikolinergiliste ravimite, difenoksülaadi, loperamiidi, desodoreeritud oopiumi5
tinktuuri või kodeiiniga. Üldiselt võetakse ravim suukaudselt enne sööki.
Sageli manustatakse Crohni tõve sümptomite ravimiseks laia toimespektriga
antibiootikume. Kui haigus kahjustab jämesoolt või põhjustab abstsesse ning
fistuleid ümber päraku manustatakse sageli antibiootikumi metronidasooli.
Pikaajaline metronidasooli kasutamine võib aga kahjustada närve, mis põhjustab
10
surinat ja torkimistunnet käsivartes ja jalasäärtes. Sulfasalasiin ja keemiliselt
sarnased ravimid võivad kerget põletikku maha suruda, eriti jämesooles. Need
ravimid
on
aga
vähem
efektiivsed
äkiliste
tõsiste
ägenemiste
korral.
Kortikosteroidid, nagu prednisoon, vähendavad palavikku ja kõhulahtisust ning
leevendavad kõhuvalu ja -hellust. Pikaajaline kortikosteroidravi põhjustab aga
15
alati tõsiseid kõrvaltoimeid, nagu kõrge veresuhkru sisaldus, suurenenud
nakkusoht, osteoporoos, veepeetus ja nahahaprus. Ravimid, nagu asatiopriin ja
merkaptopuriin, võivad nõrgendada immuunsüsteemi, kuid patsientidel, kes ei
reageeri teistele ravimitele, on need sageli Crohni tõve ravimiseks efektiivsed.
Need ravimid vajavad tavaliselt aga 3-6 kuud aega, enne kui nad toimet
20
avaldavad ja võivad põhjustada tõsiseid kõrvaltoimeid, nagu allergia, pankreatiit
ja vere valgeliblede arvu vähenemine.
Kui Crohni tõbi põhjustab soolesulgust või kui abstsessid ja fistulid ei parane, võib
olla vajalik haigusest hõlmatud sooleosa kirurgiliselt eemaldada. Operatsioon ei
ravi aga haigust ja põletik kaldub taastuma, kui sool uuesti ühendatakse.
25
Peaaegu pooltel nendest juhtudest on vaja teha kordusoperatsioon (The Merck
Manual of Medical Information, 1997, 528-530 (R. Berkow ed.)).
Haavandiline
koliit on
põletikuliseks
ja
krooniline haigus,
haavandub,
mis
mille puhul jämesool muutub
põhjustab
verise
kõhulahtisuse
juhte,
kõhukrampe ja palavikku. Haavandiline koliit algab tavaliselt 15. ja 30. eluaasta
EE-EP 1 648 878 B1
7
vahel, siiski on vähesel hulgal inimestest esimene atakk 50. ja 70. eluaasta vahel.
Erinevalt Crohni tõvest ei kahjusta haavandiline koliit kunagi peensoolt ja ei
kahjusta soolt kogu selle paksuses. Haigus algab tavaliselt pärakust ja
sigmakäärsoolest ning lõpuks haarab osaliselt või täielikult kogu jämesoole.
5
Haavandilise koliidi tekkepõhjust ei teata.
Haavandilise koliidi ravi on suunatud põletiku ohjamisele, sümptomite vähendamisele ja kaotatud vedeliku ja toitainete asendamisele. Kerge kõhulahtisuse
ravimiseks
manustatakse
antikolinergilisi
ravimeid
ja
väikeses
annuses
difenoksülaati või loperamiidi. Tugevama kõhulahtisuse puhul manustatakse
10
suuremates
annustes
difenoksülaati
või
loperamiidi
või
desodoreeritud
oopiumitinktuuri või kodeiini. Põletiku vähendamiseks võib kasutada sulfasalasiini, olsalasiini, prednisooni või mesalamiini. Haavandilise koliidiga patsientidel,
kes muidu vajaks pikaajalist kortikosteroidravi, on kasutatud remissiooni
säilitamiseks asatiopriini ja merkaptopuriini. Haavandilise koliidi rasketel juhtudel
15
patsient hospitaliseeritakse ja manustatakse intravenoosselt kortikosteroide.
Tõsise pärakuverejooksuga isikud vajavad vereülekannet ja intravenoosset
vedelike manustamist. Kui tekib toksiline koliit ja ravi ebaõnnestub, võib olla
vajalik eemaldada jämesool kirurgiliselt. Kui diagnoositakse vähk, avastatakse
prekantseroossed kahjustused või teeks püsiv krooniline haigus isiku muidu
20
invaliidiks või sõltuvaks kortikosteroidide suurtest annustest, võib teostada
erakorralise operatsiooni. Jämesoole ja päraku täielik eemaldamine ravib
haavandilise koliidi täielikult (The Merck Manual of Medical Information, 1997,
530-532 (R. Berkow ed.), Goodman and Gilman’s The Pharmacological Basis of
Therapeutics, 9th ed., 1996 (J. Hardman and L. Limbird eds.)).
25
Ärritunud soole sündroom (irritable bowel syndrome, IBS) on kogu seedetrakti
motoorika haigus, mis põhjustab kõhuvalu, kõhukinnisust ja/või kõhulahtisust.
IBS-i esineb naistel kolm korda rohkem kui meestel. IBS-i tekitajad, nagu stress,
toit, ravimid, hormoonid või ärritavad tegurid, võivad põhjustada seedetrakti
ebanormaalseid kontraktsioone. IBS-i episoodi ajal muutuvad seedetrakti
30
kontraktsioonid tugevamaks ja sagedasemaks, põhjustades toidu ja rooja kiiret
transporti läbi peensoole, mis tekitab sageli kõhulahtisust. Krambid tekivad
EE-EP 1 648 878 B1
8
jämesoole tugevatest kontraktsioonide tõttu ja valuretseptorite tundlikkuse
suurenemisest jämesooles.
On olemas kaks peamist IBS-i tüüpi. Esimene tüüp, spastilise käärsoole tüüp,
vallandub sageli söömisega ning tavaliselt tekitab perioodilist kõhukinnisust ja
5
-lahtisust koos valuga. Väljaheitesse ilmub sageli lima. Valu võib esineda
pidevate nüride hoogude või krampidena, tavaliselt alakõhus. Spastilise
käärsoole tüüpi IBS-i all kannatavatel isikutel võib esineda ka kõhupuhitust,
kõhugaase, iiveldust, peavalu, väsimust, depressiooni, ärevust ja kontsentreerumisraskusi. Teine IBS-i tüüp põhjustab tavaliselt valulikku kõhulahtisust või -
10
kinnisust. Kõhulahtisus võib alata äkki ja olla äärmiselt pakiline. Sageli tekib
kõhulahtisus varsti pärast sööki ja võib mõnikord tekkida just ärkamisel.
IBS-i ravi hõlmab tavaliselt IBS-iga patsiendi toitumise muutmist. Sageli
soovitatakse, et IBS-iga patsient väldiks ube, kapsast, sorbitooli ja fruktoosi.
Madala rasvasisalduse ja kõrge kiudainesisaldusega dieet võib samuti aidata
15
mõningaid IBS-iga patsiente. Regulaarne füüsiline aktiivsus võib samuti aidata
hoida seedetrakti talitlust korras. Seedetrakti talitlust aeglustavad ravimid, nagu
propanteliin, ei ole üldiselt IBS-i ravis efektiivsed. Kõhulahtisuse korral aitavad ka
kõhulahtisuse vastased ravimid, nagu difenoksülaat ja loperamiid (The Merck
Manual of Medical Information, 1997, 525-526 (R. Berkow ed.)).
20
Sõltuvuse ravimiseks on manustatud teatud raviaineid. US patendis 5,556,838
(Mayer
et
al.)
kirjeldatakse
mittetoksiliste
NMDA-d
blokeerivate
ainete
manustamist koos sõltuvusainetega, et vältida tolerantsuse või võõrutussümptomite arenemist. US patendis 5,574,052 (Rose et al.) kirjeldatakse sõltuvusainete manustamist koos antagonistiga, et osaliselt blokeerida sõltuvusaine
25
farmakoloogilisi toimeid. US patendis 5,075,341 (Mendelson et al.) kirjeldatakse
opioidiagonisti/-antagonisti omadustega aine kasutamist kokaiini ja opiaadisõltuvuse ravimiseks. US patendis 5,232,934 (Downs) kirjeldatakse 3-fenoksüpüridiini manustamist sõltuvuse ravimiseks. US patendis 5,039,680 ja 5,198,459
(Imperato et al.) kirjeldatakse serotoniini antagonisti kasutamist kemikaali-
30
sõltuvuse ravimiseks. US patendis 5,556,837 (Nestler et al.) kirjeldatakse BDNF-i
EE-EP 1 648 878 B1
9
või NT-4 kasvufaktorite infundeerimist neuroloogiliste adaptatiivsete muutuste,
mis sõltlastel korreleeruvad käitumuslike muutustega, inhibeerimiseks või
kõrvaldamiseks. US patendis 5,762,925 (Sagan) kirjeldatakse kapslisse viidud
neerupealise säsi rakkude implanteerimist looma kesknärvisüsteemi, et takistada
5
opiaaditolerantsuse arenemist. US patendis 6,204,284 (Beer et al.) kirjeldatakse
ratseemilist (±)-l-(3,4-diklorofenüül)-3-asabitsüklo[3.1.0]heksaani kasutamiseks
ravimisõltuvusest põhjustatud võõrutussündroomi vältimiseks või leevendamiseks
ja kemikaalisõltuvuse ravimiseks.
Ravita progresseerub Parkinsoni tõbi rigiidseks akineetiliseks seisundiks, mille
10
puhul patsiendid ei ole võimelised enda eest hoolitsema. Surm saabub sageli
liikumisvõimetusest tingitud tüsistuste tõttu, nagu aspiratsioonipneumoonia või
kopsuemboolia. Parkinsoni tõve ravimiseks tavaliselt kasutatavad ravimid
hõlmavad karbidopat/levodopat, pergoliidi, bromokriptiini, selegiliini, amantadiini
ja triheksüülfenidüülvesinikkloriidi. Jääb aga vajadus ravimite järele, mis on
15
kasulikud Parkinsoni tõve ravimiseks ja millel on parem terapeutiline profiil.
Praegu kasutatakse ärevusevastaste ainetena generaliseerunud ärevushäire
korral kõige sagedamini bensodiasepiine. Bensodiasepiinide kasutamisega aga
kaasneb, eriti eakatel, kognitsiooni ja vilumust nõudvate motoorsete funktsioonide
häirumise risk, mis võib põhjustada segasust, deliiriumi ja kukkumistest tingitud
20
luumurde. Ärevuse ravimiseks määratakse sageli ka rahusteid. Mõõduka ärevuse
ravimiseks on kasutatud ka asapiroone, nagu buspiroon. Asapiroonid on aga
vähem kasulikud tõsise ärevuse ravimiseks, millega kaasnevad paanikahood.
Epilepsiahoogude ja epilepsia ravimiseks kasutatavate ravimite näited hõlmavad
karbamasepiini, etosuktsimiidi, gabapentiini, lamotrigiini, fenobarbitaali, fenütoiini,
25
primidooni,
valproehapet,
trimetadiooni,
bensodiasepiine,
γ-vinüül-GABAt,
atsetasoolamiidi ja felbamaati. Epilepsiahoogude vastastel ravimitel on aga
kõrvaltoimed, nagu unisus, hüperaktiivsus, hallutsinatsioonid, kontsentreerumisraskused, kesk- ja perifeerse närvisüsteemi toksilisus, nagu nüstagm, ataksia,
diploopia ja peapööritus, igemete hüperplaasia, seedetraktihäired, nagu iiveldus,
30
oksendamine,
valu
ülakõhus
ja
anoreksia,
endokriinsed
toimed,
nagu
EE-EP 1 648 878 B1
10
antidiureetilise
hormooni
inhibeerimine,
hüperglükeemia,
glükosuuria,
osteomalaatsia ja ülitundlikkus, nagu sarlakitaoline lööve, leetritaoline lööve,
Stevensi-Johnsoni sündroom, süsteemne erütematoosluupus, ja maksanekroos,
ning hematoloogilised reaktsioonid, nagu vere punaliblede aplaasia, agranulotsü5
toos, trombotsütopeenia, aplastiline aneemia ja megaloblastiline aneemia (The
Merck Manual of Medical Information, 1997, 345-350 (R. Berkow ed.)).
Insultide sümptomid varieeruvad sõltuvalt sellest, millises ajuosas see tekib.
Sümptomid hõlmavad ebanormaalset tunnet või tunde kadumist käsivarres või
jalasääres või ühes kehapooles, käsivarre või jalasääre või ühe kehapoole
10
nõrkust või halvatust, nägemise või kuulmise osalist kadu, kahekordset nägemist,
pearinglust, kõnehäireid, raskusi sobivate sõnade leidmise ja väljaütlemisega,
võimetust ära tunda kehaosi, ebatavalisi liigutusi, põiekontrolli kadumist,
tasakaaluhäireid, kukkumist ja minestamist. Sümptomid võivad olla jäädavad ja
nendega võib kaasneda kooma või stuupor. Insuldi ravis kasutatavate ravimite
15
näited hõlmavad antikoagulante, nagu hepariin, trombi lahustavaid ravimeid,
nagu streptokinaas või koe plasminogeeni aktivaator, ja turset vähendavaid
ravimeid, nagu mannitool ja kortikosteroidid (The Merck Manual of Medical
Information, 1997, 352-355 (R. Berkow ed.)).
Kihelus on ebameeldiv aisting, mis sunnib kratsima. Tavaliselt ravitakse kihelust
20
valgusraviga, nagu ultraviolettkiirgus B või PUVA, või raviainetega, nagu
naltreksoon, nalmefeen, danasool ja tritsüklilised antidepressandid.
In vivo loommudelites on näidatud, et metabotroopse glutamaadiretseptori
5 (mGluR5) selektiivsed antagonistid avaldavad analgeetilist toimet (K. Walker
et al., Neuropharmacology, 2000, 40, 1-9; A. Dogrul et al., Neuroscience Letters,
25
2000, 292 (2), 115-118).
Samuti
on
loommudelites
näidatud,
et
mGluR5-retseptori
selektiivsed
antagonistid avaldavad in vivo anksiolüütilist ja depressioonivastast toimet
(E. Tatarczynska et al., Br. J. Pharmacol., 2001, 132 (7), 1423-1430; P. J. M. Will
et al., Trends in Pharmacological Sciences, 2001, 22 (7), 331-37).
EE-EP 1 648 878 B1
11
Samuti on näidatud, et mGluR5-retseptori selektiivsed antagonistid avaldavad in
vivo Parkinsoni tõve vastast toimet (K. J. Ossowska et al., Neuropharmacology,
2001, 41 (4), 413-20; P. J. M. Will et al., Trends in Pharmacological Sciences,
2001, 22 (7), 331-37).
5
Samuti on näidatud, et mGluR5-retseptorite selektiivsed antagonistid avaldavad
in vivo sõltuvusevastast toimet (C. Chiamulera et al., Nature Neuroscience, 2001,
4 (9), 873-74).
Rahvusvahelises publikatsioonis WO 01/027107 kirjeldatakse heterotsükliliste
ühendite rühma, mis on naatriumi-/prootonpumba inhibiitorid.
10
Rahvusvahelises
publikatsioonis
WO
99/37304
kirjeldatakse
asendatud
oksoasaheterotsüklüülühendeid, mis on kasulikud faktor Xa inhibeerimiseks.
US patendis 6,248,756 (Anthony et al.) ja rahvusvahelises publikatsioonis
WO 97/38665
kirjeldatakse
piperidiini sisaldavate
ühendite rühma,
mis
inhibeerivad farnesüüli/proteiini transferaasi (FTaas).
15
Rahvusvahelises
publikatsioonis
WO
98/31669
kirjeldatakse
tsüklilistest
amiinidest saadud aromaatsete amiinide rühma, mis on kasulikud antidepressantidena.
Rahvusvahelises publikatsioonis WO 97/28140 kirjeldatakse 1-(piperasiin-1üül)arüül(oksü/amino)karbonüül-4-arüülpiperidiinist saadud piperidiinide rühma,
20
mis on kasulikud 5-HT1Db-retseptorite antagonistidena.
Rahvusvahelises publikatsioonis WO 97/38665 kirjeldatakse piperidiini sisldavate
ühendite rühma, mis on kasulikud farnesüüli/proteiini transferaasi inhibiitoritena.
US patendis 4,797,419 (Moos et al.) kirjeldatakse uureaühendite rühma
atsetüülkoliini vabanemise stimuleerimiseks ja kasutamiseks vananemisega
EE-EP 1 648 878 B1
12
seotud kognitsiooni halvenemise sümptomite, mida iseloomustab atsetüülkoliini
produktsiooni või vabanemise vähenemine ajus, ravimiseks.
US patendis 5,891,889 kirjeldatakse asendatud piperidiiniühendite rühma, mis on
kasulikud farnesüüli/proteiini transferaasi ja onkogeense valgu Ras farnesüüli5
mise inhibiitoritena.
Publikatsioonis WO 02/18348 kirjeldatakse kinasoliini derivaate kui α1-adrenoretseptorite antagoniste.
Patendis
EP
0
333
025
kirjeldatakse
4-arüül-4-arüüloksüpiperidiinide
1-karbonüülderivaate, mis on kasulikud valu leevendamiseks ja krampide
10
ravimiseks.
Publikatsioonis WO 03/029199 kirjeldatakse benseeni derivaate, millel on
agonistlik toime vanilloidiretseptorisse ja mis on kasulikud analgeetikumidena
pollakisuuria ja kusepidamatuse vältimiseks ja ravimiseks.
Publikatsioonis WO 99/10313 kirjeldatakse n-aroüülfenüülalaniini derivaate, mis
15
toimivad VCAM-1 ja rakke ekspresseeriva VLA-4 vahelise seondumise
inhibiitoritena.
Vastaval alal jääb aga kindel vajadus uute ravimite järele, mis on kasulikud valu,
UI, haavandi, IBD, IBS-i, sõltuvushäirete, Parkinsoni tõve, parkinsonismi,
ärevuse, epilepsia, insuldi, krampide, kiheluse, psühhoosi, kognitiivse häire,
20
mäluhäire, ajutalitluse häire, Huntingtoni korea, ALS-i, dementsuse, retinopaatia,
lihasspasmide, migreeni, oksendamise, düskineesia või depressiooni ravimiseks
või vältimiseks.
Mis tahes selle patenditaotluse osas 2 tsiteeritud viidet ei tule võtta mööndusena,
et selline viide on käesoleva patenditaotluse jaoks tehnika senine tase.
EE-EP 1 648 878 B1
13
3. LEIUTISE KOKKUVÕTE
Käesolev leiutis käsitleb ühendeid valemiga (I)
Ar1
R4
(R3)m
N
X
NH
Ar2
(I)
ja nende farmatseutiliselt vastuvõetavaid sooli, milles
5
Ar1 on
(R2)n
(R2)p
(R2)p
N
N
R1
N
R1
,
(R2)p
N
N S
N
N
R1
,
N
N
R1
R1
, või
or
,
;
Ar2 on
N
NH
N
S
N
O
N
või
(R14)q
R8
R9
, R8
R9
,
R8
X on O, S, N-CN, N-OH või N-OR10,
R9
,
N
(R14)q
;
EE-EP 1 648 878 B1
14
R1 on -H, halogenorühm, -CH3, -NO2, -CN, -OH, -OCH3, -NH2, -C(halogeno)3-,
-CH(halogeno)2- või -CH2(halogeno)rühm,
iga R2 on sõltumatult:
(a) halogenorühm, -OH, -CN, -NO2 või -NH2,
5
(b) -(C1-C10)alküül-, -(C2-C10)alkenüül-, -(C2-C10)alkünüül-, -(C3-C10)tsükloalküül-,
-(C8-C14)bitsükloalküül-,
-(C8-C14)tritsükloalküül-,
-(C5-C10)tsükloalkenüül-,
-(C8-C14)bitsükloalkenüül-, -(C8-C14)tritsükloalkenüül-, -(3-7-lüliline)heterotsükliline
või -(7-10-lüliline)bitsükloheterotsükliline rühm, millest igaüks on asendamata või
asendatud ühe või enama rühmaga R5, või
10
(c) fenüül-, naftüül-, -(C14)arüül- või -(5-10-lüliline)heteroarüülrühm, millest igaüks
on asendamata või asendatud ühe või enama rühmaga R6,
iga R3 on sõltumatult:
(a) halogenorühm, -CN, -OH, -NO2 või -NH2,
(b) -(C1-C10)alküül-, -(C2-C10)alkenüül-, -(C2-C10)alkünüül-, -(C3-C10)tsükloalküül-,
15
-(C8-C14)bitsükloalküül-,
-(C8-C14)tritsükloalküül-,
-(C5-C10)tsükloalkenüül-,
-(C8-C14)bitsükloalkenüül-, -(C8-C14)tritsükloalkenüül-, -(3-7-lüliline)heterotsükliline
või -(7-10-lüliline)bitsükloheterotsükliline rühm, millest igaüks on asendamata või
asendatud ühe või enama rühmaga R5, või
(c) fenüül-, naftüül-, -(C14)arüül- või -(5-10-lüliline)heteroarüülrühm, millest igaüks
20
on asendamata või asendatud ühe või enama rühmaga R6,
R4 on -OH, -OCF3, halogenorühm, -(C1-C6)alküül-, -CH2OH, -CH2Cl, -CH2Br,
-CH2I, -CH2F, -CH(halogeno)2-, -CF3, -OR10, -SR13, -COOH, -COOR10, -C(O)R10,
-C(O)H, -OC(O)R10, -OC(O)NHR10, -NHC(O)R13, -CON(R13)2, -SO2R10 või NO2,
EE-EP 1 648 878 B1
15
iga R5 on sõltumatult -CN, -OH, -(C1-C6)alküül-, -(C2-C6)alkenüül-, halogenorühm,
-N3, -NO2, -N(R7)2, -CH=NR7, -NR7OH, -OR7, -COR7, -C(O)OR7, -OC(O)R7 või
-OC(O)OR7,
iga R6 on sõltumatult -(C1-C6)alküül-, -(C2-C6)alkenüül-, -(C2-C6)alkünüül-,
5
-(C3-C8)tsükloalküül-, -(C5-C8)tsükloalkenüül-, fenüül-, -(3-5-lüliline)heterotsükliline
rühm,
-C(halogeno)3-,
-CH(halogeno)2-,
-CH2(halogeno)rühm,
-CN,
-OH,
halogenorühm, -N3, -NO2, -CH=NR7, -NR7OH, -OR7, -COR7, -C(O)OR7,
-OC(O)R7, -OC(O)OR7, -SR7, -S(O)R7 või -S(O)2R7,
iga R7 on sõltumatult -H, -(C1-C6)alküül-, -(C2-C6)alkenüül-, -(C2-C6)alkünüül-,
10
-(C3-C8)tsükloalküül-, -(C5-C8)tsükloalkenüül-, fenüül-, -(3-5-lüliline)heterotsükliline
rühm, -C(halogeno)3-, -CH(halogeno)2- või -CH2(halogeno)rühm,
iga
R8
ja
R9
on
sõltumatult
-H,
-(C1-C6)alküül-,
-(C2-C6)alkenüül-,
-(C2-C6)alkünüül-, -(C3-C8)tsükloalküül-, -(C5-C8)tsükloalkenüül-, fenüül-, -(3-5-lüliline)heterotsükliline rühm, -CH2C(halogeno)3-, -C(halogeno)3-, -CH(halogeno)2-,
15
-CH2(halogeno)rühm, -CN, -OH, halogenorühm, -N3, -NO2, -CH=NR7, -NR7OH,
-OR7, -COR7, -C(O)OR7, -OC(O)R7, -OC(O)OR7, -SR7, -S(O)R7 või -S(O)2R7,
R10 on -(C1-C4)alküülrühm,
iga R13 on sõltumatult:
(a) -H või -(C1-C4)alküülrühm või
20
(c) fenüül- või -(3-5-lüliline)heteroarüülrühm, millest igaüks on asendamata või
asendatud ühe või enama rühmaga R6,
iga R14 on sõltumatult -(C1-C6)alküül-, -(C2-C6)alkenüül-, -(C2-C6)alkünüül-,
-(C3-C8)tsükloalküül-, -(C5-C8)tsükloalkenüül-, fenüül-, -(3-5-lüliline)heterotsükliline
rühm, -CH2C(halogeno)3-, -C(halogeno)3-, -CH(halogeno)2-, -CH2(halogeno)rühm,
EE-EP 1 648 878 B1
16
-CN, -OH, halogenorühm, -N3, -NO2, -CH=NR7, -NR7OH, -OR7, -COR7,
-C(O)OR7, -OC(O)R7, -OC(O)OR7, -SR7, -S(O)R7 või -S(O)2R7,
iga halogenorühm on sõltumatult -F, -Cl, -Br või -I,
n on täisarv vahemikus 0 kuni 3,
5
p on täisarv vahemikus 0 kuni 2,
q on täisarv vahemikus 0 kuni 4 ja
m on 0 või 1.
Käesolev leiutis käsitleb ka ühendeid valemiga (II)
N
(R2)n
R4
R1
(R3)m
N
x
NH
Ar3
(II)
(II)
10
ja nende farmatseutiliselt vastuvõetavaid sooli, milles
Ar3 on
(R11)r
, or
või
(R9)s
;
EE-EP 1 648 878 B1
17
X on O, S, N-CN, N-OH või N-OR10,
R1 on halogenorühm, -CH3, -NO2, -CN, -OH, -OCH3, -NH2, -C(halogeno)3-,
-CH(halogeno)2- või -CH2(halogeno)rühm,
iga R2 on sõltumatult:
5
(a) halogenorühm, -OH või -NH2,
(b) -(C1-C10)alküül-, -(C2-C10)alkenüül-, -(C2-C10)alkünüül-, -(C3-C10)tsükloalküül-,
-(C8-C14)bitsükloalküül-,
-(C8-C14)tritsükloalküül-,
-(C5-C10)tsükloalkenüül-,
-(C8-C14)bitsükloalkenüül-, -(C8-C14)tritsükloalkenüül-, -(3-7-lüliline)heterotsükliline
või -(7-10-lüliline)bitsükloheterotsükliline rühm, millest igaüks on asendamata või
10
asendatud ühe või enama rühmaga R5, või
(c) fenüül-, naftüül-, -(C14)arüül- või -(5-10-lüliline)heteroarüülrühm, millest igaüks
on asendamata või asendatud ühe või enama rühmaga R6,
iga R3 on sõltumatult:
(a) halogenorühm, -CN, -OH, -NO2 või -NH2,
15
(b) -(C1-C10)alküül-, -(C2-C10)alkenüül-, -(C2-C10)alkünüül-, -(C3-C10)tsükloalküül-,
-(C8-C14)bitsükloalküül-,
-(C8-C14)tritsükloalküül-,
-(C5-C10)tsükloalkenüül-,
-(C8-C14)bitsükloalkenüül-, -(C8-C14)tritsükloalkenüül-, -(3-7-lüliline)heterotsükliline
või -(7-10-lüliline)bitsükloheterotsükliline rühm, millest igaüks on asendamata või
asendatud ühe või enama rühmaga R5, või
20
(c) fenüül-, naftüül-, -(C14)arüül- või -(5-10-lüliline)heteroarüülrühm, millest igaüks
on asendamata või asendatud ühe või enama rühmaga R6,
EE-EP 1 648 878 B1
18
R4 on -OH, -OCF3, halogenorühm, -(C1-C6)alküül-, -CH2OH, -CH2Cl, -CH2Br,
-CH2I, -CH2F, -CH(halogeno)2-, -CF3, -OR10, -SR13, -COOH, -COOR10, -C(O)R10,
-C(O)H, -OC(O)R10, -OC(O)NHR10, -NHC(O)R13, -CON(R13)2, -SO2R10 või NO2,
iga R5 on sõltumatult -CN, -OH, -(C1-C6)alküül-, -(C2-C6)alkenüül-, halogenorühm,
5
-N3, -NO2, -N(R7)2, -CH=NR7, -NR7OH, -OR7, -COR7, -C(O)OR7, -OC(O)R7 või
-OC(O)OR7,
iga R6 on sõltumatult -(C1-C6)alküül-, -(C2-C6)alkenüül-, -(C2-C6)alkünüül-,
-(C3-C8)tsükloalküül-,
-(C5-C8)tsükloalkenüül-,
fenüül-,
-C(halogeno)3-,
-CH(halogeno)2-, -CH2(halogeno)rühm, -CN, -OH, halogenorühm, -N3, -NO2,
10
-CH=NR7, -NR7OH, -OR7, -COR7, -C(O)OR7, -OC(O)R7, -OC(O)OR7, -SR7,
-S(O)R7 või -S(O)2R7,
iga R7 on sõltumatult -H, -(C1-C6)alküül-, -(C2-C6)alkenüül-, -(C2-C6)alkünüül-,
-(C3-C8)tsükloalküül-, -(C5-C8)tsükloalkenüül-, fenüül-, -(3-5-lüliline)heterotsükliline
rühm, -C(halogeno)3-, -CH(halogeno)2- või -CH2(halogeno)rühm,
15
iga R9 on -(C1-C6)alküül-, -(C2-C6)alkenüül-, -(C2-C6)alkünüül-, -(C3-C8)tsükloalküül-,
-(C5-C8)tsükloalkenüül-,
fenüül-,
-(3-5-lüliline)heterotsükliline
rühm,
-CH2C(halogeno)3-, -C(halogeno)3-, -CH(halogeno)2-, -CH2(halogeno)rühm, -CN,
-OH, halogenorühm, -N3, -NO2, -CH=NR7, -NR7OH, -OR7, -COR7, -C(O)OR7,
-OC(O)R7, -OC(O)OR7, -SR7, -S(O)R7 või -S(O)2R7,
20
R10 on -(C1-C4)alküülrühm,
iga
R11
on
sõltumatult
-CN,
-OH,
-(C1-C6)alküül-,
-(C2-C6)alkenüül-,
halogenorühm, -N3, -NO2, -N(R7)2, -CH=NR7, -NR7OH, -OR7, -COR7, -C(O)OR7,
-OC(O)R7 või -OC(O)OR7,
iga R13 on sõltumatult:
EE-EP 1 648 878 B1
19
(a) -H või -(C1-C4)alküülrühm või
(c) fenüül- või -(3-5-lüliline)heteroarüülrühm, millest igaüks on asendamata või
asendatud ühe või enama rühmaga R6,
iga halogenorühm on sõltumatult -F, -Cl, -Br või -I,
5
n on täisarv vahemikus 0 kuni 3,
r on täisarv vahemikus 0 kuni 6,
s on täisarv vahemikus 0 kuni 5, ja
m on 0 või 1.
Käesolev leiutis käsitleb veel ühendeid valemiga (III)
Ar1 R4
(R3)m
N
X
NH
Ar3
(III)
(III)
10
ja nende farmatseutiliselt vastuvõetavaid sooli, milles
Ar1 on
EE-EP 1 648 878 B1
20
(R2)p
(R2)p
N
R1
N
(R2)p
N
N
R1
,
N S
N
R1
,
N
N
R1
või
,
Ar3 on
(R11)r
, või
or
(R9)s
;
X on O, S, N-CN, N-OH või N-OR10,
5
R1 on -H, halogenorühm, -CH3, -NO2, -CN, -OH, -OCH3, -NH2, -C(halogeno)3-,
-CH(halogeno)2- või -CH2(halogeno)rühm,
iga R2 on sõltumatult:
(a) halogenorühm, -OH, -CN, -NO2 või -NH2,
(b) -(C1-C10)alküül-, -(C2-C10)alkenüül-, -(C2-C10)alkünüül-, -(C3-C10)tsükloalküül-,
10
-(C8-C14)bitsükloalküül-,
-(C8-C14)tritsükloalküül-,
-(C5-C10)tsükloalkenüül-,
-(C8-C14)bitsükloalkenüül-, -(C8-C14)tritsükloalkenüül-, -(3-7-lüliline)heterotsükliline
või -(7-10-lüliline)bitsükloheterotsükliline rühm, millest igaüks on asendamata või
asendatud ühe või enama rühmaga R5, või
(c) fenüül-, naftüül-, -(C14)arüül- või -(5-10-lüliline)heteroarüülrühm, millest igaüks
15
on asendamata või asendatud ühe või enama rühmaga R6,
iga R3 on sõltumatult:
EE-EP 1 648 878 B1
21
(a) halogenorühm, -CN, -OH, -NO2 või -NH2,
(b) -(C1-C10)alküül-, -(C2-C10)alkenüül-, -(C2-C10)alkünüül-, -(C3-C10)tsükloalküül-,
-(C8-C14)bitsükloalküül-,
-(C8-C14)tritsükloalküül-,
-(C5-C10)tsükloalkenüül-,
-(C8-C14)bitsükloalkenüül-, -(C8-C14)tritsükloalkenüül-, -(3-7-lüliline)heterotsükliline
5
või -(7-10-lüliline)bitsükloheterotsükliline rühm, millest igaüks on asendamata või
asendatud ühe või enama rühmaga R5, või
(c) fenüül-, naftüül-, -(C14)arüül- või -(5-10-lüliline)heteroarüülrühm, millest igaüks
on asendamata või asendatud ühe või enama rühmaga R6,
R4 on -OH, -OCF3, halogenorühm, -(C1-C6)alküül-, -CH2OH, -CH2Cl, -CH2Br,
10
-CH2I, -CH2F, -CH(halogeno)2rühm, -CF3, -OR10, -SR13, -COOH, -COOR10,
-C(O)R10, -C(O)H, -OC(O)R10, -OC(O)NHR10, -NHC(O)R13, -CON(R13)2, -SO2R10
või NO2,
iga R5 on sõltumatult -CN, -OH, -(C1-C6)alküül-, -(C2-C6)alkenüül-, halogenorühm,
-N3, -NO2, -N(R7)2, -CH=NR7, -NR7OH, -OR7, -COR7, -C(O)OR7, -OC(O)R7 või
15
-OC(O)OR7,
iga R6 on sõltumatult -(C1-C6)alküül-, -(C2-C6)alkenüül-, -(C2-C6)alkünüül-,
-(C3-C8)tsükloalküül-,
-(C5-C8)tsükloalkenüül-,
fenüül-,
-C(halogeno)3-,
-CH(halogeno)2-, -CH2(halogeno)rühm, -CN, -OH, halogenorühm, -N3, -NO2,
-CH=NR7, -NR7OH, -OR7, -COR7, -C(O)OR7, -OC(O)R7, -OC(O)OR7, -SR7,
20
-S(O)R7 või -S(O)2R7,
iga R7 on sõltumatult -H, -(C1-C6)alküül-, -(C2-C6)alkenüül-, -(C2-C6)alkünüül-,
-(C3-C8)tsükloalküül-, -(C5-C8)tsükloalkenüül-, fenüül-, -(3-5-lüliline)heterotsükliline
rühm, -C(halogeno)3-, -CH(halogeno)2- või -CH2(halogeno)rühm,
iga R9 on sõltumatult -(C1-C6)alküül-, -(C2-C6)alkenüül-, -(C2-C6)alkünüül-,
25
-(C3-C8)tsükloalküül-, -(C5-C8)tsükloalkenüül-, fenüül-, -(3-5-lüliline)heterotsükliline
22
EE-EP 1 648 878 B1
rühm, -CH2C(halogeno)3-, -C(halogeno)3-, -CH(halogeno)2-, -CH2(halogeno)rühm,
-CN, -OH, halogenorühm, -N3, -NO2, -CH=NR7, -NR7OH, -OR7, -COR7,
-C(O)OR7, -OC(O)R7, -OC(O)OR7, -SR7, -S(O)R7 või -S(O)2R7,
R10 on -(C1-C4)alküülrühm,
5
iga R11 on sõltumatult -CN, -OH, -(C1-C6)alküül-, -(C2-C6)alkenüül-, halogenorühm, -N3, -NO2, -N(R7)2, -CH=NR7, -NR7OH, -OR7, -COR7, -C(O)OR7, -OC(O)R7
või -OC(O)OR7,
iga R13 on sõltumatult:
(a) -H või -(C1-C4)alküülrühm või
10
(b) fenüül- või -(3-5-lüliline)heteroarüülrühm, millest igaüks on asendamata või
asendatud ühe või enama rühmaga R6,
iga halogenorühm on sõltumatult -F, -Cl, -Br või -I,
p on täisarv vahemikus 0 kuni 2,
r on täisarv vahemikus 0 kuni 6,
15
s on täisarv vahemikus 0 kuni 5 ja
m on 0 või 1.
Ühend valemiga (I), (II) või (III) või selle farmatseutiliselt vastuvõetav sool
(piperidiiniühend) on kasulik valu, UI, haavandi, IBD, IBS-i, sõltuvushäire,
Parkinsoni tõve, parkinsonismi, ärevuse, epilepsia, insuldi, krampide, kiheluse,
20
psühhoosi, kognitiivse häire, mäluhäire, ajutalitluse häire, Huntingtoni korea,
EE-EP 1 648 878 B1
23
ALS-i,
dementsuse,
retinopaatia,
lihasspasmide,
migreeni,
oksendamise,
düskineesia või depressiooni (igaüks neist on haigusseisund) ravimiseks või
vältimiseks loomal.
Leiutis käsitleb ka koostisi, mis sisaldavad efektiivses koguses piperidiiniühendit
5
ja farmatseutiliselt vastuvõetavat kandjat või abiainet. Koostised on kasulikud
haigusseisundi ravimiseks või vältimiseks loomal.
Leiutis käsitleb veel piperidiiniühendi efektiivse koguse kasutamist ravimi
valmistamiseks
haigusseisundi
ravimiseks
või
vältimiseks,
mis
hõlmab
piperidiiniühendi efektiivse koguse manustamist seda vajavale loomale.
10
Leiutis käsitleb veel nõudluspunktile 40 vastavaid meetodeid vanilloidiretseptori 1
(VR1) funktsiooni inhibeerimiseks rakus, mis hõlmavad VR1 ekspresseerima
võimelise raku kokkuviimist piperidiiniühendi efektiivse kogusega.
Leiutis käsitleb veel meetodeid mGluR5 funktsiooni inhibeerimiseks rakus, mis
hõlmavad mGluR5 ekspresseerima võimelise raku kokkuviimist piperidiiniühendi
15
efektiivse kogusega.
Leiutis käsitleb lisaks veel meetodeid metabotroopse glutamaadiretseptori 1
(mGluR1) funktsiooni inhibeerimiseks rakus, mis hõlmavad mGluR1 ekspresseerima võimelise raku kokkuviimist piperidiiniühendi efektiivse kogusega.
Leiutis käsitleb lisaks veel koostise valmistamise meetodit, mis hõlmab
20
piperidiiniühendi ja farmatseutiliselt vastuvõetava kandja või abiaine segamise
etappi.
Leiutis käsitleb lisaks veel komplekti, mis sisaldab piperidiiniühendi efektiivset
kogust sisaldavat anumat.
EE-EP 1 648 878 B1
24
Käesolevast leiutisest on võimalik paremini aru saada järgneva üksikasjaliku
kirjelduse ja selgitavate näidete abil.
4. LEIUTISE ÜKSIKASJALIK KIRJELDUS
4.1 PIPERIDIINIÜHENDID VALEMIGA (I)
5
Nagu eespool on mainitud, käsitleb käesolev leiutis ühendeid valemiga (I)
Ar1
R4
(R3)m
N
X
NH
Ar2
(I)
ja nende farmatseutiliselt vastuvõetavaid sooli, milles Ar1, Ar2, R3, R4, X ja m on
määratletud eespool piperidiiniühendite valemiga (I) puhul.
Ühes teostuses Ar1 on püridüülrühm.
10
Järgmises teostuses Ar1 on pürimidinüülrühm.
Järgmises teostuses Ar1 on pürasinüülrühm.
Järgmises teostuses Ar1 on püridasinüülrühm.
Järgmises teostuses Ar1 on tiasanüülrühm.
Järgmises teostuses X on O.
25
Järgmises teostuses X on S.
Järgmises teostuses X on N-CN.
Järgmises teostuses X on N-OH.
Järgmises teostuses X on N-OR10.
5
Järgmises teostuses Ar2 on bensoimidasolüülrühm.
Järgmises teostuses Ar2 on bensotiasolüülrühm.
Järgmises teostuses Ar2 on bensooksasolüülrühm.
Järgmises teostuses on Ar2
N
(R14)q
10
Järgmises teostuses on Ar2
N
(R14)q
Järgmises teostuses n või p on 0.
Järgmises teostuses n või p on 1.
EE-EP 1 648 878 B1
26
EE-EP 1 648 878 B1
Järgmises teostuses m on 0.
Järgmises teostuses m on 1.
Järgmises teostuses R1 on -H.
Järgmises teostuses R1 on halogenorühm.
5
Järgmises teostuses R1 on -CH3.
Järgmises teostuses R1 on -NO2.
Järgmises teostuses R1 on -CN.
Järgmises teostuses R1 on -OH.
Järgmises teostuses R1 on -OCH3.
10
Järgmises teostuses R1 on -NH2.
Järgmises teostuses R1 on -C(halogeno)3rühm.
Järgmises teostuses R1 on -CH(halogeno)2rühm.
Järgmises teostuses R1 on -CH2(halogeno)rühm.
Järgmises teostuses n või p on 1 ja R2 on halogenorühm, -CN, -OH, -NO2 või
15
-NH2.
Järgmises teostuses n või p on 1 ja R2 on -(C1-C10)alküül-, -(C2-C10)alkenüül-,
-(C2-C10)alkünüül-, -(C3-C10)tsükloalküül-, -(C8-C14)bitsükloalküül-, -(C8-C14)tri-
EE-EP 1 648 878 B1
27
tsükloalküül-, -(C5-C10)tsükloalkenüül-, -(C8-C14)bitsükloalkenüül-, -(C8-C14)tritsükloalkenüül-,
-(3-7-lüliline)heterotsükliline
või
-(7-10-lüliline)bitsüklohetero-
tsükliline rühm, millest igaüks on asendamata või asendatud ühe või enama
rühmaga R5.
5
Järgmises teostuses n või p on 1 ja R2 on fenüül-, naftüül-, -(C14)arüül- või -(5-10lüliline)heteroarüülrühm, millest igaüks on asendamata või asendatud ühe või
enama rühmaga R6.
Järgmises teostuses m on 1 ja R3 on halogenorühm, -CN, -OH, -NO2 või -NH2.
Järgmises teostuses m on 1 ja R3 on -(C1-C10)alküül-, -(C2-C10)alkenüül-,
10
-(C2-C10)alkünüül-, -(C3-C10)tsükloalküül-, -(C8-C14)bitsükloalküül-, -(C8-C14)tritsükloalküül-, -(C5-C10)tsükloalkenüül-, -(C8-C14)bitsükloalkenüül-, -(C8-C14)tritsükloalkenüül-,
-(3-7-lüliline)heterotsükliline
või
-(7-10-lüliline)bitsüklohetero-
tsükliline rühm, millest igaüks on asendamata või asendatud ühe või enama
rühmaga R5.
15
Järgmises teostuses m on 1 ja R3 on fenüül-, naftüül-, -(C14)arüül- või
-(5-10-lüliline)heteroarüülrühm, millest igaüks on asendamata või asendatud ühe
või enama rühmaga R6.
Järgmises teostuses m on 1 ja R3 on -CH3.
Järgmises teostuses R4 on -OH.
20
Järgmises teostuses R4 on -OCF3.
Järgmises teostuses R4 on halogenorühm.
Järgmises teostuses R4 on -(C1-C6)alküülrühm.
28
Järgmises teostuses R4 on -CH3.
Järgmises teostuses R4 on -CH2OH.
Järgmises teostuses R4 on -CH2Cl.
Järgmises teostuses R4 on -CH2Br.
5
Järgmises teostuses R4 on -CH2I.
Järgmises teostuses R4 on -CH2F.
Järgmises teostuses R4 on -CH(halogeno)2rühm.
Järgmises teostuses R4 on -CF3.
Järgmises teostuses R4 on -NO2.
10
Järgmises teostuses R4 on -OR10.
Järgmises teostuses R4 on -SR13.
Järgmises teostuses R4 on -C(O)R10.
Järgmises teostuses R4 on -COOH.
Järgmises teostuses R4 on -C(O)H.
15
Järgmises teostuses R4 on -COOR10.
Järgmises teostuses R4 on -OC(O)R10.
EE-EP 1 648 878 B1
29
EE-EP 1 648 878 B1
Järgmises teostuses R4 on -SO2R10.
Järgmises teostuses R4 on -OC(O)NHR10.
Järgmises teostuses R4 on -NHC(O)R13.
Järgmises teostuses R4 on -CON(R13)2.
5
Järgmises teostuses Ar2 on bensotiasolüül-, bensoimidasolüül- või bensooksasolüülrühm ja vähemalt üks rühmadest R8 ja R9 on -H.
Järgmises teostuses on Ar2
N
(R14)q
ja q on 1.
10
Järgmises teostuses on Ar2
N
(R14)q
ja q on 1.
Järgmises teostuses on Ar1 püridüülrühm, X on O, m on 0, R4 on halogenorühm
ja Ar2 on bensotiasolüülrühm.
30
EE-EP 1 648 878 B1
Järgmises teostuses on Ar1 püridüülrühm, X on O, m on 0, R4 on -F ja Ar2 on
bensotiasolüülrühm.
Järgmises teostuses on Ar1 püridüülrühm, X on O, m on 0, R4 on -Cl ja Ar2 on
bensotiasolüülrühm.
5
Järgmises teostuses on Ar1 püridüülrühm, X on O, m on 0, R4 on -Br ja Ar2 on
bensotiasolüülrühm.
Järgmises teostuses on Ar1 püridüülrühm, X on O, m on 0, R4 on -I ja Ar2 on
bensotiasolüülrühm.
Järgmises teostuses on Ar1 püridüülrühm, X on O, m on 0, R4 on halogenorühm
10
ja Ar2 on bensoimidasolüülrühm.
Järgmises teostuses on Ar1 püridüülrühm, X on O, m on 0, R4 on -F ja Ar2 on
bensoimidasolüülrühm.
Järgmises teostuses on Ar1 püridüülrühm, X on O, m on 0, R4 on -Cl ja Ar2 on
bensoimidasolüülrühm.
15
Järgmises teostuses on Ar1 püridüülrühm, X on O, m on 0, R4 on -Br ja Ar2 on
bensoimidasolüülrühm.
Järgmises teostuses on Ar1 püridüülrühm, X on O, m on 0, R4 on -I ja Ar2 on
bensoimidasolüülrühm.
Järgmises teostuses on Ar1 püridüülrühm, X on O, m on 0, R4 on halogenorühm
20
ja Ar2 on bensoimidasolüülrühm.
Järgmises teostuses on Ar1 püridüülrühm, X on O, m on 0, R4 on -F ja Ar2 on
bensooksasolüülrühm.
31
EE-EP 1 648 878 B1
Järgmises teostuses on Ar1 püridüülrühm, X on O, m on 0, R4 on -Cl ja Ar2 on
bensooksasolüülrühm.
Järgmises teostuses on Ar1 püridüülrühm, X on O, m on 0, R4 on -Br ja Ar2 on
bensooksasolüülrühm.
5
Järgmises teostuses on Ar1 püridüülrühm, X on O, m on 0, R4 on -I ja Ar2 on
bensooksasolüülrühm.
Järgmises teostuses on Ar1 püridüülrühm, X on O, m on 0, R4 on halogenorühm
ja Ar2 on
N
(R14)q .
10
Järgmises teostuses on Ar1 püridüülrühm, X on O, m on 0, R4 on -F ja Ar2 on
N
(R14)q .
Järgmises teostuses on Ar1 püridüülrühm, X on O, m on 0, R4 on -Cl ja Ar2 on
N
(R14)q .
Järgmises teostuses on Ar1 püridüülrühm, X on O, m on 0, R4 on -Br ja Ar2 on
32
EE-EP 1 648 878 B1
N
(R14)q .
Järgmises teostuses on Ar1 püridüülrühm, X on O, m on 0, R4 on -I ja Ar2 on
N
(R14)q .
Järgmises teostuses on Ar1 püridüülrühm, X on O, m on 0, R4 on halogenorühm
5
ja Ar2 on
N
(R14)q.
Järgmises teostuses on Ar1 püridüülrühm, X on O, m on 0, R4 on -F ja Ar2 on
N
(R14)q.
Järgmises teostuses on Ar1 püridüülrühm, X on O, m on 0, R4 on -Cl ja Ar2 on
N
10
(R14)q.
33
EE-EP 1 648 878 B1
Järgmises teostuses on Ar1 püridüülrühm, X on O, m on 0, R4 on -Br ja Ar2 on
N
(R14)q.
Järgmises teostuses on Ar1 püridüülrühm, X on O, m on 0, R4 on -I ja Ar2 on
N
(R14)q.
5
Järgmises teostuses on Ar1 püridüülrühm, X on O, m on 0, R4 on -OH ja Ar2 on
bensotiasolüülrühm.
Järgmises teostuses on Ar1 püridüülrühm, X on O, m on 0, R4 on -OH ja Ar2 on
bensoimidasolüülrühm.
Järgmises teostuses on Ar1 püridüülrühm, X on O, m on 0, R4 on -OH ja Ar2 on
10
bensooksasolüülrühm.
Järgmises teostuses on Ar1 püridüülrühm, X on O, m on 0, R4 on -OH ja Ar2 on
N
(R14)q .
Järgmises teostuses on Ar1 püridüülrühm, X on O, m on 0, R4 on -OH ja Ar2 on
34
EE-EP 1 648 878 B1
N
(R14)q.
Järgmises teostuses on Ar1 püridüülrühm, X on O, m on 0, R4 on -CH3 ja Ar2 on
bensotiasolüülrühm.
Järgmises teostuses on Ar1 püridüülrühm, X on O, m on 0, R4 on -CH3 ja Ar2 on
5
bensoimidasolüülrühm.
Järgmises teostuses on Ar1 püridüülrühm, X on O, m on 0, R4 on -CH3 ja Ar2 on
bensooksasolüülrühm.
Järgmises teostuses on Ar1 püridüülrühm, X on O, m on 0, R4 on -CH3 ja Ar2 on
N
(R14)q .
10
Järgmises teostuses on Ar1 püridüülrühm, X on O, m on 0, R4 on -CH3 ja Ar2 on
N
(R14)q.
Järgmises teostuses on Ar1 püridüülrühm, X on O, m on 0, R4 on -OR10 ja Ar2 on
bensotiasolüülrühm.
Järgmises teostuses on Ar1 püridüülrühm, X on O, m on 0, R4 on -OR10 ja Ar2 on
15
bensoimidasolüülrühm.
35
EE-EP 1 648 878 B1
Järgmises teostuses on Ar1 püridüülrühm, X on O, m on 0, R4 on -OR10 ja Ar2 on
bensooksasolüülrühm.
Järgmises teostuses on Ar1 püridüülrühm, X on O, m on 0, R4 on -OR10 ja Ar2 on
N
(R14)q
5
Järgmises teostuses on Ar1 püridüülrühm, X on O, m on 0, R4 on -OR10 ja Ar2 on
N
(R14)q.
Järgmises teostuses on Ar1 püridüülrühm, X on O, m on 0, R4 on -C(O)R10 ja Ar2
on bensotiasolüülrühm.
Järgmises teostuses on Ar1 püridüülrühm, X on O, m on 0, R4 on -C(O)R10 ja Ar2
10
on bensoimidasolüülrühm.
Järgmises teostuses on Ar1 püridüülrühm, X on O, m on 0, R4 on -C(O)R10 ja Ar2
on bensooksasolüülrühm.
Järgmises teostuses on Ar1 püridüülrühm, X on O, m on 0, R4 on -C(O)R10 ja Ar2
on
N
15
(R14)q .
36
EE-EP 1 648 878 B1
Järgmises teostuses on Ar1 püridüülrühm, X on O, m on 0, R4 on -C(O)R10 ja Ar2
on
N
(R14)q.
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on
5
halogenorühm ja Ar2 on bensotiasolüülrühm.
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -F ja Ar2 on
bensotiasolüülrühm.
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -Cl ja Ar2 on
bensotiasolüülrühm.
10
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -Br ja Ar2 on
bensotiasolüülrühm.
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -I ja Ar2 on
bensotiasolüülrühm.
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on
15
halogenorühm ja Ar2 on bensoimidasolüülrühm.
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -F ja Ar2 on
bensoimidasolüülrühm.
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -Cl ja Ar2 on
bensoimidasolüülrühm.
37
EE-EP 1 648 878 B1
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -Br ja Ar2 on
bensoimidasolüülrühm.
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -I ja Ar2 on
bensoimidasolüülrühm.
5
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on
halogenorühm ja Ar2 on bensooksasolüülrühm.
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -F ja Ar2 on
bensooksasolüülrühm.
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -Cl ja Ar2 on
10
bensooksasolüülrühm.
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -Br ja Ar2 on
bensooksasolüülrühm.
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -I ja Ar2 on
bensooksasolüülrühm.
15
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on
halogenorühm ja Ar2 on
N
(R14)q .
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -F ja Ar2 on
38
EE-EP 1 648 878 B1
N
(R14)q .
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -Cl ja Ar2 on
N
(R14)q .
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -Br ja Ar2 on
N
(R14)q .
5
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -I ja Ar2 on
N
(R14)q
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on
halogenorühm ja Ar2 on
N
10
(R14)q.
39
EE-EP 1 648 878 B1
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -F ja Ar2 on
N
(R14)q.
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -Cl ja Ar2 on
N
(R14)q.
5
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -Br ja Ar2 on
N
(R14)q.
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -I ja Ar2 on
N
(R14)q.
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -OH ja Ar2
10
on bensotiasolüülrühm.
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -OH ja Ar2
on bensoimidasolüülrühm.
40
EE-EP 1 648 878 B1
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -OH ja Ar2
on bensooksasolüülrühm.
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -OH ja Ar2
on
N
(R14)q .
5
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -OH ja Ar2
on
N
(R14)q.
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -CH3 ja Ar2
10
on bensotiasolüülrühm.
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -CH3 ja Ar2
on bensoimidasolüülrühm.
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -CH3 ja Ar2
on bensooksasolüülrühm.
15
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -CH3 ja Ar2
on tsükloheksüülrühm.
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -CH3 ja Ar2
on
41
EE-EP 1 648 878 B1
N
(R14)q .
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -CH3 ja Ar2
on
N
(R14)q.
5
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -OR10 ja Ar2
on bensotiasolüülrühm.
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -OR10 ja Ar2
on bensoimidasolüülrühm.
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -OR10 ja Ar2
10
on bensooksasolüülrühm.
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -OR10 ja Ar2
on
N
(R14)q .
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -OR10 ja Ar2
15
on
42
EE-EP 1 648 878 B1
N
(R14)q.
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -C(O)R10 ja
Ar2 on bensotiasolüülrühm.
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -C(O)R10 ja
5
Ar2 on bensoimidasolüülrühm.
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -C(O)R10 ja
Ar2 on bensooksasolüülrühm.
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -C(O)R10 ja
Ar2 on
N
(R14)q .
10
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -C(O)R10 ja
Ar2 on
N
(R14)q.
Leiutis käsitleb ka ühendeid valemiga (I) ja nende farmatseutiliselt vastuvõetavaid
15
sooli, milles
EE-EP 1 648 878 B1
43
Ar2 on
N
N
NH
N
S
O
või
R8
R9 , R8
R9 , or
R8
R9 ;
iga R3 on sõltumatult:
(a) halogenorühm, -CN, -OH, -NO2 või -NH2 või
5
(b) -(C1-C10)alküül-, -(C2-C10)alkenüül-, -(C2-C10)alkünüül-, millest igaüks on
asendamata või asendatud ühe või enama rühmaga R5, ja vähemalt üks
rühmadest R8 või R9 on muu kui -H.
4.2 PIPERIDIINIÜHENDID VALEMIGA (II)
Käesolev leiutis käsitleb ka ühendeid valemiga (II)
N
(R2)n
R4
R1
(R3)m
N
x
NH
Ar3
10
(II)
(II)
ja nende farmatseutiliselt vastuvõetavaid sooli, milles R1, R2, Ar3, R3, R4, X, n ja m
on nagu määratletud eespool piperidiiniühendite valemiga (II) puhul.
EE-EP 1 648 878 B1
44
Ühes teostuses X on O.
Järgmises teostuses X on S.
Järgmises teostuses X on N-CN.
Järgmises teostuses X on N-OH.
5
Järgmises teostuses X on N-OR10.
Järgmises teostuses on Ar3
(R9)s
.
Järgmises teostuses on Ar3
(R11)r
.
10
On arusaadav, et kui kaks rühma R11 on seotud sama süsinikuaatomiga, siis kaks
sama süsinikuaatomiga seotud rühma R11 ei ole mõlemad -CN, -OH, -N3, -NO2,
-N(R7)2, -CH=NR7, -NR7OH, -COR7, -OC(O)R7 või -OC(O)OR7.
Järgmises teostuses n on 0.
Järgmises teostuses n on 1.
15
Järgmises teostuses R1 on halogenorühm.
EE-EP 1 648 878 B1
45
Järgmises teostuses R1 on -CH3.
Järgmises teostuses R1 on -NO2.
Järgmises teostuses R1 on -CN.
Järgmises teostuses R1 on -OH.
5
Järgmises teostuses R1 on -OCH3.
Järgmises teostuses R1 on -NH2.
Järgmises teostuses R1 on -C(halogeno)3rühm.
Järgmises teostuses R1 on -CH(halogeno)2rühm.
Järgmises teostuses R1 on -CH2(halogeno)rühm.
10
Järgmises teostuses n on 1 ja R2 on halogenorühm, -OH või -NH2.
Järgmises teostuses n on 1 ja R2 on -(C1-C10)alküül-, -(C2-C10)alkenüül-,
-(C2-C10)alkünüül-, -(C3-C10)tsükloalküül-, -(C8-C14)bitsükloalküül-, -(C8-C14)tritsükloalküül-, -(C5-C10)tsükloalkenüül-, -(C8-C14)bitsükloalkenüül-, -(C8-C14)tritsükloalkenüül-,
15
-(3-7-lüliline)heterotsükliline
või
-(7-10-lüliline)bitsüklohetero-
tsükliline rühm, millest igaüks on asendamata või asendatud ühe või enama
rühmaga R5.
Järgmises teostuses n on 1 ja R2 on fenüül-, naftüül-, -(C14)arüül- või -(5-10lüliline)heteroarüülrühm, millest igaüks on asendamata või asendatud ühe või
enama rühmaga R6.
EE-EP 1 648 878 B1
46
Järgmises teostuses m on 1 ja R3 on halogenorühm, -CN, -OH, -NO2 või -NH2.
Järgmises teostuses m on 1 ja R3 on -(C1-C10)alküül-, -(C2-C10)alkenüül-,
-(C2-C10)alkünüül-, -(C3-C10)tsükloalküül-, -(C8-C14)bitsükloalküül-, -(C8-C14)tritsükloalküül-, -(C5-C10)tsükloalkenüül-, -(C8-C14)bitsükloalkenüül-, -(C8-C14)tri5
tsükloalkenüül-,
-(3-7-lüliline)heterotsükliline
või
-(7-10-lüliline)bitsüklohetero-
tsükliline rühm, millest igaüks on asendamata või asendatud ühe või enama
rühmaga R5.
Järgmises teostuses m on 1 ja R3 on fenüül-, naftüül-, -(C14)arüül- või -(5-10lüliline)heteroarüülrühm, millest igaüks on asendamata või asendatud ühe või
10
enama rühmaga R6.
Järgmises teostuses m on 1 ja R3 on -CH3.
Järgmises teostuses R4 on -OH.
Järgmises teostuses R4 on -OCF3.
Järgmises teostuses R4 on halogenorühm.
15
Järgmises teostuses R4 on -(C1-C6)alküülrühm.
Järgmises teostuses R4 on -CH3.
Järgmises teostuses R4 on -CH2OH.
Järgmises teostuses R4 on -CH2Cl.
Järgmises teostuses R4 on -CH2Br.
47
Järgmises teostuses R4 on -CH2I.
Järgmises teostuses R4 on -CH2F.
Järgmises teostuses R4 on -CH(halogeno)2rühm.
Järgmises teostuses R4 on -CF3.
5
Järgmises teostuses R4 on -NO2.
Järgmises teostuses R4 on -OR10.
Järgmises teostuses R4 on -SR13.
Järgmises teostuses R4 on -C(O)R10.
Järgmises teostuses R4 on -COOH.
10
Järgmises teostuses R4 on -C(O)H.
Järgmises teostuses R4 on -COOR10.
Järgmises teostuses R4 on -C(O)OR10.
Järgmises teostuses R4 on -SO2R10.
Järgmises teostuses R4 on -OC(O)NHR10.
15
Järgmises teostuses R4 on -NHC(O)R13.
Järgmises teostuses R4 on -CON(R13)2.
EE-EP 1 648 878 B1
EE-EP 1 648 878 B1
48
Järgmises teostuses on Ar3
(R9)s
ja s on 1.
Järgmises teostuses on Ar3
(R11)r
5
ja r on 1.
Järgmises teostuses X on O, m on 0, R4 on halogenorühm ja Ar3 on
(R11)r
.
Järgmises teostuses X on O, m on 0, R4 on -F ja Ar3 on
(R11)r
10
.
Järgmises teostuses X on O, m on 0, R4 on -Cl ja Ar3 on
EE-EP 1 648 878 B1
49
(R11)r
.
Järgmises teostuses X on O, m on 0, R4 on -Br ja Ar3 on
(R11)r
.
Järgmises teostuses X on O, m on 0, R4 on -I ja Ar3 on
(R11)r
5
.
Järgmises teostuses X on O, m on 0, R4 on halogenorühm ja Ar3 on
(R9)s
.
Järgmises teostuses X on O, m on 0, R4 on -F ja Ar3 on
(R9)s
.
10
Järgmises teostuses X on O, m on 0, R4 on -Cl ja Ar3 on
EE-EP 1 648 878 B1
50
(R9)s
.
Järgmises teostuses X on O, m on 0, R4 on -Br ja Ar3 on
(R9)s
.
Järgmises teostuses X on O, m on 0, R4 on -I ja Ar3 on
(R9)s
5
.
Järgmises teostuses X on O, m on 0, R4 on -OH ja Ar3 on
(R11)r
.
Järgmises teostuses X on O, m on 0, R4 on -OH ja Ar3 on
(R9)s
.
10
Järgmises teostuses X on O, m on 0, R4 on -OH ja Ar3 on
EE-EP 1 648 878 B1
51
(R9)s
,
s on 1 ja R9 on -(C1-C6)alküülrühm.
Järgmises teostuses X on O, m on 0, R4 on -OH ja Ar3 on
(R9)s
,
5
s on 1 ja R9 on -CH3.
Järgmises teostuses X on O, m on 0, R4 on -CH3 ja Ar3 on
(R11)r
.
Järgmises teostuses X on O, m on 0, R4 on -CH3 ja Ar3 on
(R9)s
.
10
Järgmises teostuses X on O, m on 0, R4 on -CH3 ja Ar3 on
(R9)s
,
EE-EP 1 648 878 B1
52
s on 1 ja R9 on -(C1-C6)alküülrühm.
Järgmises teostuses X on O, m on 0, R4 on -CH3 ja Ar3 on
(R9)s
,
s on 1 ja R9 on -CH3.
5
Järgmises teostuses X on O, m on 0, R4 on -OR10 ja Ar3 on
(R11)r
.
Järgmises teostuses X on O, m on 0, R4 on -OR10 ja Ar3 on
(R9)s
.
Järgmises teostuses X on O, m on 0, R4 on -OR10 ja Ar3 on
(R9)s
10
,
s on 1 ja R9 on -(C1-C6)alküülrühm.
Järgmises teostuses X on O, m on 0, R4 on -OR10 ja Ar3 on
EE-EP 1 648 878 B1
53
(R9)s
,
s on 1 ja R9 on -CH3.
Järgmises teostuses X on O, m on 0, R4 on -C(O)R10 ja Ar3 on
(R11)r
.
5
Järgmises teostuses X on O, m on 0, R4 on -C(O)R10 ja Ar3 on
(R9)s
.
Järgmises teostuses X on O, m on 0, R4 on -C(O)R10 ja Ar3 on
(R9)s
,
s on 1 ja R9 on -(C1-C6)alküülrühm.
10
Järgmises teostuses X on O, m on 0, R4 on -C(O)R10 ja Ar3 on
(R9)s
,
EE-EP 1 648 878 B1
54
s on 1 ja R9 on -CH3.
4.3 PIPERIDIINIÜHENDID VALEMIGA (III)
Leiutis käsitleb ka ühendeid valemiga (III)
Ar1
R4
(R3)m
N
x
NH
Ar3
(III)
(III)
5
ja nende farmatseutiliselt vastuvõetavaid sooli, milles Ar1, Ar3, R3, R4, X ja m on
määratletud eespool piperidiiniühendite valemiga (III) puhul.
Ühes teostuses X on O.
Järgmises teostuses X on S.
10
Järgmises teostuses X on N-CN.
Järgmises teostuses X on N-OH.
Järgmises teostuses X on N-OR10.
Järgmises teostuses Ar1 on pürimidüülrühm.
Järgmises teostuses Ar1 on pürasinüülrühm.
EE-EP 1 648 878 B1
55
Järgmises teostuses Ar1 on püridasinüülrühm.
Järgmises teostuses Ar1 on tiasanüülrühm.
Järgmises teostuses on Ar3
(R9)s
.
5
Järgmises teostuses on Ar3
(R11)r
.
On arusaadav, et kui kaks rühma R11 on seotud sama süsinikuaatomiga, siis kaks
sama süsinikuaatomiga seotud rühma R11 ei ole mõlemad -CN, -OH, -N3, -NO2,
-N(R7)2, -CH=NR7, -NR7OH, -COR7, -OC(O)R7 või -OC(O)OR7.
10
Järgmises teostuses p on 0.
Järgmises teostuses p on 1.
Järgmises teostuses R1 on -H.
Järgmises teostuses R1 on halogenorühm.
Järgmises teostuses R1 on -CH3.
15
Järgmises teostuses R1 on -NO2.
EE-EP 1 648 878 B1
56
Järgmises teostuses R1 on -CN.
Järgmises teostuses R1 on -OH.
Järgmises teostuses R1 on -OCH3.
Järgmises teostuses R1 on -NH2.
5
Järgmises teostuses R1 on -C(halogeno)3rühm.
Järgmises teostuses R1 on -CH(halogeno)2rühm.
Järgmises teostuses R1 on -CH2(halogeno)rühm.
Järgmises teostuses p on 1 ja R2 on halogenorühm, -CN, -OH, -NO2 või -NH2.
Järgmises teostuses p on 1 ja R2 on -(C1-C10)alküül-, -(C2-C10)alkenüül-,
10
-(C2-C10)alkünüül-, -(C3-C10)tsükloalküül-, -(C8-C14)bitsükloalküül-, -(C8-C14)tritsükloalküül-, -(C5-C10)tsükloalkenüül-, -(C8-C14)bitsükloalkenüül-, -(C8-C14)tritsükloalkenüül-,
-(3-7-lüliline)heterotsükliline
või
-(7-10-lüliline)bitsüklohetero-
tsükliline rühm, millest igaüks on asendamata või asendatud ühe või enama
rühmaga R5.
15
Järgmises teostuses p on 1 ja R2 on fenüül-, naftüül-, -(C14)arüül- või -(5-10lüliline)heteroarüülrühm, millest igaüks on asendamata või asendatud ühe või
enama rühmaga R6.
Järgmises teostuses m on 1 ja R3 on halogenorühm, -CN, -OH, -NO2 või -NH2.
Järgmises teostuses m on 1 ja R3 on -(C1-C10)alküül-, -(C2-C10)alkenüül-,
20
-(C2-C10)alkünüül-, -(C3-C10)tsükloalküül-, -(C8-C14)bitsükloalküül-, -(C8-C14)tri-
57
EE-EP 1 648 878 B1
tsükloalküül-, -(C5-C10)tsükloalkenüül-, -(C8-C14)bitsükloalkenüül-, -(C8-C14)tritsükloalkenüül-, -(3-7-lüliline)heterotsükliline või -(7-10-lüliline)bitsükloheterotsükliline
rühm, millest igaüks on asendamata või asendatud ühe või enama rühmaga R5.
Järgmises teostuses m on 1 ja R3 on fenüül-, naftüül-, -(C14)arüül- või -(5-105
lüliline)heteroarüülrühm, millest igaüks on asendamata või asendatud ühe või
enama rühmaga R6.
Järgmises teostuses m on 1 ja R3 on -CH3.
Järgmises teostuses R4 on -OH.
Järgmises teostuses R4 on -OCF3.
10
Järgmises teostuses R4 on halogenorühm.
Järgmises teostuses R4 on -(C1-C6)alküülrühm.
Järgmises teostuses R4 on -CH3.
Järgmises teostuses R4 on -CH2OH.
Järgmises teostuses R4 on -CH2Cl.
15
Järgmises teostuses R4 on -CH2Br.
Järgmises teostuses R4 on -CH2I.
Järgmises teostuses R4 on -CH2F.
Järgmises teostuses R4 on -CH(halogeno)2rühm.
EE-EP 1 648 878 B1
58
Järgmises teostuses R4 on -CF3.
Järgmises teostuses R4 on -NO2.
Järgmises teostuses R4 on -OR10.
Järgmises teostuses R4 on -SR13.
5
Järgmises teostuses R4 on -C(O)R10.
Järgmises teostuses R4 on -COOH.
Järgmises teostuses R4 on -C(O)H.
Järgmises teostuses R4 on -COOR10.
Järgmises teostuses R4 on -OC(O)R10.
10
Järgmises teostuses R4 on -SO2R10.
Järgmises teostuses R4 on -OC(O)NHR10.
Järgmises teostuses R4 on -NHC(O)R13.
Järgmises teostuses R4 on -CON(R13)2.
Järgmises teostuses on Ar3
(R9)s
15
EE-EP 1 648 878 B1
59
ja s on 1.
Järgmises teostuses on Ar3
(R11)r
ja r on 1.
5
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on
halogenorühm ja Ar3 on
(R11)r
.
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -F ja Ar3 on
(R11)r
.
10
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -Cl ja Ar3 on
(R11)r
.
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -Br ja Ar3 on
EE-EP 1 648 878 B1
60
(R11)r
.
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -I ja Ar3 on
(R11)r
.
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on
5
halogenorühm ja Ar3 on
(R9)s
.
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -F ja Ar3 on
(R9)s
.
Järgmises teostuses X on O, m on 0, R4 on -Cl ja Ar3 on
(R9)s
10
.
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -Br ja Ar3 on
EE-EP 1 648 878 B1
61
(R9)s
.
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -I ja Ar3 on
(R9)s
.
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -OH ja Ar3
5
on
(R11)r
.
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -OH ja Ar3
on
(R9)s
.
10
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -OH ja Ar3
on
(R9)s
,
milles s on 1 ja R9 on -(C1-C6)alküülrühm.
EE-EP 1 648 878 B1
62
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -OH ja Ar3
on
(R9)s
,
milles s on 1 ja R9 on -CH3.
5
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -CH3 ja Ar3
on
(R11)r
.
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -CH3 ja Ar3
on
(R9)s
10
.
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -CH3 ja Ar3
on
(R9)s
ning s on 1 ja R9 on -(C1-C6)alküülrühm.
EE-EP 1 648 878 B1
63
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -CH3 ja Ar3
on
(R9)s
,
milles s on 1 ja R9 on -CH3.
5
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -OR10 ja Ar3
on
(R11)r
.
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -OR10 ja Ar3
on
(R9)s
10
.
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -OR10 ja Ar3
on
(R9)s
,
s on 1 ja R9 on -(C1-C6)alküülrühm.
EE-EP 1 648 878 B1
64
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -OR10 ja Ar3
on
(R9)s
,
s on 1 ja R9 on -CH3.
5
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -C(O)R10 ja
Ar3 on
(R11)r
.
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -C(O)R10 ja
Ar3 on
(R9)s
10
.
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -C(O)R10 ja
Ar3 on
(R9)s
,
s on 1 ja R9 on -(C1-C6)alküülrühm.
EE-EP 1 648 878 B1
65
Järgmises teostuses on Ar1 püridasinüülrühm, X on O, m on 0, R4 on -C(O)R10 ja
Ar3 on
(R9)s
,
s on 1 ja R9 on -CH3.
5
4.4 PIPERIDIINIÜHENDID VALEMITEGA (I)-(III)
Piperidiiniühendite puhul, milles esineb rühm R3, võib rühm R3 olla seotud
süsinikuaatomiga, mis paikneb kõrvuti süsinikuaatomiga, millega on seotud rühm
R4, või rühm R3 võib olla seotud süsinikuaatomiga, mis paikneb kõrvuti lämmastikuaatomiga, millega on seotud rühm -C(X)NH-Ar2 või -C(X)NH-Ar3. Ühes teos10
tuses on rühm R3 seotud süsinikuaatomiga, mis paikneb kõrvuti süsinikuaatomiga, millega on seotud rühm R4. Järgmises teostuses on rühm R3 seotud
süsinikuaatomiga, mis paikneb kõrvuti lämmastikuaatomiga, millega on seotud
rühm -C(X)NH-Ar2 või -C(X)NH-Ar3.
Ühes teostuses, milles piperidiiniühendis esineb rühm R3, on süsinikuaatom,
15
millega rühm R3 on seotud, (R)-konfiguratsioonis. Järgmises teostuses, milles
piperidiiniühendis esineb rühm R3, on süsinikuaatom, millega rühm R3 on seotud,
(S)-konfiguratsioonis.
Järgmises teostuses esineb piperidiiniühendil rühm R3, rühm R3 on seotud
süsinikuaatomiga, mis paikneb kõrvuti süsinikuaatomiga, millega on seotud rühm
20
R4, ja süsinikuaatom, millega rühm R3 on seotud, on (R)-konfiguratsioonis.
Järgmises teostuses esineb piperidiiniühendil rühm R3, rühm R3 on seotud
süsinikuaatomiga, mis paikneb kõrvuti süsinikuaatomiga, millega on seotud rühm
R4, süsinikuaatom, millega rühm R3 on seotud, on (R)-konfiguratsioonis, ja R3 on
66
EE-EP 1 648 878 B1
-(C1-C4)alküülrühm, mis on asendamata või asendatud ühe või enama halogenorühmaga.
Järgmises teostuses esineb piperidiiniühendil rühm R3, rühm R3 on seotud
süsinikuaatomiga, mis paikneb kõrvuti süsinikuaatomiga, millega on seotud rühm
5
R4, süsinikuaatom, millega rühm R3 on seotud, on (R)-konfiguratsioonis ja R3 on
-CH3.
Järgmises teostuses esineb piperidiiniühendil rühm R3, rühm R3 on seotud
süsinikuaatomiga, mis paikneb kõrvuti süsinikuaatomiga, millega on seotud rühm
R4, süsinikuaatom, millega rühm R3 on seotud, on (R)-konfiguratsioonis ja R3 on
10
-CF3.
Järgmises teostuses esineb piperidiiniühendil rühm R3, rühm R3 on seotud
süsinikuaatomiga, mis paikneb kõrvuti süsinikuaatomiga, millega on seotud rühm
R4, süsinikuaatom, millega rühm R3 on seotud, on (R)-konfiguratsioonis ja R3 on
-CH2CH3.
15
Järgmises teostuses esineb piperidiiniühendil rühm R3, rühm R3 on seotud
süsinikuaatomiga, mis paikneb kõrvuti lämmastikuaatomiga, millega on seotud
rühm -C(X)NH-Ar2 või -C(X)NH-Ar3, ja süsinikuaatom, millega rühm R3 on seotud,
on (R)-konfiguratsioonis.
Järgmises teostuses esineb piperidiiniühendil rühm R3, rühm R3 on seotud
20
süsinikuaatomiga, mis paikneb kõrvuti lämmastikuaatomiga, millega on seotud
rühm -C(X)NH-Ar2 või -C(X)NH-Ar3, süsinikuaatom, millega rühm R3 on seotud,
on (R)-konfiguratsioonis, ja R3 on -(C1-C4)alküülrühm, mis on asendamata või
asendatud ühe või enama halogenorühmaga.
Järgmises teostuses esineb piperidiiniühendil rühm R3, rühm R3 on seotud
25
süsinikuaatomiga, mis paikneb kõrvuti lämmastikuaatomiga, millega on seotud
67
EE-EP 1 648 878 B1
rühm -C(X)NH-Ar2 või -C(X)NH-Ar3, süsinikuaatom, millega rühm R3 on seotud,
on (R)-konfiguratsioonis ja R3 on -CH3.
Järgmises teostuses esineb piperidiiniühendil rühm R3, rühm R3 on seotud
süsinikuaatomiga, mis paikneb kõrvuti lämmastikuaatomiga, millega on seotud
5
rühm -C(X)NH-Ar2 või -C(X)NH-Ar3, süsinikuaatom, millega rühm R3 on seotud,
on (R)-konfiguratsioonis ja R3 on -CF3.
Järgmises teostuses esineb piperidiiniühendil rühm R3, rühm R3 on seotud
süsinikuaatomiga, mis paikneb kõrvuti lämmastikuaatomiga, millega on seotud
rühm -C(X)NH-Ar2 või -C(X)NH-Ar3, süsinikuaatom, millega rühm R3 on seotud,
10
on (R)-konfiguratsioonis ja R3 on -CH2CH3.
Järgmises teostuses esineb piperidiiniühendil rühm R3, rühm R3 on seotud
süsinikuaatomiga, mis paikneb kõrvuti süsinikuaatomiga, millega on seotud rühm
R4, ja süsinikuaatom, millega rühm R3 on seotud, on (S)-konfiguratsioonis.
Järgmises teostuses on piperidiiniühendil rühm R3, rühm R3 on seotud
15
süsinikuaatomiga, mis paikneb kõrvuti süsinikuaatomiga, millega on seotud rühm
R4, süsinikuaatom, millega rühm R3 on seotud, on (S)-konfiguratsioonis, ja R3 on
-(C1-C4)alküülrühm, mis on asendamata või asendatud ühe või enama
halogenorühmaga.
Järgmises teostuses esineb piperidiiniühendil rühm R3, rühm R3 on seotud
20
süsinikuaatomiga, mis paikneb kõrvuti süsinikuaatomiga, millega on seotud rühm
R4, süsinikuaatom, millega rühm R3 on seotud, on (S)-konfiguratsioonis ja R3 on
-CH3.
Järgmises teostuses esineb piperidiiniühendil rühm R3, rühm R3 on seotud
süsinikuaatomiga, mis paikneb kõrvuti süsinikuaatomiga, millega on seotud rühm
25
R4, süsinikuaatom, millega rühm R3 on seotud, on (S)-konfiguratsioonis ja R3 on
-CF3.
68
EE-EP 1 648 878 B1
Järgmises teostuses esineb piperidiiniühendil rühm R3, rühm R3 on seotud
süsinikuaatomiga, mis paikneb kõrvuti süsinikuaatomiga, millega on seotud rühm
R4, süsinikuaatom, millega rühm R3 on seotud, on (S)-konfiguratsioonis ja R3 on
-CH2CH3.
5
Järgmises teostuses esineb piperidiiniühendil rühm R3, rühm R3 on seotud
süsinikuaatomiga, mis paikneb kõrvuti lämmastikuaatomiga, millega on seotud
rühm -C(X)NH-Ar2 või -C(X)NH-Ar3, ja süsinikuaatom, millega rühm R3 on seotud,
on (S)-konfiguratsioonis.
Järgmises teostuses esineb piperidiiniühendil rühm R3, rühm R3 on seotud
10
süsinikuaatomiga, mis paikneb kõrvuti lämmastikuaatomiga, millega on seotud
rühm -C(X)NH-Ar2 või -C(X)NH-Ar3, süsinikuaatom, millega rühm R3 on seotud,
on (S)-konfiguratsioonis, ja R3 on -(C1-C4)alküülrühm, mis on asendamata või
asendatud ühe või enama halogenorühmaga.
Järgmises teostuses esineb piperidiiniühendil rühm R3, rühm R3 on seotud
15
süsinikuaatomiga, mis paikneb kõrvuti lämmastikuaatomiga, millega on seotud
rühm -C(X)NH-Ar2 või -C(X)NH-Ar3, süsinikuaatom, millega rühm R3 on seotud,
on (S)-konfiguratsioonis ja R3 on -CH3.
Järgmises teostuses esineb piperidiiniühendil rühm R3, rühm R3 on seotud
süsinikuaatomiga, mis paikneb kõrvuti lämmastikuaatomiga, millega on seotud
20
rühm -C(X)NH-Ar2 või -C(X)NH-Ar3, süsinikuaatom, millega rühm R3 on seotud,
on (S)-konfiguratsioonis ja R3 on -CF3.
Järgmises teostuses esineb piperidiiniühendil rühm R3, rühm R3 on seotud
süsinikuaatomiga, mis paikneb kõrvuti lämmastikuaatomiga, millega on seotud
rühm -C(X)NH-Ar2 või -C(X)NH-Ar3, süsinikuaatom, millega rühm R3 on seotud,
25
on (S)-konfiguratsioonis ja R3 on -CH2CH3.
69
EE-EP 1 648 878 B1
Järgmises teostuses on rühm R3 seotud süsinikuaatomiga, mis paikneb kõrvuti
lämmastikuaatomiga, millega on seotud rühm -C(X)NH-Ar2 või -C(X)NH-Ar3 ja R3
on -CH3.
Järgmises teostuses on rühm R3 seotud süsinikuaatomiga, mis paikneb kõrvuti
5
lämmastikuaatomiga, millega on seotud rühm -C(X)NH-Ar2 või -C(X)NH-Ar3 ja R3
on -CF3.
Järgmises teostuses on rühm R3 seotud süsinikuaatomiga, mis paikneb kõrvuti
lämmastikuaatomiga, millega on seotud rühm -C(X)NH-Ar2 või -C(X)NH-Ar3 ja R3
on -CH2CH3.
10
Järgmises teostuses on rühm R3 seotud süsinikuaatomiga, mis paikneb kõrvuti
lämmastikuaatomiga, millega on seotud rühm -C(X)NH-Ar2 või -C(X)NH-Ar3, ja
süsinikuaatom, millega rühm R3 on seotud, on (R)-konfiguratsioonis.
Järgmises teostuses on rühm R3 seotud süsinikuaatomiga, mis paikneb kõrvuti
lämmastikuaatomiga, millega on seotud rühm -C(X)NH-Ar2 või -C(X)NH-Ar3,
15
süsinikuaatom, millega rühm R3 on seotud, on (R)-konfiguratsioonis ja R3 on
-CH3.
Järgmises teostuses on rühm R3 seotud süsinikuaatomiga, mis paikneb kõrvuti
lämmastikuaatomiga, millega on seotud rühm -C(X)NH-Ar2 või -C(X)NH-Ar3,
süsinikuaatom, millega rühm R3 on seotud, on (R)-konfiguratsioonis ja R3 on
20
-CF3.
Järgmises teostuses on rühm R3 seotud süsinikuaatomiga, mis paikneb kõrvuti
lämmastikuaatomiga, millega on seotud rühm -C(X)NH-Ar2 või -C(X)NH-Ar3,
süsinikuaatom, millega rühm R3 on seotud, on (R)-konfiguratsioonis ja R3 on
-CH2CH3.
25
Järgmises teostuses m on 1 ja R3 on R4 cis-isomeer.
EE-EP 1 648 878 B1
70
Järgmises teostuses m on 1 ja R3 on R4 trans-isomeer.
Näitena toodud piperidiiniühendid on loetletud allpool tabelites 1-18.
Tabel 1
N
R1
Cl
N
O
NH
R9
(IIa)
5
ja selle farmatseutiliselt vastuvõetavad soolad, milles:
Ühend
R1
R9
AAA
-Cl
-H
AAB
-Cl
-tert-butüül
AAC
-Cl
-iso-butüül
AAD
-Cl
-sec-butüül
AAE
-Cl
-tsükloheksüül
AAF
-Cl
-tert-butoksü
AAG
-Cl
-iso-propoksü
AAH
-Cl
-CF3
AAI
-Cl
-CH2CF3
AAJ
-Cl
-OCF3
EE-EP 1 648 878 B1
71
AAK
-Cl
-Cl
AAL
-Cl
-Br
AAM
-Cl
-I
AAN
-Cl
-n-butüül
AAO
-Cl
-n-propüül
AAP
-F
-H
AAQ
-F
-tert-butüül
AAR
-F
-iso-butüül
AAS
-F
-sec-butüül
AAT
-F
-tsükloheksüül
AAU
-F
-tert-butoksü
AAV
-F
-iso-propoksü
AAW
-F
-CF3
AAX
-F
-CH2CF3
AAY
-F
-OCF3
AAZ
-F
-Cl
ABA
-F
-Br
ABB
-F
-I
ABC
-F
-n-butüül
ABD
-F
-n-propüül
ABE
-CH3
-H
ABF
-CH3
-iso-butüül
ABG
-CH3
-tert-butüül
ABH
-CH3
-sec-butüül
ABI
-CH3
-tsükloheksüül
ABJ
-CH3
-tert-butoksü
ABK
-CH3
-iso-propoksü
ABL
-CH3
-CF3
ABM
-CH3
-CH2CF3
ABN
-CH3
-OCF3
ABO
-CH3
-Cl
ABP
-CH3
-Br
EE-EP 1 648 878 B1
72
ABQ
-CH3
-I
ABR
-CH3
-n-butüül
ABS
-CH3
-n-propüül
ABT
-CF3
-H
ABU
-CF3
-tert-butüül
ABV
-CF3
-iso-butüül
ABW
-CF3
-sec-butüül
ABX
-CF3
-tsükloheksüül
ABY
-CF3
-tert-butoksü
ABZ
-CF3
-iso-propoksü
ACA
-CF3
-CF3
ACB
-CF3
-CH2CF3
ACC
-CF3
-OCF3
ACD
-CF3
-Cl
ACE
-CF3
-Br
ACF
-CF3
-I
ACG
-CF3
-n-butüül
ACH
-CF3
-n-propüül
ACI
-CHF2
-tert-butüül
ACJ
-CHF2
-H
ACK
-CHF2
-iso-butüül
ACL
-CHF2
-sec-butüül
ACM
-CHF2
-tsükloheksüül
CAN
-CHF2
-tert-butoksü
ACO
-CHF2
-iso-propoksü
ACP
-CHF2
-CF3
ACQ
-CHF2
-CH2CF3
ACR
-CHF2
-OCF3
ACS
-CHF2
-Cl
ACT
-CHF2
-Br
ACU
-CHF2
-I
ACV
-CHF2
-n-butüül
EE-EP 1 648 878 B1
73
ACW
-CHF2
-n-propüül
ACX
-OH
-H
ACY
-OH
-tert-butüül
ACZ
-OH
-iso-butüül
ADA
-OH
-sec-butüül
ADB
-OH
-tsükloheksüül
ADC
-OH
-tert-butoksü
ADD
-OH
-iso-propoksü
ADE
-OH
-CF3
ADF
-OH
-CH2CF3
ADG
-OH
-OCF3
ADH
-OH
-Cl
ADI
-OH
-Br
ADJ
-OH
-I
ADK
-OH
-n-butüül
ADL
-OH
-n-propüül
ADM
-NO2
-H
AND
-NO2
-tert-butüül
ADO
-NO2
-iso-butüül
ADP
-NO2
-sec-butüül
ADQ
-NO2
-tsükloheksüül
ADR
-NO2
-tert-butoksü
ADS
-NO2
-iso-propoksü
ADT
-NO2
-CF3
ADU
-NO2
-CH2CF3
ADV
-NO2
-OCF3
ADW
-NO2
-Cl
ADX
-NO2
-Br
ADY
-NO2
-I
ADZ
-NO2
-n-butüül
AEA
-NO2
-n-propüül
AEB
-CN
-H
EE-EP 1 648 878 B1
74
AEC
-CN
-tert-butüül
AED
-CN
-iso-butüül
AEE
-CN
-sec-butüül
AEF
-CN
-tsükloheksüül
AEG
-CN
-tert-butoksü
AEH
-CN
-iso-propoksü
AEI
-CN
-CF3
AEJ
-CN
-CH2CF3
AEK
-CN
-OCF3
AEL
-CN
-Cl
AEM
-CN
-Br
AEN
-CN
-I
AEO
-CN
-n-butüül
AEP
-CN
-n-propüül
AEQ
-Br
-H
AER
-Br
-tert-butüül
AES
-Br
-iso-butüül
AET
-Br
-sec-butüül
AEU
-Br
-tsükloheksüül
AEV
-Br
-tert-butoksü
AEW
-Br
-iso-propoksü
AEX
-Br
-CF3
AEY
-Br
-CH2CF3
AEZ
-Br
-OCF3
AFA
-Br
-Cl
AFB
-Br
-Br
AFC
-Br
-I
AFD
-Br
-n-butüül
AFE
-Br
-n-propüül
AFF
-I
-tert-butüül
AFG
-I
-H
AFH
-I
-iso-butüül
EE-EP 1 648 878 B1
75
AFI
-I
-sec-butüül
AFJ
-I
-tsükloheksüül
AFK
-I
-tert-butoksü
AFL
-I
-iso-propoksü
AFM
-I
-CF3
AFN
-I
-CH2CF3
AFO
-I
-OCF3
AFP
-I
-Cl
AFQ
-I
-Br
AFR
-I
-I
AFS
-I
-n-butüül
AFT
-I
-n-propüül
Tabel 2
N
R1
Br
N
O
NH
R9
(IIb)
5
ja selle farmatseutiliselt vastuvõetavad soolad, milles:
EE-EP 1 648 878 B1
76
Ühend
R1
R9
AFU
-Cl
-H
AFV
-Cl
-tert-butüül
AFW
-Cl
-iso-butüül
AFX
-Cl
-sec-butüül
AFY
-Cl
-tsükloheksüül
AFZ
-Cl
-tert-butoksü
AGA
-Cl
-iso-propoksü
AGB
-Cl
-CF3
AGC
-Cl
-CH2CF3
AGD
-Cl
-OCF3
AGE
-Cl
-Cl
AGF
-Cl
-Br
AGG
-Cl
-I
AGH
-Cl
-n-butüül
AGI
-Cl
-n-propüül
AGJ
-F
-H
AGK
-F
-tert-butüül
AGL
-F
-iso-butüül
AGM
-F
-sec-butüül
AGN
-F
-tsükloheksüül
AGO
-F
-tert-butoksü
AGP
-F
-iso-propoksü
AGQ
-F
-CF3
AGR
-F
-CH2CF3
AGS
-F
-OCF3
AGT
-F
-Cl
AGU
-F
-Br
AGV
-F
-I
AGW
-F
-n-butüül
EE-EP 1 648 878 B1
77
AGX
-F
-n-propüül
AGY
-CH3
-H
AGZ
-CH3
-tert-butüül
AHA
-CH3
-iso-butüül
AHB
-CH3
-sec-butüül
AHC
-CH3
-tsükloheksüül
AHD
-CH3
-tert-butoksü
AHE
-CH3
-iso-propoksü
AHF
-CH3
-CF3
AHG
-CH3
-CH2CF3
AHH
-CH3
-OCF3
AHI
-CH3
-Cl
AHJ
-CH3
-Br
AHK
-CH3
-I
AHL
-CH3
-n-butüül
AHM
-CH3
-n-propüül
AHN
-CF3
-H
AHO
-CF3
-tert-butüül
AHP
-CF3
-iso-butüül
AHQ
-CF3
-sec-butüül
AHR
-CF3
-tsükloheksüül
AHS
-CF3
-tert-butoksü
AHT
-CF3
-iso-propoksü
AHU
-CF3
-CF3
AHV
-CF3
-CH2CF3
AHW
-CF3
-OCF3
AHX
-CF3
-Cl
AHY
-CF3
-Br
AHZ
-CF3
-I
AIA
-CF3
-n-butüül
AIB
-CF3
-n-propüül
AIC
-CHF2
-tert-butüül
EE-EP 1 648 878 B1
78
AID
-CHF2
-H
AIE
-CHF2
-iso-butüül
AIF
-CHF2
-sec-butüül
AIG
-CHF2
-tsükloheksüül
AIH
-CHF2
-tert-butoksü
AII
-CHF2
-iso-propoksü
AIJ
-CHF2
-CF3
AIK
-CHF2
-CH2CF3
AIL
-CHF2
-OCF3
AIM
-CHF2
-Cl
AIN
-CHF2
-Br
AIO
-CHF2
-I
AIP
-CHF2
-n-butüül
AIQ
-CHF2
-n-propüül
AIR
-OH
-H
AIS
-OH
-tert-butüül
AIT
-OH
-iso-butüül
AIU
-OH
-sec-butüül
AIV
-OH
-tsükloheksüül
AIW
-OH
-tert-butoksü
AIX
-OH
-iso-propoksü
AIY
-OH
-CF3
AIZ
-OH
-CH2CF3
AJA
-OH
-OCF3
AJB
-OH
-Cl
AJC
-OH
-Br
AJD
-OH
-I
AJE
-OH
-n-butüül
AJF
-OH
-n-propüül
AJG
-NO2
-H
AJH
-NO2
-tert-butüül
AJI
-NO2
-iso-butüül
EE-EP 1 648 878 B1
79
AJJ
-NO2
-sec-butüül
AJK
-NO2
-tsükloheksüül
AJL
-NO2
-tert-butoksü
AJM
-NO2
-iso-propoksü
AJN
-NO2
-CF3
AJO
-NO2
-CH2CF3
AJP
-NO2
-OCF3
AJQ
-NO2
-Cl
AJR
-NO2
-Br
AJS
-NO2
-I
AJT
-NO2
-n-butüül
AJU
-NO2
-n-propüül
AJV
-CN
-H
AJW
-CN
-tert-butüül
AJX
-CN
-iso-butüül
AJY
-CN
-sec-butüül
AJZ
-CN
-tsükloheksüül
AKA
-CN
-tert-butoksü
AKB
-CN
-iso-propoksü
AKC
-CN
-CF3
AKD
-CN
-CH2CF3
AKE
-CN
-OCF3
AKF
-CN
-Cl
AKG
-CN
-Br
AKH
-CN
-I
AKI
-CN
-n-butüül
AKJ
-CN
-n-propüül
AKK
-Br
-H
AKL
-Br
-tert-butüül
AKM
-Br
-iso-butüül
AKN
-Br
-sec-butüül
AKO
-Br
-tsükloheksüül
EE-EP 1 648 878 B1
80
AKP
-Br
-tert-butoksü
AKQ
-Br
-iso-propoksü
AKR
-Br
-CF3
AKS
-Br
-CH2CF3
AKT
-Br
-OCF3
AKU
-Br
-Cl
AKV
-Br
-Br
AKW
-Br
-I
AKX
-Br
-n-butüül
AKY
-Br
-n-propüül
AKZ
-I
-tert-butüül
ALA
-I
-H
ALB
-I
-iso-butüül
ALC
-I
-sec-butüül
ALD
-I
-tsükloheksüül
ALE
-I
-tert-butoksü
ALF
-I
-iso-propoksü
ALG
-I
-CF3
ALH
-I
-CH2CF3
ALI
-I
-OCF3
ALJ
-I
-Cl
ALK
-I
-Br
ALL
-I
-I
ALM
-I
-n-butüül
ALN
-I
-n-propüül
EE-EP 1 648 878 B1
81
Tabel 3
N
R1
F
N
O
NH
R9
(IIc)
ja selle farmatseutiliselt vastuvõetavad soolad, milles:
Ühend
R1
R9
ALO
-Cl
-H
ALP
-Cl
-tert-butüül
ALQ
-Cl
-iso-butüül
ALR
-Cl
-sec-butüül
ALS
-Cl
-tsükloheksüül
ALT
-Cl
-tert-butoksü
ALU
-Cl
-iso-propoksü
ALV
-Cl
-CF3
ALW
-Cl
-CH2CF3
ALX
-Cl
-OCF3
ALY
-Cl
-Cl
ALZ
-Cl
-Br
AMA
-Cl
-I
AMB
-Cl
-n-butüül
EE-EP 1 648 878 B1
82
AMC
-Cl
-n-propüül
AMD
-F
-H
AME
-F
-tert-butüül
AMF
-F
-iso-butüül
AMG
-F
-sec-butüül
AMH
-F
-tsükloheksüül
AMI
-F
-tert-butoksü
AMJ
-F
-iso-propoksü
AMK
-F
-CF3
AML
-F
-CH2CF3
AMM
-F
-OCF3
AMN
-F
-Cl
AMO
-F
-Br
AMP
-F
-I
AMQ
-F
-n-butüül
AMR
-F
-n-propüül
AMS
-CH3
-H
AMT
-CH3
-tert-butüül
AMU
-CH3
-iso-butüül
AMV
-CH3
-sec-butüül
AMW
-CH3
-tsükloheksüül
AMX
-CH3
-tert-butoksü
AMY
-CH3
-iso-propoksü
AMZ
-CH3
-CF3
ANA
-CH3
-CH2CF3
ANB
-CH3
-OCF3
ANC
-CH3
-Cl
AND
-CH3
-Br
ANE
-CH3
-I
ANF
-CH3
-n-butüül
ANG
-CH3
-n-propüül
ANH
-CF3
-H
EE-EP 1 648 878 B1
83
ANI
-CF3
-tert-butüül
ANJ
-CF3
-iso-butüül
ANK
-CF3
-sec-butüül
ANL
-CF3
-tsükloheksüül
ANM
-CF3
-tert-butoksü
ANN
-CF3
-iso-propoksü
ANO
-CF3
-CF3
ANP
-CF3
-CH2CF3
ANQ
-CF3
-OCF3
ANR
-CF3
-Cl
ANS
-CF3
-Br
ANT
-CF3
-I
ANU
-CF3
-n-butüül
ANV
-CF3
-n-propüül
ANW
-CHF2
-tert-butüül
ANX
-CHF2
-H
ANY
-CHF2
-iso-butüül
ANZ
-CHF2
-sec-butüül
AOA
-CHF2
-tsükloheksüül
AOB
-CHF2
-tert-butoksü
AOC
-CHF2
-iso-propoksü
AOD
-CHF2
-CF3
AOE
-CHF2
-CH2CF3
AOF
-CHF2
-OCF3
AOG
-CHF2
-Cl
AOH
-CHF2
-Br
AOI
-CHF2
-I
AOJ
-CHF2
-n-butüül
AOK
-CHF2
-n-propüül
AOL
-OH
-H
AOM
-OH
-tert-butüül
AON
-OH
-iso-butüül
EE-EP 1 648 878 B1
84
AOO
-OH
-sec-butüül
AOP
-OH
-tsükloheksüül
AOQ
-OH
-tert-butoksü
AOR
-OH
-iso-propoksü
AOS
-OH
-CF3
AOT
-OH
-CH2CF3
AOU
-OH
-OCF3
AOV
-OH
-Cl
AOW
-OH
-Br
AOX
-OH
-I
AOY
-OH
-n-butüül
AOZ
-OH
-n-propüül
APA
-NO2
-H
APB
-NO2
-tert-butüül
APC
-NO2
-iso-butüül
APD
-NO2
-sec-butüül
APE
-NO2
-tsükloheksüül
APF
-NO2
-tert-butoksü
APG
-NO2
-iso-propoksü
APH
-NO2
-CF3
API
-NO2
-CH2CF3
APJ
-NO2
-OCF3
APK
-NO2
-Cl
APL
-NO2
-Br
APM
-NO2
-I
APN
-NO2
-n-butüül
APO
-NO2
-n-propüül
APP
-CN
-H
APQ
-CN
-tert-butüül
APR
-CN
-iso-butüül
APS
-CN
-sec-butüül
APT
-CN
-tsükloheksüül
EE-EP 1 648 878 B1
85
APU
-CN
-tert-butoksü
APV
-CN
-iso-propoksü
APW
-CN
-CF3
APX
-CN
-CH2CF3
APY
-CN
-OCF3
APZ
-CN
-Cl
AQA
-CN
-Br
AQB
-CN
-I
AQC
-CN
-n-butüül
AQD
-CN
-n-propüül
AQE
-Br
-H
AQF
-Br
-tert-butüül
AQG
-Br
-iso-butüül
AQH
-Br
-sec-butüül
AQI
-Br
-tsükloheksüül
AQJ
-Br
-tert-butoksü
AQK
-Br
-iso-propoksü
AQL
-Br
-CF3
AQM
-Br
-CH2CF3
AQN
-Br
-OCF3
AQO
-Br
-Cl
AQP
-Br
-Br
AQQ
-Br
-I
AQR
-Br
-n-butüül
AQS
-Br
-n-propüül
AQT
-I
-tert-butüül
AQU
-I
-H
AQV
-I
-iso-butüül
AQW
-I
-sec-butüül
AQX
-I
-tsükloheksüül
AQY
-I
-tert-butoksü
AQZ
-I
-iso-propoksü
EE-EP 1 648 878 B1
86
ARA
-I
-CF3
ARB
-I
-CH2CF3
ARC
-I
-OCF3
ARD
-I
-Cl
ARE
-I
-Br
ARF
-I
-I
ARG
-I
-n-butüül
ARH
-I
-n-propüül
Tabel 4
N
R1
I
N
O
NH
R9
(IId)
5
ja selle farmatseutiliselt vastuvõetavad soolad, milles:
Ühend
R1
R9
ARI
-Cl
-H
ARJ
-Cl
-tert-butüül
ARK
-Cl
-iso-butüül
ARL
-Cl
-sec-butüül
EE-EP 1 648 878 B1
87
ARM
-Cl
-tsükloheksüül
ARN
-Cl
-tert-butoksü
ARO
-Cl
-iso-propoksü
ARP
-Cl
-CF3
ARQ
-Cl
-CH2CF3
ARR
-Cl
-OCF3
ARS
-Cl
-Cl
ART
-Cl
-Br
ARU
-Cl
-I
ARV
-Cl
-n-butüül
ARW
-Cl
-n-propüül
ARX
-F
-H
ARY
-F
-tert-butüül
ARZ
-F
-iso-butüül
ASA
-F
-sec-butüül
ASB
-F
-tsükloheksüül
ASC
-F
-tert-butoksü
ASD
-F
-iso-propoksü
ASE
-F
-CF3
ASF
-F
-CH2CF3
ASG
-F
-OCF3
ASH
-F
-Cl
ASI
-F
-Br
ASJ
-F
-I
ASK
-F
-n-butüül
ASL
-F
-n-propüül
ASM
-CH3
-H
ASN
-CH3
-tert-butüül
ASO
-CH3
-iso-butüül
ASP
-CH3
-sec-butüül
ASQ
-CH3
-tsükloheksüül
ASR
-CH3
-tert-butoksü
EE-EP 1 648 878 B1
88
ASS
-CH3
-iso-propoksü
AST
-CH3
-CF3
ASU
-CH3
-CH2CF3
ASV
-CH3
-OCF3
ASW
-CH3
-Cl
ASX
-CH3
-Br
ASY
-CH3
-I
ASZ
-CH3
-n-butüül
ATA
-CH3
-n-propüül
ATB
-CF3
-H
ATC
-CF3
-tert-butüül
ATD
-CF3
-iso-butüül
ATE
-CF3
-sec-butüül
ATF
-CF3
-tsükloheksüül
ATG
-CF3
-tert-butoksü
ATH
-CF3
-iso-propoksü
ATI
-CF3
-CF3
ATJ
-CF3
-CH2CF3
ATK
-CF3
-OCF3
ATL
-CF3
-Cl
ATM
-CF3
-Br
ATN
-CF3
-I
ATO
-CF3
-n-butüül
ATP
-CF3
-n-propüül
ATQ
-CHF2
-tert-butüül
ATR
-CHF2
-H
ATS
-CHF2
-iso-butüül
ATT
-CHF2
-sec-butüül
ATU
-CHF2
-tsükloheksüül
ATV
-CHF2
-tert-butoksü
ATW
-CHF2
-iso-propoksü
ATX
-CHF2
-CF3
EE-EP 1 648 878 B1
89
ATY
-CHF2
-CH2CF3
ATZ
-CHF2
-OCF3
AUA
-CHF2
-Cl
AUB
-CHF2
-Br
AUC
-CHF2
-I
AUD
-CHF2
-n-butüül
AUE
-CHF2
-n-propüül
AUF
-OH
-H
AUG
-OH
-tert-butüül
AUH
-OH
-iso-butüül
AUI
-OH
-sec-butüül
AUJ
-OH
-tsükloheksüül
AUK
-OH
-tert-butoksü
AUL
-OH
-iso-propoksü
AUM
-OH
-CF3
AUN
-OH
-CH2CF3
AUO
-OH
-OCF3
AUP
-OH
-Cl
AUQ
-OH
-Br
AUR
-OH
-I
AUS
-OH
-n-butüül
AUT
-OH
-n-propüül
AUU
-NO2
-H
AUV
-NO2
-tert-butüül
AUW
-NO2
-iso-butüül
AUX
-NO2
-sec-butüül
AUY
-NO2
-tsükloheksüül
AUZ
-NO2
-tert-butoksü
AVA
-NO2
-iso-propoksü
AVB
-NO2
-CF3
AVC
-NO2
-CH2CF3
AVD
-NO2
-OCF3
EE-EP 1 648 878 B1
90
AVE
-NO2
-Cl
AVF
-NO2
-Br
AVG
-NO2
-I
AVH
-NO2
-n-butüül
AVI
-NO2
-n-propüül
AVJ
-CN
-H
AVK
-CN
-tert-butüül
AVL
-CN
-iso-butüül
AVM
-CN
-sec-butüül
AVN
-CN
-tsükloheksüül
AVO
-CN
-tert-butoksü
AVP
-CN
-iso-propoksü
AVQ
-CN
-CF3
AVR
-CN
-CH2CF3
AVS
-CN
-OCF3
AVT
-CN
-Cl
AVU
-CN
-Br
AVV
-CN
-I
AVW
-CN
-n-butüül
AVX
-CN
-n-propüül
AVY
-Br
-H
AVZ
-Br
-tert-butüül
AWA
-Br
-iso-butüül
AWB
-Br
-sec-butüül
AWC
-Br
-tsükloheksüül
AWD
-Br
-tert-butoksü
AWE
-Br
-iso-propoksü
AWF
-Br
-CF3
AWG
-Br
-CH2CF3
AWH
-Br
-OCF3
AWI
-Br
-Cl
AWJ
-Br
-Br
EE-EP 1 648 878 B1
91
AWK
-Br
-I
AWL
-Br
-n-butüül
AWM
-Br
-n-propüül
AWN
-I
-tert-butüül
AWO
-I
-H
AWP
-I
-iso-butüül
AWQ
-I
-sec-butüül
AWR
-I
-tsükloheksüül
AWS
-I
-tert-butoksü
AWT
-I
-iso-propoksü
AWU
-I
-CF3
AWV
-I
-CH2CF3
AWW
-I
-OCF3
AWX
-I
-Cl
AWY
-I
-Br
AWZ
-I
-I
AXA
-I
-n-butüül
AXB
-I
-n-propüül
EE-EP 1 648 878 B1
92
Tabel 5
N
R1
OH
N
O
NH
R9
(IIe)
ja selle farmatseutiliselt vastuvõetavad soolad, milles:
Ühend
R1
R9
AXC
-Cl
-H
AXD
-Cl
-tert-butüül
AXE
-Cl
-iso-butüül
AXF
-Cl
-sec-butüül
AXG
-Cl
-tsükloheksüül
AXH
-Cl
-tert-butoksü
AXI
-Cl
-iso-propoksü
AXJ
-Cl
-CF3
AXK
-Cl
-CH2CF3
AXL
-Cl
-OCF3
AXM
-Cl
-Cl
AXN
-Cl
-Br
AXO
-Cl
-I
AXP
-Cl
-n-butüül
EE-EP 1 648 878 B1
93
AXQ
-Cl
-n-propüül
AXR
-F
-H
AXS
-F
-tert-butüül
AXT
-F
-iso-butüül
AXU
-F
-sec-butüül
AXV
-F
-tsükloheksüül
AXW
-F
-tert-butoksü
AXX
-F
-iso-propoksü
AXY
-F
-CF3
AXZ
-F
-CH2CF3
AYA
-F
-OCF3
AYB
-F
-Cl
AYC
-F
-Br
AYD
-F
-I
AYE
-F
-n-butüül
AYF
-F
-n-propüül
AYG
-CH3
-H
AYH
-CH3
-tert-butüül
AYI
-CH3
-iso-butüül
AYJ
-CH3
-sec-butüül
AYK
-CH3
-tsükloheksüül
AYL
-CH3
-tert-butoksü
AYM
-CH3
-iso-propoksü
AYN
-CH3
-CF3
AYO
-CH3
-CH2CF3
AYP
-CH3
-OCF3
AYQ
-CH3
-Cl
AYR
-CH3
-Br
AYS
-CH3
-I
AYT
-CH3
-n-butüül
AYU
-CH3
-n-propüül
AYV
-CF3
-H
EE-EP 1 648 878 B1
94
AYW
-CF3
-tert-butüül
AYX
-CF3
-iso-butüül
AYY
-CF3
-sec-butüül
AYZ
-CF3
-tsükloheksüül
AZA
-CF3
-tert-butoksü
AZB
-CF3
-iso-propoksü
AZC
-CF3
-CF3
AZD
-CF3
-CH2CF3
AZE
-CF3
-OCF3
AZF
-CF3
-Cl
AZG
-CF3
-Br
AZH
-CF3
-I
AZI
-CF3
-n-butüül
AZJ
-CF3
-n-propüül
AZK
-CHF2
-tert-butüül
AZL
-CHF2
-H
AZM
-CHF2
-iso-butüül
AZN
-CHF2
-sec-butüül
AZO
-CHF2
-tsükloheksüül
AZP
-CHF2
-tert-butoksü
AZQ
-CHF2
-iso-propoksü
AZR
-CHF2
-CF3
AZS
-CHF2
-CH2CF3
AZT
-CHF2
-OCF3
AZU
-CHF2
-Cl
AZV
-CHF2
-Br
AZW
-CHF2
-I
AZX
-CHF2
-n-butüül
AZY
-CHF2
-n-propüül
AZZ
-OH
-H
BAA
-OH
-tert-butüül
BAB
-OH
-iso-butüül
EE-EP 1 648 878 B1
95
BAC
-OH
-sec-butüül
BAD
-OH
-tsükloheksüül
BAE
-OH
-tert-butoksü
BAF
-OH
-iso-propoksü
BAG
-OH
-CF3
BAH
-OH
-CH2CF3
BAI
-OH
-OCF3
BAJ
-OH
-Cl
BAK
-OH
-Br
BAL
-OH
-I
BAM
-OH
-n-butüül
BAN
-OH
-n-propüül
BAO
-NO2
-H
BAP
-NO2
-tert-butüül
BAQ
-NO2
-iso-butüül
BAR
-NO2
-sec-butüül
BAS
-NO2
-tsükloheksüül
BAT
-NO2
-tert-butoksü
BAU
-NO2
-iso-propoksü
BAV
-NO2
-CF3
BAW
-NO2
-CH2CF3
BAX
-NO2
-OCF3
BAY
-NO2
-Cl
BAZ
-NO2
-Br
BBA
-NO2
-I
BBB
-NO2
-n-butüül
BBC
-NO2
-n-propüül
BBD
-CN
-H
BBE
-CN
-tert-butüül
BBF
-CN
-iso-butüül
BBG
-CN
-sec-butüül
BBH
-CN
-tsükloheksüül
EE-EP 1 648 878 B1
96
BBI
-CN
-tert-butoksü
BBJ
-CN
-iso-propoksü
BBK
-CN
-CF3
BBL
-CN
-CH2CF3
BBM
-CN
-OCF3
BBN
-CN
-Cl
BBO
-CN
-Br
BBP
-CN
-I
BBQ
-CN
-n-butüül
BBR
-CN
-n-propüül
BBS
-Br
-H
BBT
-Br
-tert-butüül
BBU
-Br
-iso-butüül
BBV
-Br
-sec-butüül
BBW
-Br
-tsükloheksüül
BBX
-Br
-tert-butoksü
BBY
-Br
-iso-propoksü
BBZ
-Br
-CF3
BCA
-Br
-CH2CF3
BCB
-Br
-OCF3
BCC
-Br
-Cl
BCD
-Br
-Br
BCE
-Br
-I
BCF
-Br
-n-butüül
BCG
-Br
-n-propüül
BCH
-I
-tert-butüül
BCI
-I
-H
BCJ
-I
-iso-butüül
BCK
-I
-sec-butüül
BCL
-I
-tsükloheksüül
BCM
-I
-tert-butoksü
BCN
-I
-iso-propoksü
EE-EP 1 648 878 B1
97
BCO
-I
-CF3
BCP
-I
-CH2CF3
BCQ
-I
-OCF3
BCR
-I
-Cl
BCS
-I
-Br
BCT
-I
-I
BCU
-I
-n-butüül
BCV
-I
-n-propüül
Tabel 6
N
R1
CH3
N
O
NH
R9
(IIf)
5
ja selle farmatseutiliselt vastuvõetavad soolad, milles:
Ühend
R1
R9
BCW
-Cl
-H
BCX
-Cl
-tert-butüül
BCY
-Cl
-iso-butüül
BCZ
-Cl
-sec-butüül
EE-EP 1 648 878 B1
98
BDA
-Cl
-tsükloheksüül
BDB
-Cl
-tert-butoksü
BDC
-Cl
-iso-propoksü
BDD
-Cl
-CF3
BDE
-Cl
-CH2CF3
BDF
-Cl
-OCF3
BDG
-Cl
-Cl
BDH
-Cl
-Br
BDI
-Cl
-I
BDJ
-Cl
-n-butüül
BDK
-Cl
-n-propüül
BDL
-F
-H
BDM
-F
-tert-butüül
BDN
-F
-iso-butüül
BDO
-F
-sec-butüül
BDP
-F
-tsükloheksüül
BDQ
-F
-tert-butoksü
BDR
-F
-iso-propoksü
BDS
-F
-CF3
BDT
-F
-CH2CF3
BDU
-F
-OCF3
BDV
-F
-Cl
BDW
-F
-Br
BDX
-F
-I
BDY
-F
-n-butüül
BDZ
-F
-n-propüül
BEA
-CH3
-H
BEB
-CH3
-tert-butüül
BEC
-CH3
-iso-butüül
BED
-CH3
-sec-butüül
BEE
-CH3
-tsükloheksüül
BEF
-CH3
-tert-butoksü
EE-EP 1 648 878 B1
99
BEG
-CH3
-iso-propoksü
BEH
-CH3
-CF3
BEI
-CH3
-CH2CF3
BEJ
-CH3
-OCF3
BEK
-CH3
-Cl
BEL
-CH3
-Br
BEM
-CH3
-I
BEN
-CH3
-n-butüül
BEO
-CH3
-n-propüül
BEP
-CF3
-H
BEQ
-CF3
-tert-butüül
BER
-CF3
-iso-butüül
BES
-CF3
-sec-butüül
BET
-CF3
-tsükloheksüül
BEU
-CF3
-tert-butoksü
BEV
-CF3
-iso-propoksü
BEW
-CF3
-CF3
BEX
-CF3
-CH2CF3
BEY
-CF3
-OCF3
BEZ
-CF3
-Cl
BFA
-CF3
-Br
BFB
-CF3
-I
BFC
-CF3
-n-butüül
BFD
-CF3
-n-propüül
BFE
-CHF2
-tert-butüül
BFF
-CHF2
-H
BFG
-CHF2
-iso-butüül
BFH
-CHF2
-sec-butüül
BFI
-CHF2
-tsükloheksüül
BFJ
-CHF2
-tert-butoksü
BFK
-CHF2
-iso-propoksü
BFL
-CHF2
-CF3
EE-EP 1 648 878 B1
100
BFM
-CHF2
-CH2CF3
BFN
-CHF2
-OCF3
BFO
-CHF2
-Cl
BFP
-CHF2
-Br
BFQ
-CHF2
-I
BFR
-CHF2
-n-butüül
BFS
-CHF2
-n-propüül
BFT
-OH
-H
BFU
-OH
-tert-butüül
BFV
-OH
-iso-butüül
BFW
-OH
-sec-butüül
BFX
-OH
-tsükloheksüül
BFY
-OH
-tert-butoksü
BFZ
-OH
-iso-propoksü
BGA
-OH
-CF3
BGB
-OH
-CH2CF3
BGC
-OH
-OCF3
BGD
-OH
-Cl
BGE
-OH
-Br
BGF
-OH
-I
BGG
-OH
-n-butüül
BGH
-OH
-n-propüül
BGI
-NO2
-H
BGJ
-NO2
-tert-butüül
BGK
-NO2
-iso-butüül
BGL
-NO2
-sec-butüül
BGM
-NO2
-tsükloheksüül
BGN
-NO2
-tert-butoksü
BGO
-NO2
-iso-propoksü
BGP
-NO2
-CF3
BGQ
-NO2
-CH2CF3
BGR
-NO2
-OCF3
EE-EP 1 648 878 B1
101
BGS
-NO2
-Cl
BGT
-NO2
-Br
BGU
-NO2
-I
BGV
-NO2
-n-butüül
BGW
-NO2
-n-propüül
BGX
-CN
-H
BGY
-CN
-tert-butüül
BGZ
-CN
-iso-butüül
BHA
-CN
-sec-butüül
BHB
-CN
-tsükloheksüül
BHC
-CN
-tert-butoksü
BHD
-CN
-iso-propoksü
BHE
-CN
-CF3
BHF
-CN
-CH2CF3
BHG
-CN
-OCF3
BHH
-CN
-Cl
BHI
-CN
-Br
BHJ
-CN
-I
BHK
-CN
-n-butüül
BHL
-CN
-n-propüül
BHM
-Br
-H
BHN
-Br
-tert-butüül
BHO
-Br
-iso-butüül
BHP
-Br
-sec-butüül
BHQ
-Br
-tsükloheksüül
BHR
-Br
-tert-butoksü
BHS
-Br
-iso-propoksü
BHT
-Br
-CF3
BHU
-Br
-CH2CF3
BHV
-Br
-OCF3
BHW
-Br
-Cl
BHX
-Br
-Br
EE-EP 1 648 878 B1
102
BHY
-Br
-I
BHZ
-Br
-n-butüül
BIA
-Br
-n-propüül
BIB
-I
-tert-butüül
BIC
-I
-H
BID
-I
-iso-butüül
BIE
-I
-sec-butüül
BIF
-I
-tsükloheksüül
BIG
-I
-tert-butoksü
BIH
-I
-iso-propoksü
BII
-I
-CF3
BIJ
-I
-CH2CF3
BIK
-I
-OCF3
BIL
-I
-Cl
BIM
-I
-Br
BIN
-I
-I
BIO
-I
-n-butüül
BIP
-I
-n-propüül
EE-EP 1 648 878 B1
103
Tabel 7
N
R1
CF3
N
O
NH
R9
(IIg)
ja selle farmatseutiliselt vastuvõetavad soolad, milles:
Ühend
R1
R9
BIQ
-Cl
-H
BIR
-Cl
-tert-butüül
BIS
-Cl
-iso-butüül
BIT
-Cl
-sec-butüül
BIU
-Cl
-tsükloheksüül
BIV
-Cl
-tert-butoksü
BIW
-Cl
-iso-propoksü
BIX
-Cl
-CF3
BIY
-Cl
-CH2CF3
BIZ
-Cl
-OCF3
BJA
-Cl
-Cl
BJB
-Cl
-Br
BJC
-Cl
-I
BJD
-Cl
-n-butüül
EE-EP 1 648 878 B1
104
BJE
-Cl
-n-propüül
BJF
-F
-H
BJG
-F
-tert-butüül
BJH
-F
-iso-butüül
BJI
-F
-sec-butüül
BJJ
-F
-tsükloheksüül
BJK
-F
-tert-butoksü
BJL
-F
-iso-propoksü
BJM
-F
-CF3
BJN
-F
-CH2CF3
BJO
-F
-OCF3
BJP
-F
-Cl
BJQ
-F
-Br
BJR
-F
-I
BJS
-F
-n-butüül
BJT
-F
-n-propüül
BJU
-CH3
-H
BJV
-CH3
-tert-butüül
BJW
-CH3
-iso-butüül
BJX
-CH3
-sec-butüül
BJY
-CH3
-tsükloheksüül
BJZ
-CH3
-tert-butoksü
BKA
-CH3
-iso-propoksü
BKB
-CH3
-CF3
BKC
-CH3
-CH2CF3
BKD
-CH3
-OCF3
BKE
-CH3
-Cl
BKF
-CH3
-Br
BKG
-CH3
-I
BKH
-CH3
-n-butüül
BKI
-CH3
-n-propüül
BKJ
-CF3
-H
EE-EP 1 648 878 B1
105
BKK
-CF3
-tert-butüül
BKL
-CF3
-iso-butüül
BKM
-CF3
-sec-butüül
BKN
-CF3
-tsükloheksüül
BKO
-CF3
-tert-butoksü
BKP
-CF3
-iso-propoksü
BKQ
-CF3
-CF3
BKR
-CF3
-CH2CF3
BKS
-CF3
-OCF3
BKT
-CF3
-Cl
BKU
-CF3
-Br
BKV
-CF3
-I
BKW
-CF3
-n-butüül
BKX
-CF3
-n-propüül
BKY
-CHF2
-tert-butüül
BKZ
-CHF2
-H
BLA
-CHF2
-iso-butüül
BLB
-CHF2
-sec-butüül
BLC
-CHF2
-tsükloheksüül
BLD
-CHF2
-tert-butoksü
BLE
-CHF2
-iso-propoksü
BLF
-CHF2
-CF3
BLG
-CHF2
-CH2CF3
BLH
-CHF2
-OCF3
BLI
-CHF2
-Cl
BLJ
-CHF2
-Br
BLK
-CHF2
-I
BLL
-CHF2
-n-butüül
BLM
-CHF2
-n-propüül
BLN
-OH
-H
BLO
-OH
-tert-butüül
BLP
-OH
-iso-butüül
EE-EP 1 648 878 B1
106
BLQ
-OH
-sec-butüül
BLR
-OH
-tsükloheksüül
BLS
-OH
-tert-butoksü
BLT
-OH
-iso-propoksü
BLU
-OH
-CF3
BLV
-OH
-CH2CF3
BLW
-OH
-OCF3
BLX
-OH
-Cl
BLY
-OH
-Br
BLZ
-OH
-I
BMA
-OH
-n-butüül
BMB
-OH
-n-propüül
BMC
-NO2
-H
BMD
-NO2
-tert-butüül
BME
-NO2
-iso-butüül
BMF
-NO2
-sec-butüül
BMG
-NO2
-tsükloheksüül
BMH
-NO2
-tert-butoksü
BMI
-NO2
-iso-propoksü
BMJ
-NO2
-CF3
BMK
-NO2
-CH2CF3
BML
-NO2
-OCF3
BMM
-NO2
-Cl
BMN
-NO2
-Br
BMO
-NO2
-I
BMP
-NO2
-n-butüül
BMQ
-NO2
-n-propüül
BMR
-CN
-H
BMS
-CN
-tert-butüül
BMT
-CN
-iso-butüül
BMU
-CN
-sec-butüül
BMV
-CN
-tsükloheksüül
EE-EP 1 648 878 B1
107
BMW
-CN
-tert-butoksü
BMX
-CN
-iso-propoksü
BMY
-CN
-CF3
BMZ
-CN
-CH2CF3
BNA
-CN
-OCF3
BNB
-CN
-Cl
BNC
-CN
-Br
BND
-CN
-I
BNE
-CN
-n-butüül
BNF
-CN
-n-propüül
BNG
-Br
-H
BNH
-Br
-tert-butüül
BNI
-Br
-iso-butüül
BNJ
-Br
-sec-butüül
BNK
-Br
-tsükloheksüül
BNL
-Br
-tert-butoksü
BNM
-Br
-iso-propoksü
BNN
-Br
-CF3
BNO
-Br
-CH2CF3
BNP
-Br
-OCF3
BNQ
-Br
-Cl
BNR
-Br
-Br
BNS
-Br
-I
BNT
-Br
-n-butüül
BNU
-Br
-n-propüül
BNV
-I
-tert-butüül
BNW
-I
-H
BNX
-I
-iso-butüül
BNY
-I
-sec-butüül
BNZ
-I
-tsükloheksüül
BOA
-I
-tert-butoksü
BOB
-I
-iso-propoksü
EE-EP 1 648 878 B1
108
BOC
-I
-CF3
BOD
-I
-CH2CF3
BOE
-I
-OCF3
BOF
-I
-Cl
BOG
-I
-Br
BOH
-I
-I
BOI
-I
-n-butüül
BOJ
-I
-n-propüül
Tabel 8
N
R1
OCH3
N
O
NH
R9
(Ih)
5
ja selle farmatseutiliselt vastuvõetavad soolad, milles:
Ühend
R1
R9
BOK
-Cl
-H
BOL
-Cl
-tert-butüül
BOM
-Cl
-iso-butüül
BON
-Cl
-sec-butüül
EE-EP 1 648 878 B1
109
BOO
-Cl
-tsükloheksüül
BOP
-Cl
-tert-butoksü
BOQ
-Cl
-iso-propoksü
BOR
-Cl
-CF3
BOS
-Cl
-CH2CF3
BOT
-Cl
-OCF3
BOU
-Cl
-Cl
BOV
-Cl
-Br
BOW
-Cl
-I
BOX
-Cl
-n-butüül
BOY
-Cl
-n-propüül
BOZ
-F
-H
BPA
-F
-tert-butüül
BPB
-F
-iso-butüül
BPC
-F
-sec-butüül
BPD
-F
-tsükloheksüül
BPE
-F
-tert-butoksü
BPF
-F
-iso-propoksü
BPG
-F
-CF3
BPH
-F
-CH2CF3
BPI
-F
-OCF3
BPJ
-F
-Cl
BPK
-F
-Br
BPL
-F
-I
BPM
-F
-n-butüül
BPN
-F
-n-propüül
BPO
-CH3
-H
BPP
-CH3
-tert-butüül
BPQ
-CH3
-iso-butüül
BPR
-CH3
-sec-butüül
BPS
-CH3
-tsükloheksüül
BPT
-CH3
-tert-butoksü
EE-EP 1 648 878 B1
110
BPU
-CH3
-iso-propoksü
BPV
-CH3
-CF3
BPW
-CH3
-CH2CF3
BPX
-CH3
-OCF3
BPY
-CH3
-Cl
BPZ
-CH3
-Br
BQA
-CH3
-I
BQB
-CH3
-n-butüül
BQC
-CH3
-n-propüül
BQD
-CF3
-H
BQE
-CF3
-tert-butüül
BQF
-CF3
-iso-butüül
BQG
-CF3
-sec-butüül
BQH
-CF3
-tsükloheksüül
BQI
-CF3
-tert-butoksü
BQJ
-CF3
-iso-propoksü
BQK
-CF3
-CF3
BQL
-CF3
-CH2CF3
BQM
-CF3
-OCF3
BQN
-CF3
-Cl
BQO
-CF3
-Br
BQP
-CF3
-I
BQQ
-CF3
-n-butüül
BQR
-CF3
-n-propüül
BQS
-CHF2
-tert-butüül
BQT
-CHF2
-H
BQU
-CHF2
-iso-butüül
BQV
-CHF2
-sec-butüül
BQW
-CHF2
-tsükloheksüül
BQX
-CHF2
-tert-butoksü
BQY
-CHF2
-iso-propoksü
BQZ
-CHF2
-CF3
EE-EP 1 648 878 B1
111
BRA
-CHF2
-CH2CF3
BRB
-CHF2
-OCF3
BRC
-CHF2
-Cl
BRD
-CHF2
-Br
BRE
-CHF2
-I
BRF
-CHF2
-n-butüül
BRG
-CHF2
-n-propüül
BRH
-OH
-H
BRI
-OH
-tert-butüül
BRJ
-OH
-iso-butüül
BRK
-OH
-sec-butüül
BRL
-OH
-tsükloheksüül
BRM
-OH
-tert-butoksü
BRN
-OH
-iso-propoksü
BRO
-OH
-CF3
BRP
-OH
-CH2CF3
BRQ
-OH
-OCF3
BRR
-OH
-Cl
BRS
-OH
-Br
BRT
-OH
-I
BRU
-OH
-n-butüül
BRV
-OH
-n-propüül
BRW
-NO2
-H
BRX
-NO2
-tert-butüül
BRY
-NO2
-iso-butüül
BRZ
-NO2
-sec-butüül
BSA
-NO2
-tsükloheksüül
BSB
-NO2
-tert-butoksü
BSC
-NO2
-iso-propoksü
BSD
-NO2
-CF3
BSE
-NO2
-CH2CF3
BSF
-NO2
-OCF3
EE-EP 1 648 878 B1
112
BSG
-NO2
-Cl
BSH
-NO2
-Br
BSI
-NO2
-I
BSJ
-NO2
-n-butüül
BSK
-NO2
-n-propüül
BSL
-CN
-H
BSM
-CN
-tert-butüül
BSN
-CN
-iso-butüül
BSO
-CN
-sec-butüül
BSP
-CN
-tsükloheksüül
BSQ
-CN
-tert-butoksü
BSR
-CN
-iso-propoksü
BSS
-CN
-CF3
BST
-CN
-CH2CF3
BSU
-CN
-OCF3
BSV
-CN
-Cl
BSW
-CN
-Br
BSX
-CN
-I
BSY
-CN
-n-butüül
BSZ
-CN
-n-propüül
BTA
-Br
-H
BTB
-Br
-tert-butüül
BTC
-Br
-iso-butüül
BTD
-Br
-sec-butüül
BTE
-Br
-tsükloheksüül
BTF
-Br
-tert-butoksü
BTG
-Br
-iso-propoksü
BTH
-Br
-CF3
BTI
-Br
-CH2CF3
BTJ
-Br
-OCF3
BTK
-Br
-Cl
BTL
-Br
-Br
EE-EP 1 648 878 B1
113
BTM
-Br
-I
BTN
-Br
-n-butüül
BTO
-Br
-n-propüül
BTP
-I
-tert-butüül
BTQ
-I
-H
BTR
-I
-iso-butüül
BTS
-I
-sec-butüül
BTT
-I
-tsükloheksüül
BTU
-I
-tert-butoksü
BTV
-I
-iso-propoksü
BTW
-I
-CF3
BTX
-I
-CH2CF3
BTY
-I
-OCF3
BTZ
-I
-Cl
BUA
-I
-Br
BUB
-I
-I
BUC
-I
-n-butüül
BUD
-I
-n-propüül
Tabel 9
N
R1
OCF3
N
O
NH
R9
(III)
5
ja selle farmatseutiliselt vastuvõetavad soolad, milles:
EE-EP 1 648 878 B1
114
Ühend
R1
R9
BUE
-Cl
-H
BUF
-Cl
-tert-butüül
BUG
-Cl
-iso-butüül
BUH
-Cl
-sec-butüül
BUI
-Cl
-tsükloheksüül
BUJ
-Cl
-tert-butoksü
BUK
-Cl
-iso-propoksü
BUL
-Cl
-CF3
BUM
-Cl
-CH2CF3
BUN
-Cl
-OCF3
BUO
-Cl
-Cl
BUP
-Cl
-Br
BUQ
-Cl
-I
BUR
-Cl
-n-butüül
BUS
-Cl
-n-propüül
BUT
-F
-H
BUU
-F
-tert-butüül
BUV
-F
-iso-butüül
BUW
-F
-sec-butüül
BUX
-F
-tsükloheksüül
BUY
-F
-tert-butoksü
BUZ
-F
-iso-propoksü
BVA
-F
-CF3
BVB
-F
-CH2CF3
BVC
-F
-OCF3
BVD
-F
-Cl
BVE
-F
-Br
BVF
-F
-I
BVG
-F
-n-butüül
BVH
-F
-n-propüül
BVI
-CH3
-H
EE-EP 1 648 878 B1
115
BVJ
-CH3
-tert-butüül
BVK
-CH3
-iso-butüül
BVL
-CH3
-sec-butüül
BVM
-CH3
-tsükloheksüül
BVN
-CH3
-tert-butoksü
BVO
-CH3
-iso-propoksü
BVP
-CH3
-CF3
BVQ
-CH3
-CH2CF3
BVR
-CH3
-OCF3
BVS
-CH3
-Cl
BVT
-CH3
-Br
BVU
-CH3
-I
BVV
-CH3
-n-butüül
BVW
-CH3
-n-propüül
BVX
-CF3
-H
BVY
-CF3
-tert-butüül
BVZ
-CF3
-iso-butüül
BWA
-CF3
-sec-butüül
BWB
-CF3
-tsükloheksüül
BWC
-CF3
-tert-butoksü
BWD
-CF3
-iso-propoksü
BWE
-CF3
-CF3
BWF
-CF3
-CH2CF3
BWG
-CF3
-OCF3
BWH
-CF3
-Cl
BWI
-CF3
-Br
BWJ
-CF3
-I
BWK
-CF3
-n-butüül
BWL
-CF3
-n-propüül
BWM
-CHF2
-tert-butüül
BWN
-CHF2
-H
BWO
-CHF2
-iso-butüül
EE-EP 1 648 878 B1
116
BWP
-CHF2
-sec-butüül
BWQ
-CHF2
-tsükloheksüül
BWR
-CHF2
-tert-butoksü
BWS
-CHF2
-iso-propoksü
BWT
-CHF2
-CF3
BWU
-CHF2
-CH2CF3
BWV
-CHF2
-OCF3
BWW
-CHF2
-Cl
BWX
-CHF2
-Br
BWY
-CHF2
-I
BWZ
-CHF2
-n-butüül
BXA
-CHF2
-n-propüül
BXB
-OH
-H
BXC
-OH
-tert-butüül
BXD
-OH
-iso-butüül
BXE
-OH
-sec-butüül
BXF
-OH
-tsükloheksüül
BXG
-OH
-tert-butoksü
BXH
-OH
-iso-propoksü
BXI
-OH
-CF3
BXJ
-OH
-CH2CF3
BXK
-OH
-OCF3
BXL
-OH
-Cl
BXM
-OH
-Br
BXN
-OH
-I
BXO
-OH
-n-butüül
BXP
-OH
-n-propüül
BXQ
-NO2
-H
BXR
-NO2
-tert-butüül
BXS
-NO2
-iso-butüül
BXT
-NO2
-sec-butüül
BXU
-NO2
-tsükloheksüül
EE-EP 1 648 878 B1
117
BXV
-NO2
-tert-butoksü
BXW
-NO2
-iso-propoksü
BXX
-NO2
-CF3
BXY
-NO2
-CH2CF3
BXZ
-NO2
-OCF3
BYA
-NO2
-Cl
BYB
-NO2
-Br
BYC
-NO2
-I
BYD
-NO2
-n-butüül
BYE
-NO2
-n-propüül
BYF
-CN
-H
BYG
-CN
-tert-butüül
BYH
-CN
-iso-butüül
BYI
-CN
-sec-butüül
BYJ
-CN
-tsükloheksüül
BYK
-CN
-tert-butoksü
BYL
-CN
-iso-propoksü
BYM
-CN
-CF3
BYN
-CN
-CH2CF3
BYO
-CN
-OCF3
BYP
-CN
-Cl
BYQ
-CN
-Br
BYR
-CN
-I
BYS
-CN
-n-butüül
BYT
-CN
-n-propüül
BYU
-Br
-H
BYV
-Br
-tert-butüül
BYW
-Br
-iso-butüül
BYX
-Br
-sec-butüül
BYY
-Br
-tsükloheksüül
BYZ
-Br
-tert-butoksü
BZA
-Br
-iso-propoksü
EE-EP 1 648 878 B1
118
BZB
-Br
-CF3
BZC
-Br
-CH2CF3
BZD
-Br
-OCF3
BZE
-Br
-Cl
BZF
-Br
-Br
BZG
-Br
-I
BZH
-Br
-n-butüül
BZI
-Br
-n-propüül
BZJ
-I
-tert-butüül
BZK
-I
-H
BZL
-I
-iso-butüül
BZM
-I
-sec-butüül
BZN
-I
-tsükloheksüül
BZO
-I
-tert-butoksü
BZP
-I
-iso-propoksü
BZQ
-I
-CF3
BZR
-I
-CH2CF3
BZS
-I
-OCF3
BZT
-I
-Cl
BZU
-I
-Br
BZV
-I
-I
BZW
-I
-n-butüül
BZX
-I
-n-propüül
EE-EP 1 648 878 B1
119
Tabel 10
N
R1
Cl
N
O
NH
N
R8
S
R9
(Ia)
ja selle farmatseutiliselt vastuvõetavad soolad, milles:
Ühend
R1
R8
R9
BZY
-Cl
-Cl
-H
BZZ
-Cl
-Br
-H
CAA
-Cl
-F
-H
CAB
-Cl
-CH3
-H
CAC
-Cl
-CF3
-H
CAD
-Cl
-OCH3
-H
CAE
-Cl
-OCH2CH3
-H
CAF
-Cl
-OCF3
-H
CAG
-Cl
-tert-butüül
-H
CAH
-Cl
-iso-propüül
-H
CAI
-Cl
-CH3
-CH3
CAJ
-Cl
-H
-H
CAK
-Cl
-H
-CH3
EE-EP 1 648 878 B1
120
CAL
-Cl
-H
-CF3
CAM
-Cl
-H
-OCH3
CAN
-Cl
-H
-OCH2CH3
CAO
-Cl
-H
-OCF3
CAP
-Cl
-H
-tert-butüül
CAQ
-Cl
-H
-iso-propüül
CAR
-Cl
-H
-OCF3
CAS
-Cl
-H
-tert-butüül
CAT
-Cl
-H
-iso-propüül
CAU
-CH3
-Cl
-H
CAV
-CH3
-Br
-H
CAW
-CH3
-F
-H
CAX
-CH3
-CH3
-H
CAY
-CH3
-CF3
-H
CAZ
-CH3
-OCH3
-H
CBA
-CH3
-OCH2CH3
-H
CBB
-CH3
-OCF3
-H
CBC
-CH3
-tert-butüül
-H
CBD
-CH3
-iso-propüül
-H
CBE
-CH3
-CH3
-CH3
CBF
-CH3
-H
-H
CBG
-CH3
-H
-Cl
CBH
-CH3
-H
-Br
CBI
-CH3
-H
-F
CBJ
-CH3
-H
-CH3
CBK
-CH3
-H
-CF3
CBL
-CH3
-H
-OCH3
CBM
-CH3
-H
-OCH2CH3
CBN
-CH3
-H
-OCF3
CBO
-CH3
-H
-tert-butüül
CBP
-CH3
-H
-iso-propüül
CBQ
-CF3
-Cl
-H
EE-EP 1 648 878 B1
121
CBR
-CF3
-Br
-H
CBS
-CF3
-F
-H
CBT
-CF3
-CH3
-H
CBU
-CF3
-CF3
-H
CBV
-CF3
-OCH3
-H
CBW
-CF3
-OCH2CH3
-H
CBX
-CF3
-OCF3
-H
CBY
-CF3
-tert-butüül
-H
CBZ
-CF3
-iso-propüül
-H
CCA
-CF3
-CH3
-CH3
CCB
-CF3
-H
-H
CCC
-CF3
-H
-Cl
CCD
-CF3
-H
-Br
CCE
-CF3
-H
-F
CCF
-CF3
-H
-CH3
CCG
-CF3
-H
-CF3
CCH
-CF3
-H
-OCH3
CCI
-CF3
-H
-OCH2CH3
CCJ
-CF3
-H
-OCF3
CCK
-CF3
-H
-tert-butüül
CCL
-CF3
-H
-iso-propüül
CCM
-CHF2
-Cl
-H
CCN
-CHF2
-Br
-H
CCO
-CHF2
-F
-H
CCP
-CHF2
-CH3
-H
CCQ
-CHF2
-CF3
-H
CCR
-CHF2
-OCH3
-H
CCS
-CHF2
-OCH2CH3
-H
CCT
-CHF2
-OCF3
-H
CCU
-CHF2
-tert-butüül
-H
CCV
-CHF2
-iso-propüül
-H
CCW
-CHF2
-CH3
-CH3
EE-EP 1 648 878 B1
122
CCX
-CHF2
-H
-H
CCY
-CHF2
-H
-Cl
CCZ
-CHF2
-H
-Br
CDA
-CHF2
-H
-F
CDB
-CHF2
-H
-CH3
CDC
-CHF2
-H
-CF3
CDD
-CHF2
-H
-OCH3
CDE
-CHF2
-H
-OCH2CH3
CDF
-CHF2
-H
-OCF3
CDG
-CHF2
-H
-tert-butüül
CDH
-CHF2
-H
-iso-propüül
CDI
-OH
-Cl
-H
CDJ
-OH
-Br
-H
CDK
-OH
-F
-H
CDL
-OH
-CH3
-H
CDM
-OH
-CF3
-H
CDN
-OH
-OCH3
-H
CDO
-OH
-OCH2CH3
-H
CDP
-OH
-OCF3
-H
CDQ
-OH
-tert-butüül
-H
CDR
-OH
-iso-propüül
-H
CDS
-OH
-CH3
-CH3
CDT
-OH
-H
-H
CDU
-OH
-H
-Cl
CDV
-OH
-H
-Br
CDW
-OH
-H
-F
CDX
-OH
-H
-CH3
CDY
-OH
-H
-CF3
CDZ
-OH
-H
-OCH3
CEA
-OH
-H
-OCH2CH3
CEB
-OH
-H
-OCF3
CEC
-OH
-H
-tert-butüül
EE-EP 1 648 878 B1
123
CED
-OH
-H
-iso-propüül
CEE
-NO2
-Cl
-H
CEF
-NO2
-Br
-H
CEG
-NO2
-F
-H
CEH
-NO2
-CH3
-H
CEI
-NO2
-CF3
-H
CEJ
-NO2
-OCH3
-H
CEK
-NO2
-OCH2CH3
-H
CEL
-NO2
-OCF3
-H
CEM
-NO2
-tert-butüül
-H
CEN
-NO2
-iso-propüül
-H
CEO
-NO2
-CH3
-CH3
CEP
-NO2
-H
-H
CEQ
-NO2
-H
-Cl
CER
-NO2
-H
-Br
CES
-NO2
-H
-F
CET
-NO2
-H
-CH3
CEU
-NO2
-H
-CF3
CEV
-NO2
-H
-OCH3
CEW
-NO2
-H
-OCH2CH3
CEX
-NO2
-H
-OCF3
CEY
-NO2
-H
-tert-butüül
CEZ
-NO2
-H
-iso-propüül
CFA
-CN
-Br
-H
CFB
-CN
-Cl
-H
CFC
-CN
-F
-H
CFD
-CN
-CH3
-H
CFE
-CN
-CF3
-H
CFF
-CN
-OCH3
-H
CFG
-CN
-OCH2CH3
-H
CFH
-CN
-OCF3
-H
CFI
-CN
-tert-butüül
-H
EE-EP 1 648 878 B1
124
CFJ
-CN
-iso-propüül
-H
CFK
-CN
-CH3
-CH3
CFL
-CN
-H
-H
CFM
-CN
-H
-Cl
CFN
-CN
-H
-Br
CFO
-CN
-H
-F
CFP
-CN
-H
-CH3
CFQ
-CN
-H
-CF3
CFR
-CN
-H
-OCH3
CFS
-CN
-H
-OCH2CH3
CFT
-CN
-H
-OCF3
CFU
-CN
-H
-tert-butüül
CFV
-CN
-H
-iso-propüül
CFW
-Br
-Br
-H
CFX
-Br
-Cl
-H
CFY
-Br
-F
-H
CFZ
-Br
-CH3
-H
CGA
-Br
-CF3
-H
CGB
-Br
-OCH3
-H
CGC
-Br
-OCH2CH3
-H
CGD
-Br
-OCF3
-H
CGE
-Br
-tert-butüül
-H
CGF
-Br
-iso-propüül
-H
CGG
-Br
-CH3
-CH3
CGH
-Br
-H
-H
CGI
-Br
-H
-Cl
CGJ
-Br
-H
-Br
CGK
-Br
-H
-F
CGL
-Br
-H
-CH3
CGM
-Br
-H
-CF3
CGN
-Br
-H
-OCH3
CGO
-Br
-H
-OCH2CH3
EE-EP 1 648 878 B1
125
CGP
-Br
-H
-OCF3
CGQ
-Br
-H
-tert-butüül
CGR
-Br
-H
-iso-propüül
CGS
-I
-Cl
-H
CGT
-I
-Br
-H
CGU
-I
-F
-H
CGV
-I
-CH3
-H
CGW
-I
-CF3
-H
CGX
-I
-OCH3
-H
CGY
-I
-OCH2CH3
-H
CGZ
-I
-OCF3
-H
CHA
-I
-tert-butüül
-H
CHB
-I
-iso-propüül
-H
CHC
-I
-CH3
-CH3
CHD
-I
-H
-H
CHE
-I
-H
-Cl
CHF
-I
-H
-Br
CHG
-I
-H
-F
CHH
-I
-H
-CH3
CHI
-I
-H
-CF3
CHJ
-I
-H
-OCH3
CHK
-I
-H
-OCH2CH3
CHL
-I
-H
-OCF3
CHM
-I
-H
-tert-butüül
CHN
-I
-H
-iso-propüül
EE-EP 1 648 878 B1
126
Tabel 11
N
R1
Br
N
O
NH
N
R8
S
R9
(Ib)
ja selle farmatseutiliselt vastuvõetavad soolad, milles:
Ühend
R1
R8
R9
CHO
-Cl
-Cl
-H
CHP
-Cl
-Br
-H
CHQ
-Cl
-F
-H
CHR
-Cl
-CH3
-H
CHS
-Cl
-CF3
-H
CHT
-Cl
-OCH3
-H
CHU
-Cl
-OCH2CH3
-H
CHV
-Cl
-OCF3
-H
CHW
-Cl
-tert-butüül
-H
CHX
-Cl
-iso-propüül
-H
CHY
-Cl
-CH3
-CH3
CHZ
-Cl
-H
-H
CIA
-Cl
-H
-CH3
EE-EP 1 648 878 B1
127
CIB
-Cl
-H
-CF3
CIC
-Cl
-H
-OCH3
CID
-Cl
-H
-OCH2CH3
CIE
-Cl
-H
-OCF3
CIF
-Cl
-H
-tert-butüül
CIG
-Cl
-H
-iso-propüül
CIH
-Cl
-H
-OCF3
CII
-Cl
-H
-tert-butüül
CIJ
-Cl
-H
-iso-propüül
CIK
-CH3
-Cl
-H
CIL
-CH3
-Br
-H
CIM
-CH3
-F
-H
CIN
-CH3
-CH3
-H
CIO
-CH3
-CF3
-H
CIP
-CH3
-OCH3
-H
CIQ
-CH3
-OCH2CH3
-H
CIR
-CH3
-OCF3
-H
CIS
-CH3
-tert-butüül
-H
CIT
-CH3
-iso-propüül
-H
CIU
-CH3
-CH3
-CH3
CIV
-CH3
-H
-H
CIW
-CH3
-H
-Cl
CIX
-CH3
-H
-Br
CIY
-CH3
-H
-F
CIZ
-CH3
-H
-CH3
CJA
-CH3
-H
-CF3
CJB
-CH3
-H
-OCH3
CJC
-CH3
-H
-OCH2CH3
CJD
-CH3
-H
-OCF3
CJE
-CH3
-H
-tert-butüül
CJF
-CH3
-H
-iso-propüül
CJG
-CF3
-Cl
-H
EE-EP 1 648 878 B1
128
CJH
-CF3
-Br
-H
CJI
-CF3
-F
-H
CJJ
-CF3
-CH3
-H
CJK
-CF3
-CF3
-H
CJL
-CF3
-OCH3
-H
CJM
-CF3
-OCH2CH3
-H
CJN
-CF3
-OCF3
-H
CJO
-CF3
-tert-butüül
-H
CJP
-CF3
-iso-propüül
-H
CJQ
-CF3
-CH3
-CH3
CJR
-CF3
-H
-H
CJS
-CF3
-H
-Cl
CJT
-CF3
-H
-Br
CJU
-CF3
-H
-F
CJV
-CF3
-H
-CH3
CJW
-CF3
-H
-CF3
CJX
-CF3
-H
-OCH3
CJY
-CF3
-H
-OCH2CH3
CJZ
-CF3
-H
-OCF3
CKA
-CF3
-H
-tert-butüül
CKB
-CF3
-H
-iso-propüül
CKC
-CHF2
-Cl
-H
CKD
-CHF2
-Br
-H
CKE
-CHF2
-F
-H
CKF
-CHF2
-CH3
-H
CKG
-CHF2
-CF3
-H
CKH
-CHF2
-OCH3
-H
CKI
-CHF2
-OCH2CH3
-H
CKJ
-CHF2
-OCF3
-H
CKK
-CHF2
-tert-butüül
-H
CKL
-CHF2
-iso-propüül
-H
CKM
-CHF2
-CH3
-CH3
EE-EP 1 648 878 B1
129
CKN
-CHF2
-H
-H
CKO
-CHF2
-H
-Cl
CKP
-CHF2
-H
-Br
CKQ
-CHF2
-H
-F
CKR
-CHF2
-H
-CH3
CKS
-CHF2
-H
-CF3
CKT
-CHF2
-H
-OCH3
CKU
-CHF2
-H
-OCH2CH3
CKV
-CHF2
-H
-OCF3
CKW
-CHF2
-H
-tert-butüül
CKX
-CHF2
-H
-iso-propüül
CKY
-OH
-Cl
-H
CKZ
-OH
-Br
-H
CLA
-OH
-F
-H
CLB
-OH
-CH3
-H
CLC
-OH
-CF3
-H
CLD
-OH
-OCH3
-H
CLE
-OH
-OCH2CH3
-H
CLF
-OH
-OCF3
-H
CLG
-OH
-tert-butüül
-H
CLH
-OH
-iso-propüül
-H
CLI
-OH
-CH3
-CH3
CLJ
-OH
-H
-H
CLK
-OH
-H
-Cl
CLL
-OH
-H
-Br
CLM
-OH
-H
-F
CLN
-OH
-H
-CH3
CLO
-OH
-H
-CF3
CLP
-OH
-H
-OCH3
CLQ
-OH
-H
-OCH2CH3
CLR
-OH
-H
-OCF3
CLS
-OH
-H
-tert-butüül
EE-EP 1 648 878 B1
130
CLT
-OH
-H
-iso-propüül
CLU
-NO2
-Cl
-H
CLV
-NO2
-Br
-H
CLW
-NO2
-F
-H
CLX
-NO2
-CH3
-H
CLY
-NO2
-CF3
-H
CLZ
-NO2
-OCH3
-H
CMA
-NO2
-OCH2CH3
-H
CMB
-NO2
-OCF3
-H
CMC
-NO2
-tert-butüül
-H
CMD
-NO2
-iso-propüül
-H
CME
-NO2
-CH3
-CH3
CMF
-NO2
-H
-H
CMG
-NO2
-H
-Cl
CMH
-NO2
-H
-Br
CMI
-NO2
-H
-F
CMJ
-NO2
-H
-CH3
CMK
-NO2
-H
-CF3
CML
-NO2
-H
-OCH3
CMM
-NO2
-H
-OCH2CH3
CMN
-NO2
-H
-OCF3
CMO
-NO2
-H
-tert-butüül
CMP
-NO2
-H
-iso-propüül
CMQ
-CN
-Br
-H
CMR
-CN
-Cl
-H
CMS
-CN
-F
-H
CMT
-CN
-CH3
-H
CMU
-CN
-CF3
-H
CMV
-CN
-OCH3
-H
CMW
-CN
-OCH2CH3
-H
CMX
-CN
-OCF3
-H
CMY
-CN
-tert-butüül
-H
EE-EP 1 648 878 B1
131
CMZ
-CN
-iso-propüül
-H
CNA
-CN
-CH3
-CH3
CNB
-CN
-H
-H
CNC
-CN
-H
-Cl
CND
-CN
-H
-Br
CNE
-CN
-H
-F
CNF
-CN
-H
-CH3
CNG
-CN
-H
-CF3
CNH
-CN
-H
-OCH3
CNI
-CN
-H
-OCH2CH3
CNJ
-CN
-H
-OCF3
CNK
-CN
-H
-tert-butüül
CNL
-CN
-H
-iso-propüül
CNM
-Br
-Br
-H
CNN
-Br
-Cl
-H
CNO
-Br
-F
-H
CNP
-Br
-CH3
-H
CNQ
-Br
-CF3
-H
CNR
-Br
-OCH3
-H
CNS
-Br
-OCH2CH3
-H
CNT
-Br
-OCF3
-H
CNU
-Br
-tert-butüül
-H
CNV
-Br
-iso-propüül
-H
CNW
-Br
-CH3
-CH3
CNX
-Br
-H
-H
CNY
-Br
-H
-Cl
CNZ
-Br
-H
-Br
COA
-Br
-H
-F
COB
-Br
-H
-CH3
COC
-Br
-H
-CF3
COD
-Br
-H
-OCH3
COE
-Br
-H
-OCH2CH3
EE-EP 1 648 878 B1
132
COF
-Br
-H
-OCF3
COG
-Br
-H
-tert-butüül
COH
-Br
-H
-iso-propüül
COI
-I
-Cl
-H
COJ
-I
-Br
-H
COK
-I
-F
-H
COL
-I
-CH3
-H
COM
-I
-CF3
-H
CON
-I
-OCH3
-H
COO
-I
-OCH2CH3
-H
COP
-I
-OCF3
-H
COQ
-I
-tert-butüül
-H
COR
-I
-iso-propüül
-H
COS
-I
-CH3
-CH3
COT
-I
-H
-H
COU
-I
-H
-Cl
COV
-I
-H
-Br
COW
-I
-H
-F
COX
-I
-H
-CH3
COY
-I
-H
-CF3
COZ
-I
-H
-OCH3
CPA
-I
-H
-OCH2CH3
CPB
-I
-H
-OCF3
CPC
-I
-H
-tert-butüül
CPD
-I
-H
-iso-propüül
EE-EP 1 648 878 B1
133
Tabel 12
N
R1
I
N
O
NH
N
R8
S
R9
(Ic)
ja selle farmatseutiliselt vastuvõetavad soolad, milles:
Ühend
R1
R8
R9
CPE
-Cl
-Cl
-H
CPF
-Cl
-Br
-H
CPG
-Cl
-F
-H
CPH
-Cl
-CH3
-H
CPI
-Cl
-CF3
-H
CPJ
-Cl
-OCH3
-H
CPK
-Cl
-OCH2CH3
-H
CPL
-Cl
-OCF3
-H
CPM
-Cl
-tert-butüül
-H
CPN
-Cl
-iso-propüül
-H
CPO
-Cl
-CH3
-CH3
CPP
-Cl
-H
-H
CPQ
-Cl
-H
-CH3
EE-EP 1 648 878 B1
134
CPR
-Cl
-H
-CF3
CPS
-Cl
-H
-OCH3
CPT
-Cl
-H
-OCH2CH3
CPU
-Cl
-H
-OCF3
CPV
-Cl
-H
-tert-butüül
CPW
-Cl
-H
-iso-propüül
CPX
-Cl
-H
-OCF3
CPY
-Cl
-H
-tert-butüül
CPZ
-Cl
-H
-iso-propüül
CQA
-CH3
-Cl
-H
CQB
-CH3
-Br
-H
CQC
-CH3
-F
-H
CQD
-CH3
-CH3
-H
CQE
-CH3
-CF3
-H
CQF
-CH3
-OCH3
-H
CQG
-CH3
-OCH2CH3
-H
CQH
-CH3
-OCF3
-H
CQI
-CH3
-tert-butüül
-H
CQJ
-CH3
-iso-propüül
-H
CQK
-CH3
-CH3
-CH3
CQL
-CH3
-H
-H
CQM
-CH3
-H
-Cl
CQN
-CH3
-H
-Br
CQO
-CH3
-H
-F
CQP
-CH3
-H
-CH3
CQQ
-CH3
-H
-CF3
CQR
-CH3
-H
-OCH3
CQS
-CH3
-H
-OCH2CH3
CQT
-CH3
-H
-OCF3
CQU
-CH3
-H
-tert-butüül
CQV
-CH3
-H
-iso-propüül
CQW
-CF3
-Cl
-H
EE-EP 1 648 878 B1
135
CQX
-CF3
-Br
-H
CQY
-CF3
-F
-H
CQZ
-CF3
-CH3
-H
CRA
-CF3
-CF3
-H
CRB
-CF3
-OCH3
-H
CRC
-CF3
-OCH2CH3
-H
CRD
-CF3
-OCF3
-H
CRE
-CF3
-tert-butüül
-H
CRF
-CF3
-iso-propüül
-H
CRG
-CF3
-CH3
-CH3
CRH
-CF3
-H
-H
CRI
-CF3
-H
-Cl
CRJ
-CF3
-H
-Br
CRK
-CF3
-H
-F
CRL
-CF3
-H
-CH3
CRM
-CF3
-H
-CF3
CRN
-CF3
-H
-OCH3
CRO
-CF3
-H
-OCH2CH3
CRP
-CF3
-H
-OCF3
CRQ
-CF3
-H
-tert-butüül
CRR
-CF3
-H
-iso-propüül
CRS
-CHF2
-Cl
-H
CRT
-CHF2
-Br
-H
CRU
-CHF2
-F
-H
CRV
-CHF2
-CH3
-H
CRW
-CHF2
-CF3
-H
CRX
-CHF2
-OCH3
-H
CRY
-CHF2
-OCH2CH3
-H
CRZ
-CHF2
-OCF3
-H
CSA
-CHF2
-tert-butüül
-H
CSB
-CHF2
-iso-propüül
-H
CSC
-CHF2
-CH3
-CH3
EE-EP 1 648 878 B1
136
CSD
-CHF2
-H
-H
CSE
-CHF2
-H
-Cl
CSF
-CHF2
-H
-Br
CSG
-CHF2
-H
-F
CSH
-CHF2
-H
-CH3
CSI
-CHF2
-H
-CF3
CSJ
-CHF2
-H
-OCH3
CSK
-CHF2
-H
-OCH2CH3
CSL
-CHF2
-H
-OCF3
CSM
-CHF2
-H
-tert-butüül
CSN
-CHF2
-H
-iso-propüül
CSO
-OH
-Cl
-H
CSP
-OH
-Br
-H
CSQ
-OH
-F
-H
CSR
-OH
-CH3
-H
CSS
-OH
-CF3
-H
CST
-OH
-OCH3
-H
CSU
-OH
-OCH2CH3
-H
CSV
-OH
-OCF3
-H
CSW
-OH
-tert-butüül
-H
CSX
-OH
-iso-propüül
-H
CSY
-OH
-CH3
-CH3
CSZ
-OH
-H
-H
CTA
-OH
-H
-Cl
CTB
-OH
-H
-Br
CTC
-OH
-H
-F
CTD
-OH
-H
-CH3
CTE
-OH
-H
-CF3
CTF
-OH
-H
-OCH3
CTG
-OH
-H
-OCH2CH3
CTH
-OH
-H
-OCF3
CTI
-OH
-H
-tert-butüül
EE-EP 1 648 878 B1
137
CTJ
-OH
-H
-iso-propüül
CTK
-NO2
-Cl
-H
CTL
-NO2
-Br
-H
CTM
-NO2
-F
-H
CTN
-NO2
-CH3
-H
CTO
-NO2
-CF3
-H
CTP
-NO2
-OCH3
-H
CTQ
-NO2
-OCH2CH3
-H
CTR
-NO2
-OCF3
-H
CTS
-NO2
-tert-butüül
-H
CTT
-NO2
-iso-propüül
-H
CTU
-NO2
-CH3
-CH3
CTV
-NO2
-H
-H
CTW
-NO2
-H
-Cl
CTX
-NO2
-H
-Br
CTY
-NO2
-H
-F
CTZ
-NO2
-H
-CH3
CUA
-NO2
-H
-CF3
CUB
-NO2
-H
-OCH3
CUC
-NO2
-H
-OCH2CH3
CUD
-NO2
-H
-OCF3
CUE
-NO2
-H
-tert-butüül
CUF
-NO2
-H
-iso-propüül
CUG
-CN
-Br
-H
CUH
-CN
-Cl
-H
CUI
-CN
-F
-H
CUJ
-CN
-CH3
-H
CUK
-CN
-CF3
-H
CUL
-CN
-OCH3
-H
CUM
-CN
-OCH2CH3
-H
CUN
-CN
-OCF3
-H
CUO
-CN
-tert-butüül
-H
EE-EP 1 648 878 B1
138
CUP
-CN
-iso-propüül
-H
CUQ
-CN
-CH3
-CH3
CUR
-CN
-H
-H
CUS
-CN
-H
-Cl
CUT
-CN
-H
-Br
CUU
-CN
-H
-F
CUV
-CN
-H
-CH3
CUW
-CN
-H
-CF3
CUX
-CN
-H
-OCH3
CUY
-CN
-H
-OCH2CH3
CUZ
-CN
-H
-OCF3
CVA
-CN
-H
-tert-butüül
CVB
-CN
-H
-iso-propüül
CVC
-Br
-Br
-H
CVD
-Br
-Cl
-H
CVE
-Br
-F
-H
CVF
-Br
-CH3
-H
CVG
-Br
-CF3
-H
CVH
-Br
-OCH3
-H
CVI
-Br
-OCH2CH3
-H
CVJ
-Br
-OCF3
-H
CVK
-Br
-tert-butüül
-H
CVL
-Br
-iso-propüül
-H
CVM
-Br
-CH3
-CH3
CVN
-Br
-H
-H
CVO
-Br
-H
-Cl
CVP
-Br
-H
-Br
CVQ
-Br
-H
-F
CVR
-Br
-H
-CH3
CVS
-Br
-H
-CF3
CVT
-Br
-H
-OCH3
CVU
-Br
-H
-OCH2CH3
EE-EP 1 648 878 B1
139
CVV
-Br
-H
-OCF3
CVW
-Br
-H
-tert-butüül
CVX
-Br
-H
-iso-propüül
CVY
-I
-Cl
-H
CVZ
-I
-Br
-H
CWA
-I
-F
-H
CWB
-I
-CH3
-H
CWC
-I
-CF3
-H
CWD
-I
-OCH3
-H
CWE
-I
-OCH2CH3
-H
CWF
-I
-OCF3
-H
CWG
-I
-tert-butüül
-H
CWH
-I
-iso-propüül
-H
CWI
-I
-CH3
-CH3
CWJ
-I
-H
-H
CWK
-I
-H
-Cl
CWL
-I
-H
-Br
CWM
-I
-H
-F
CWN
-I
-H
-CH3
CWO
-I
-H
-CF3
CWP
-I
-H
-OCH3
CWQ
-I
-H
-OCH2CH3
CWR
-I
-H
-OCF3
CWS
-I
-H
-tert-butüül
CWT
-I
-H
-iso-propüül
EE-EP 1 648 878 B1
140
Tabel 13
N
R1
F
N
O
NH
N
R8
S
R9
(Id)
ja selle farmatseutiliselt vastuvõetavad soolad, milles:
Ühend
R1
R8
R9
CWU
-Cl
-Cl
-H
CWV
-Cl
-Br
-H
CWW
-Cl
-F
-H
CWX
-Cl
-CH3
-H
CWY
-Cl
-CF3
-H
CWZ
-Cl
-OCH3
-H
CXA
-Cl
-OCH2CH3
-H
CXB
-Cl
-OCF3
-H
CXC
-Cl
-tert-butüül
-H
CXD
-Cl
-iso-propüül
-H
CXE
-Cl
-CH3
-CH3
CXF
-Cl
-H
-H
CXG
-Cl
-H
-CH3
EE-EP 1 648 878 B1
141
CXH
-Cl
-H
-CF3
CXI
-Cl
-H
-OCH3
CXJ
-Cl
-H
-OCH2CH3
CXK
-Cl
-H
-OCF3
CXL
-Cl
-H
-tert-butüül
CXM
-Cl
-H
-iso-propüül
CXN
-Cl
-H
-OCF3
CXO
-Cl
-H
-tert-butüül
CXP
-Cl
-H
-iso-propüül
CXQ
-CH3
-Cl
-H
CXR
-CH3
-Br
-H
CXS
-CH3
-F
-H
CXT
-CH3
-CH3
-H
CXU
-CH3
-CF3
-H
CXV
-CH3
-OCH3
-H
CXW
-CH3
-OCH2CH3
-H
CXX
-CH3
-OCF3
-H
CXY
-CH3
-tert-butüül
-H
CXZ
-CH3
-iso-propüül
-H
CYA
-CH3
-CH3
-CH3
CYB
-CH3
-H
-H
CYC
-CH3
-H
-Cl
CYD
-CH3
-H
-Br
CYE
-CH3
-H
-F
CYF
-CH3
-H
-CH3
CYG
-CH3
-H
-CF3
CYH
-CH3
-H
-OCH3
CYI
-CH3
-H
-OCH2CH3
CYJ
-CH3
-H
-OCF3
CYK
-CH3
-H
-tert-butüül
CYL
-CH3
-H
-iso-propüül
CYM
-CF3
-Cl
-H
EE-EP 1 648 878 B1
142
CYN
-CF3
-Br
-H
CYO
-CF3
-F
-H
CYP
-CF3
-CH3
-H
CYQ
-CF3
-CF3
-H
CYR
-CF3
-OCH3
-H
CYS
-CF3
-OCH2CH3
-H
CYT
-CF3
-OCF3
-H
CYU
-CF3
-tert-butüül
-H
CYV
-CF3
-iso-propüül
-H
CYW
-CF3
-CH3
-CH3
CYX
-CF3
-H
-H
CYY
-CF3
-H
-Cl
CYZ
-CF3
-H
-Br
CZA
-CF3
-H
-F
CZB
-CF3
-H
-CH3
CZC
-CF3
-H
-CF3
CZD
-CF3
-H
-OCH3
CZE
-CF3
-H
-OCH2CH3
CZF
-CF3
-H
-OCF3
CZG
-CF3
-H
-tert-butüül
CZH
-CF3
-H
-iso-propüül
CZI
-CHF2
-Cl
-H
CZJ
-CHF2
-Br
-H
CZK
-CHF2
-F
-H
CZL
-CHF2
-CH3
-H
CZM
-CHF2
-CF3
-H
CZN
-CHF2
-OCH3
-H
CZO
-CHF2
-OCH2CH3
-H
CZP
-CHF2
-OCF3
-H
CZQ
-CHF2
-tert-butüül
-H
CZR
-CHF2
-iso-propüül
-H
CZS
-CHF2
-CH3
-CH3
EE-EP 1 648 878 B1
143
CZT
-CHF2
-H
-H
CZU
-CHF2
-H
-Cl
CZV
-CHF2
-H
-Br
CZW
-CHF2
-H
-F
CZX
-CHF2
-H
-CH3
CZY
-CHF2
-H
-CF3
CZZ
-CHF2
-H
-OCH3
DAA
-CHF2
-H
-OCH2CH3
DAB
-CHF2
-H
-OCF3
DAC
-CHF2
-H
-tert-butüül
DAD
-CHF2
-H
-iso-propüül
DAE
-OH
-Cl
-H
DAF
-OH
-Br
-H
DAG
-OH
-F
-H
DAH
-OH
-CH3
-H
DAI
-OH
-CF3
-H
DAJ
-OH
-OCH3
-H
DAK
-OH
-OCH2CH3
-H
DAL
-OH
-OCF3
-H
DAM
-OH
-tert-butüül
-H
DAN
-OH
-iso-propüül
-H
DAO
-OH
-CH3
-CH3
DAP
-OH
-H
-H
DAQ
-OH
-H
-Cl
DAR
-OH
-H
-Br
DAS
-OH
-H
-F
DAT
-OH
-H
-CH3
DAU
-OH
-H
-CF3
DAV
-OH
-H
-OCH3
DAW
-OH
-H
-OCH2CH3
DAX
-OH
-H
-OCF3
DAY
-OH
-H
-tert-butüül
EE-EP 1 648 878 B1
144
DAZ
-OH
-H
-iso-propüül
DBA
-NO2
-Cl
-H
DBB
-NO2
-Br
-H
DBC
-NO2
-F
-H
DBD
-NO2
-CH3
-H
DBE
-NO2
-CF3
-H
DBF
-NO2
-OCH3
-H
DBG
-NO2
-OCH2CH3
-H
DBH
-NO2
-OCF3
-H
DBI
-NO2
-tert-butüül
-H
DBJ
-NO2
-iso-propüül
-H
DBK
-NO2
-CH3
-CH3
DBL
-NO2
-H
-H
DBM
-NO2
-H
-Cl
DBN
-NO2
-H
-Br
DBO
-NO2
-H
-F
DBP
-NO2
-H
-CH3
DBQ
-NO2
-H
-CF3
DBR
-NO2
-H
-OCH3
DBS
-NO2
-H
-OCH2CH3
DBT
-NO2
-H
-OCF3
DBU
-NO2
-H
-tert-butüül
DBV
-NO2
-H
-iso-propüül
DBW
-CN
-Br
-H
DBX
-CN
-Cl
-H
DBY
-CN
-F
-H
DBZ
-CN
-CH3
-H
DCA
-CN
-CF3
-H
DCB
-CN
-OCH3
-H
DCC
-CN
-OCH2CH3
-H
DCD
-CN
-OCF3
-H
DCE
-CN
-tert-butüül
-H
EE-EP 1 648 878 B1
145
DCF
-CN
-iso-propüül
-H
DCG
-CN
-CH3
-CH3
DCH
-CN
-H
-H
DCI
-CN
-H
-Cl
DCJ
-CN
-H
-Br
DCK
-CN
-H
-F
DCL
-CN
-H
-CH3
DCM
-CN
-H
-CF3
DCN
-CN
-H
-OCH3
DCO
-CN
-H
-OCH2CH3
DCP
-CN
-H
-OCF3
DCQ
-CN
-H
-tert-butüül
DCR
-CN
-H
-iso-propüül
DCS
-Br
-Br
-H
DCT
-Br
-Cl
-H
DCU
-Br
-F
-H
DCV
-Br
-CH3
-H
DCW
-Br
-CF3
-H
DCX
-Br
-OCH3
-H
DCY
-Br
-OCH2CH3
-H
DCZ
-Br
-OCF3
-H
DDA
-Br
-tert-butüül
-H
DDB
-Br
-iso-propüül
-H
DDC
-Br
-CH3
-CH3
DDD
-Br
-H
-H
DDE
-Br
-H
-Cl
DDF
-Br
-H
-Br
DDG
-Br
-H
-F
DDH
-Br
-H
-CH3
DDI
-Br
-H
-CF3
DDJ
-Br
-H
-OCH3
DDK
-Br
-H
-OCH2CH3
EE-EP 1 648 878 B1
146
DDL
-Br
-H
-OCF3
DDM
-Br
-H
-tert-butüül
DDN
-Br
-H
-iso-propüül
DDO
-I
-Cl
-H
DDP
-I
-Br
-H
DDQ
-I
-F
-H
DDR
-I
-CH3
-H
DDS
-I
-CF3
-H
DDT
-I
-OCH3
-H
DDU
-I
-OCH2CH3
-H
DDV
-I
-OCF3
-H
DDW
-I
-tert-butüül
-H
DDX
-I
-iso-propüül
-H
DDY
-I
-CH3
-CH3
DDZ
-I
-H
-H
DEA
-I
-H
-Cl
DEB
-I
-H
-Br
DEC
-I
-H
-F
DED
-I
-H
-CH3
DEE
-I
-H
-CF3
DEF
-I
-H
-OCH3
DEG
-I
-H
-OCH2CH3
DEH
-I
-H
-OCF3
DEI
-I
-H
-tert-butüül
DEJ
-I
-H
-iso-propüül
EE-EP 1 648 878 B1
147
Tabel 14
N
R1
CH3
N
O
NH
N
R8
S
R9
(Ie)
ja selle farmatseutiliselt vastuvõetavad soolad, milles:
Ühend
R1
R8
R9
DEK
-Cl
-Cl
-H
DEL
-Cl
-Br
-H
DEM
-Cl
-F
-H
DEN
-Cl
-CH3
-H
DEO
-Cl
-CF3
-H
DEP
-Cl
-OCH3
-H
DEQ
-Cl
-OCH2CH3
-H
DER
-Cl
-OCF3
-H
DES
-Cl
-tert-butüül
-H
DET
-Cl
-iso-propüül
-H
DEU
-Cl
-CH3
-CH3
DEV
-Cl
-H
-H
DEW
-Cl
-H
-CH3
EE-EP 1 648 878 B1
148
DEX
-Cl
-H
-CF3
DEY
-Cl
-H
-OCH3
DEZ
-Cl
-H
-OCH2CH3
DFA
-Cl
-H
-OCF3
DFB
-Cl
-H
-tert-butüül
DFC
-Cl
-H
-iso-propüül
DFD
-Cl
-H
-OCF3
DFE
-Cl
-H
-tert-butüül
DFF
-Cl
-H
-iso-propüül
DFG
-CH3
-Cl
-H
DFH
-CH3
-Br
-H
DFI
-CH3
-F
-H
DFJ
-CH3
-CH3
-H
DFK
-CH3
-CF3
-H
DFL
-CH3
-OCH3
-H
DFM
-CH3
-OCH2CH3
-H
DFN
-CH3
-OCF3
-H
DFO
-CH3
-tert-butüül
-H
DFP
-CH3
-iso-propüül
-H
DFQ
-CH3
-CH3
-CH3
DFR
-CH3
-H
-H
DFS
-CH3
-H
-Cl
DFT
-CH3
-H
-Br
DFU
-CH3
-H
-F
DFV
-CH3
-H
-CH3
DFW
-CH3
-H
-CF3
DFX
-CH3
-H
-OCH3
DFY
-CH3
-H
-OCH2CH3
DFZ
-CH3
-H
-OCF3
DGA
-CH3
-H
-tert-butüül
DGB
-CH3
-H
-iso-propüül
DGC
-CF3
-Cl
-H
EE-EP 1 648 878 B1
149
DGD
-CF3
-Br
-H
DGE
-CF3
-F
-H
DGF
-CF3
-CH3
-H
DGG
-CF3
-CF3
-H
DGH
-CF3
-OCH3
-H
DGI
-CF3
-OCH2CH3
-H
DGJ
-CF3
-OCF3
-H
DGK
-CF3
-tert-butüül
-H
DGL
-CF3
-iso-propüül
-H
DGM
-CF3
-CH3
-CH3
DGN
-CF3
-H
-H
DGO
-CF3
-H
-Cl
DGP
-CF3
-H
-Br
DGQ
-CF3
-H
-F
DGR
-CF3
-H
-CH3
DGS
-CF3
-H
-CF3
DGT
-CF3
-H
-OCH3
DGU
-CF3
-H
-OCH2CH3
DGV
-CF3
-H
-OCF3
DGW
-CF3
-H
-tert-butüül
DGX
-CF3
-H
-iso-propüül
DGY
-CHF2
-Cl
-H
DGZ
-CHF2
-Br
-H
DHA
-CHF2
-F
-H
DHB
-CHF2
-CH3
-H
DHC
-CHF2
-CF3
-H
DHD
-CHF2
-OCH3
-H
DHE
-CHF2
-OCH2CH3
-H
DHF
-CHF2
-OCF3
-H
DHG
-CHF2
-tert-butüül
-H
DHH
-CHF2
-iso-propüül
-H
DHI
-CHF2
-CH3
-CH3
EE-EP 1 648 878 B1
150
DHJ
-CHF2
-H
-H
DHK
-CHF2
-H
-Cl
DHL
-CHF2
-H
-Br
DHM
-CHF2
-H
-F
DHN
-CHF2
-H
-CH3
DHO
-CHF2
-H
-CF3
DHP
-CHF2
-H
-OCH3
DHQ
-CHF2
-H
-OCH2CH3
DHR
-CHF2
-H
-OCF3
DHS
-CHF2
-H
-tert-butüül
DHT
-CHF2
-H
-iso-propüül
DHU
-OH
-Cl
-H
DHV
-OH
-Br
-H
DHW
-OH
-F
-H
DHX
-OH
-CH3
-H
DHY
-OH
-CF3
-H
DHZ
-OH
-OCH3
-H
DIA
-OH
-OCH2CH3
-H
DIB
-OH
-OCF3
-H
DIC
-OH
-tert-butüül
-H
DID
-OH
-iso-propüül
-H
DIE
-OH
-CH3
-CH3
DIF
-OH
-H
-H
DIG
-OH
-H
-Cl
DIH
-OH
-H
-Br
DII
-OH
-H
-F
DIJ
-OH
-H
-CH3
DIK
-OH
-H
-CF3
DIL
-OH
-H
-OCH3
DIM
-OH
-H
-OCH2CH3
DIN
-OH
-H
-OCF3
DIO
-OH
-H
-tert-butüül
EE-EP 1 648 878 B1
151
DIP
-OH
-H
-iso-propüül
DIQ
-NO2
-Cl
-H
DIR
-NO2
-Br
-H
DIS
-NO2
-F
-H
DIT
-NO2
-CH3
-H
DIU
-NO2
-CF3
-H
DIV
-NO2
-OCH3
-H
DIW
-NO2
-OCH2CH3
-H
DIX
-NO2
-OCF3
-H
DIY
-NO2
-tert-butüül
-H
DIZ
-NO2
-iso-propüül
-H
DJA
-NO2
-CH3
-CH3
DJB
-NO2
-H
-H
DJC
-NO2
-H
-Cl
DJD
-NO2
-H
-Br
DJE
-NO2
-H
-F
DJF
-NO2
-H
-CH3
DJG
-NO2
-H
-CF3
DJH
-NO2
-H
-OCH3
DJI
-NO2
-H
-OCH2CH3
DJJ
-NO2
-H
-OCF3
DJK
-NO2
-H
-tert-butüül
DJL
-NO2
-H
-iso-propüül
DJM
-CN
-Br
-H
DJN
-CN
-Cl
-H
DJO
-CN
-F
-H
DJP
-CN
-CH3
-H
DJQ
-CN
-CF3
-H
DJR
-CN
-OCH3
-H
DJS
-CN
-OCH2CH3
-H
DJT
-CN
-OCF3
-H
DJU
-CN
-tert-butüül
-H
EE-EP 1 648 878 B1
152
DJV
-CN
-iso-propüül
-H
DJW
-CN
-CH3
-CH3
DJX
-CN
-H
-H
DJY
-CN
-H
-Cl
DJZ
-CN
-H
-Br
DKA
-CN
-H
-F
DKB
-CN
-H
-CH3
DKC
-CN
-H
-CF3
DKD
-CN
-H
-OCH3
DKE
-CN
-H
-OCH2CH3
DKF
-CN
-H
-OCF3
DKG
-CN
-H
-tert-butüül
DKH
-CN
-H
-iso-propüül
DKI
-Br
-Br
-H
DKJ
-Br
-Cl
-H
DKK
-Br
-F
-H
DKL
-Br
-CH3
-H
DKM
-Br
-CF3
-H
DKN
-Br
-OCH3
-H
DKO
-Br
-OCH2CH3
-H
DKP
-Br
-OCF3
-H
DKQ
-Br
-tert-butüül
-H
DKR
-Br
-iso-propüül
-H
DKS
-Br
-CH3
-CH3
DKT
-Br
-H
-H
DKU
-Br
-H
-Cl
DKV
-Br
-H
-Br
DKW
-Br
-H
-F
DKX
-Br
-H
-CH3
DKY
-Br
-H
-CF3
DKZ
-Br
-H
-OCH3
DLA
-Br
-H
-OCH2CH3
EE-EP 1 648 878 B1
153
DLB
-Br
-H
-OCF3
DLC
-Br
-H
-tert-butüül
DLD
-Br
-H
-iso-propüül
DLE
-I
-Cl
-H
DLF
-I
-Br
-H
DLG
-I
-F
-H
DLH
-I
-CH3
-H
DLI
-I
-CF3
-H
DLJ
-I
-OCH3
-H
DLK
-I
-OCH2CH3
-H
DLL
-I
-OCF3
-H
DLM
-I
-tert-butüül
-H
DLN
-I
-iso-propüül
-H
DLO
-I
-CH3
-CH3
DLP
-I
-H
-H
DLQ
-I
-H
-Cl
DLR
-I
-H
-Br
DLS
-I
-H
-F
DLT
-I
-H
-CH3
DLU
-I
-H
-CF3
DLV
-I
-H
-OCH3
DLW
-I
-H
-OCH2CH3
DLX
-I
-H
-OCF3
DLY
-I
-H
-tert-butüül
DLZ
-I
-H
-iso-propüül
EE-EP 1 648 878 B1
154
Tabel 15
N
R1
CF3
N
O
NH
N
R8
S
R9
(If)
ja selle farmatseutiliselt vastuvõetavad soolad, milles:
Ühend
R1
R8
R9
DMA
-Cl
-Cl
-H
DMB
-Cl
-Br
-H
DMC
-Cl
-F
-H
DMD
-Cl
-CH3
-H
DME
-Cl
-CF3
-H
DMF
-Cl
-OCH3
-H
DMG
-Cl
-OCH2CH3
-H
DMH
-Cl
-OCF3
-H
DMI
-Cl
-tert-butüül
-H
DMJ
-Cl
-iso-propüül
-H
DMK
-Cl
-CH3
-CH3
DML
-Cl
-H
-H
DMM
-Cl
-H
-CH3
EE-EP 1 648 878 B1
155
DMN
-Cl
-H
-CF3
DMO
-Cl
-H
-OCH3
DMP
-Cl
-H
-OCH2CH3
DMQ
-Cl
-H
-OCF3
DMR
-Cl
-H
-tert-butüül
DMS
-Cl
-H
-iso-propüül
DMT
-Cl
-H
-OCF3
DMU
-Cl
-H
-tert-butüül
DMV
-Cl
-H
-iso-propüül
DMW
-CH3
-Cl
-H
DMX
-CH3
-Br
-H
DMY
-CH3
-F
-H
DMZ
-CH3
-CH3
-H
DNA
-CH3
-CF3
-H
DNB
-CH3
-OCH3
-H
DNC
-CH3
-OCH2CH3
-H
DND
-CH3
-OCF3
-H
DNE
-CH3
-tert-butüül
-H
DNF
-CH3
-iso-propüül
-H
DNG
-CH3
-CH3
-CH3
DNH
-CH3
-H
-H
DNI
-CH3
-H
-Cl
DNJ
-CH3
-H
-Br
DNK
-CH3
-H
-F
DNL
-CH3
-H
-CH3
DNM
-CH3
-H
-CF3
DNN
-CH3
-H
-OCH3
DNO
-CH3
-H
-OCH2CH3
DNP
-CH3
-H
-OCF3
DNQ
-CH3
-H
-tert-butüül
DNR
-CH3
-H
-iso-propüül
DNS
-CF3
-Cl
-H
EE-EP 1 648 878 B1
156
DNT
-CF3
-Br
-H
DNU
-CF3
-F
-H
DNV
-CF3
-CH3
-H
DNW
-CF3
-CF3
-H
DNX
-CF3
-OCH3
-H
DNY
-CF3
-OCH2CH3
-H
DNZ
-CF3
-OCF3
-H
DOA
-CF3
-tert-butüül
-H
DOB
-CF3
-iso-propüül
-H
DOC
-CF3
-CH3
-CH3
DOD
-CF3
-H
-H
DOE
-CF3
-H
-Cl
DOF
-CF3
-H
-Br
DOG
-CF3
-H
-F
DOH
-CF3
-H
-CH3
DOI
-CF3
-H
-CF3
DOJ
-CF3
-H
-OCH3
DOK
-CF3
-H
-OCH2CH3
DOL
-CF3
-H
-OCF3
DOM
-CF3
-H
-tert-butüül
DON
-CF3
-H
-iso-propüül
DOO
-CHF2
-Cl
-H
DOP
-CHF2
-Br
-H
DOQ
-CHF2
-F
-H
DOR
-CHF2
-CH3
-H
DOS
-CHF2
-CF3
-H
DOT
-CHF2
-OCH3
-H
DOU
-CHF2
-OCH2CH3
-H
DOV
-CHF2
-OCF3
-H
DOW
-CHF2
-tert-butüül
-H
DOX
-CHF2
-iso-propüül
-H
DOY
-CHF2
-CH3
-CH3
EE-EP 1 648 878 B1
157
DOZ
-CHF2
-H
-H
DPA
-CHF2
-H
-Cl
DPB
-CHF2
-H
-Br
DPC
-CHF2
-H
-F
DPD
-CHF2
-H
-CH3
DPE
-CHF2
-H
-CF3
DPF
-CHF2
-H
-OCH3
DPG
-CHF2
-H
-OCH2CH3
DPH
-CHF2
-H
-OCF3
DPI
-CHF2
-H
-tert-butüül
DPJ
-CHF2
-H
-iso-propüül
DPK
-OH
-Cl
-H
DPL
-OH
-Br
-H
DPM
-OH
-F
-H
DPN
-OH
-CH3
-H
DPO
-OH
-CF3
-H
DPP
-OH
-OCH3
-H
DPQ
-OH
-OCH2CH3
-H
DPR
-OH
-OCF3
-H
DPS
-OH
-tert-butüül
-H
DPT
-OH
-iso-propüül
-H
DPU
-OH
-CH3
-CH3
DPV
-OH
-H
-H
DPW
-OH
-H
-Cl
DPX
-OH
-H
-Br
DPY
-OH
-H
-F
DPZ
-OH
-H
-CH3
DQA
-OH
-H
-CF3
DQB
-OH
-H
-OCH3
DQC
-OH
-H
-OCH2CH3
DQD
-OH
-H
-OCF3
DQE
-OH
-H
-tert-butüül
EE-EP 1 648 878 B1
158
DQF
-OH
-H
-iso-propüül
DQG
-NO2
-Cl
-H
DQH
-NO2
-Br
-H
DQI
-NO2
-F
-H
DQJ
-NO2
-CH3
-H
DQK
-NO2
-CF3
-H
DQL
-NO2
-OCH3
-H
DQM
-NO2
-OCH2CH3
-H
DQN
-NO2
-OCF3
-H
DQO
-NO2
-tert-butüül
-H
DQP
-NO2
-iso-propüül
-H
DQQ
-NO2
-CH3
-CH3
DQR
-NO2
-H
-H
DQS
-NO2
-H
-Cl
DQT
-NO2
-H
-Br
DQU
-NO2
-H
-F
DQV
-NO2
-H
-CH3
DQW
-NO2
-H
-CF3
DQX
-NO2
-H
-OCH3
DQY
-NO2
-H
-OCH2CH3
DQZ
-NO2
-H
-OCF3
DRA
-NO2
-H
-tert-butüül
DRB
-NO2
-H
-iso-propüül
DRC
-CN
-Br
-H
DRD
-CN
-Cl
-H
DRE
-CN
-F
-H
DRF
-CN
-CH3
-H
DRG
-CN
-CF3
-H
DRH
-CN
-OCH3
-H
DRI
-CN
-OCH2CH3
-H
DRJ
-CN
-OCF3
-H
DRK
-CN
-tert-butüül
-H
EE-EP 1 648 878 B1
159
DRL
-CN
-iso-propüül
-H
DRM
-CN
-CH3
-CH3
DRN
-CN
-H
-H
DRO
-CN
-H
-Cl
DRP
-CN
-H
-Br
DRQ
-CN
-H
-F
DRR
-CN
-H
-CH3
DRS
-CN
-H
-CF3
DRT
-CN
-H
-OCH3
DRU
-CN
-H
-OCH2CH3
DRV
-CN
-H
-OCF3
DRW
-CN
-H
-tert-butüül
DRX
-CN
-H
-iso-propüül
DRY
-Br
-Br
-H
DRZ
-Br
-Cl
-H
DSA
-Br
-F
-H
DSB
-Br
-CH3
-H
DSC
-Br
-CF3
-H
DSD
-Br
-OCH3
-H
DSE
-Br
-OCH2CH3
-H
DSF
-Br
-OCF3
-H
DSG
-Br
-tert-butüül
-H
DSH
-Br
-iso-propüül
-H
DSI
-Br
-CH3
-CH3
DSJ
-Br
-H
-H
DSK
-Br
-H
-Cl
DSL
-Br
-H
-Br
DSM
-Br
-H
-F
DSN
-Br
-H
-CH3
DSO
-Br
-H
-CF3
DSP
-Br
-H
-OCH3
DSQ
-Br
-H
-OCH2CH3
EE-EP 1 648 878 B1
160
DSR
-Br
-H
-OCF3
DSS
-Br
-H
-tert-butüül
DST
-Br
-H
-iso-propüül
DSU
-I
-Cl
-H
DSV
-I
-Br
-H
DSW
-I
-F
-H
DSX
-I
-CH3
-H
DSY
-I
-CF3
-H
DSZ
-I
-OCH3
-H
DTA
-I
-OCH2CH3
-H
DTB
-I
-OCF3
-H
DTC
-I
-tert-butüül
-H
DTD
-I
-iso-propüül
-H
DTE
-I
-CH3
-CH3
DTF
-I
-H
-H
DTG
-I
-H
-Cl
DTH
-I
-H
-Br
DTI
-I
-H
-F
DTJ
-I
-H
-CH3
DTK
-I
-H
-CF3
DTL
-I
-H
-OCH3
DTM
-I
-H
-OCH2CH3
DTN
-I
-H
-OCF3
DTO
-I
-H
-tert-butüül
DTP
-I
-H
-iso-propüül
EE-EP 1 648 878 B1
161
Tabel 16
N
R1
OCH3
N
O
NH
N
R8
S
R9
(Ig)
ja selle farmatseutiliselt vastuvõetavad soolad, milles:
Ühend
R1
R8
R9
DTQ
-Cl
-Cl
-H
DTR
-Cl
-Br
-H
DTS
-Cl
-F
-H
DTT
-Cl
-CH3
-H
DTU
-Cl
-CF3
-H
DTV
-Cl
-OCH3
-H
DTW
-Cl
-OCH2CH3
-H
DTX
-Cl
-OCF3
-H
DTY
-Cl
-tert-butüül
-H
DTZ
-Cl
-iso-propüül
-H
DUA
-Cl
-CH3
-CH3
DUB
-Cl
-H
-H
DUC
-Cl
-H
-CH3
EE-EP 1 648 878 B1
162
DUD
-Cl
-H
-CF3
DUE
-Cl
-H
-OCH3
DUF
-Cl
-H
-OCH2CH3
DUG
-Cl
-H
-OCF3
DUH
-Cl
-H
-tert-butüül
DUI
-Cl
-H
-iso-propüül
DUJ
-Cl
-H
-OCF3
DUK
-Cl
-H
-tert-butüül
DUL
-Cl
-H
-iso-propüül
DUM
-CH3
-Cl
-H
DUN
-CH3
-Br
-H
DUO
-CH3
-F
-H
DUP
-CH3
-CH3
-H
DUQ
-CH3
-CF3
-H
DUR
-CH3
-OCH3
-H
DUS
-CH3
-OCH2CH3
-H
DUT
-CH3
-OCF3
-H
DUU
-CH3
-tert-butüül
-H
DUV
-CH3
-iso-propüül
-H
DUW
-CH3
-CH3
-CH3
DUX
-CH3
-H
-H
DUY
-CH3
-H
-Cl
DUZ
-CH3
-H
-Br
DVA
-CH3
-H
-F
DVB
-CH3
-H
-CH3
DVC
-CH3
-H
-CF3
DVD
-CH3
-H
-OCH3
DVE
-CH3
-H
-OCH2CH3
DVF
-CH3
-H
-OCF3
DVG
-CH3
-H
-tert-butüül
DVH
-CH3
-H
-iso-propüül
DVI
-CF3
-Cl
-H
EE-EP 1 648 878 B1
163
DVJ
-CF3
-Br
-H
DVK
-CF3
-F
-H
DVL
-CF3
-CH3
-H
DVM
-CF3
-CF3
-H
DVN
-CF3
-OCH3
-H
DVO
-CF3
-OCH2CH3
-H
DVP
-CF3
-OCF3
-H
DVQ
-CF3
-tert-butüül
-H
DVR
-CF3
-iso-propüül
-H
DVS
-CF3
-CH3
-CH3
DVT
-CF3
-H
-H
DVU
-CF3
-H
-Cl
DVV
-CF3
-H
-Br
DVW
-CF3
-H
-F
DVX
-CF3
-H
-CH3
DVY
-CF3
-H
-CF3
DVZ
-CF3
-H
-OCH3
DWA
-CF3
-H
-OCH2CH3
DWB
-CF3
-H
-OCF3
DWC
-CF3
-H
-tert-butüül
DWD
-CF3
-H
-iso-propüül
DWE
-CHF2
-Cl
-H
DWF
-CHF2
-Br
-H
DWG
-CHF2
-F
-H
DWH
-CHF2
-CH3
-H
DWI
-CHF2
-CF3
-H
DWJ
-CHF2
-OCH3
-H
DWK
-CHF2
-OCH2CH3
-H
DWL
-CHF2
-OCF3
-H
DWM
-CHF2
-tert-butüül
-H
DWN
-CHF2
-iso-propüül
-H
DWO
-CHF2
-CH3
-CH3
EE-EP 1 648 878 B1
164
DWP
-CHF2
-H
-H
DWQ
-CHF2
-H
-Cl
DWR
-CHF2
-H
-Br
DWS
-CHF2
-H
-F
DWT
-CHF2
-H
-CH3
DWU
-CHF2
-H
-CF3
DWV
-CHF2
-H
-OCH3
DWW
-CHF2
-H
-OCH2CH3
DWX
-CHF2
-H
-OCF3
DWY
-CHF2
-H
-tert-butüül
DWZ
-CHF2
-H
-iso-propüül
DXA
-OH
-Cl
-H
DXB
-OH
-Br
-H
DXC
-OH
-F
-H
DXD
-OH
-CH3
-H
DXE
-OH
-CF3
-H
DXF
-OH
-OCH3
-H
DXG
-OH
-OCH2CH3
-H
DXH
-OH
-OCF3
-H
DXI
-OH
-tert-butüül
-H
DXJ
-OH
-iso-propüül
-H
DXK
-OH
-CH3
-CH3
DXL
-OH
-H
-H
DXM
-OH
-H
-Cl
DXN
-OH
-H
-Br
DXO
-OH
-H
-F
DXP
-OH
-H
-CH3
DXQ
-OH
-H
-CF3
DXR
-OH
-H
-OCH3
DXS
-OH
-H
-OCH2CH3
DXT
-OH
-H
-OCF3
DXU
-OH
-H
-tert-butüül
EE-EP 1 648 878 B1
165
DXV
-OH
-H
-iso-propüül
DXW
-NO2
-Cl
-H
DXX
-NO2
-Br
-H
DXY
-NO2
-F
-H
DXZ
-NO2
-CH3
-H
DYA
-NO2
-CF3
-H
DYB
-NO2
-OCH3
-H
DYC
-NO2
-OCH2CH3
-H
DYD
-NO2
-OCF3
-H
DYE
-NO2
-tert-butüül
-H
DYF
-NO2
-iso-propüül
-H
DYG
-NO2
-CH3
-CH3
DYH
-NO2
-H
-H
DYI
-NO2
-H
-Cl
DYJ
-NO2
-H
-Br
DYK
-NO2
-H
-F
DYL
-NO2
-H
-CH3
DYM
-NO2
-H
-CF3
DYN
-NO2
-H
-OCH3
DYO
-NO2
-H
-OCH2CH3
DYP
-NO2
-H
-OCF3
DYQ
-NO2
-H
-tert-butüül
DYR
-NO2
-H
-iso-propüül
DYS
-CN
-Br
-H
DYT
-CN
-Cl
-H
DYU
-CN
-F
-H
DYV
-CN
-CH3
-H
DYW
-CN
-CF3
-H
DYX
-CN
-OCH3
-H
DYY
-CN
-OCH2CH3
-H
DYZ
-CN
-OCF3
-H
DZA
-CN
-tert-butüül
-H
EE-EP 1 648 878 B1
166
DZB
-CN
-iso-propüül
-H
DZC
-CN
-CH3
-CH3
DZD
-CN
-H
-H
DZE
-CN
-H
-Cl
DZF
-CN
-H
-Br
DZG
-CN
-H
-F
DZH
-CN
-H
-CH3
DZI
-CN
-H
-CF3
DZJ
-CN
-H
-OCH3
DZK
-CN
-H
-OCH2CH3
DZL
-CN
-H
-OCF3
DZM
-CN
-H
-tert-butüül
DZN
-CN
-H
-iso-propüül
DZO
-Br
-Br
-H
DZP
-Br
-Cl
-H
DZQ
-Br
-F
-H
DZR
-Br
-CH3
-H
DZS
-Br
-CF3
-H
DZT
-Br
-OCH3
-H
DZU
-Br
-OCH2CH3
-H
DZV
-Br
-OCF3
-H
DZW
-Br
-tert-butüül
-H
DZX
-Br
-iso-propüül
-H
DZY
-Br
-CH3
-CH3
DZZ
-Br
-H
-H
EAA
-Br
-H
-Cl
EAB
-Br
-H
-Br
EAC
-Br
-H
-F
EAD
-Br
-H
-CH3
EAE
-Br
-H
-CF3
EAF
-Br
-H
-OCH3
EAG
-Br
-H
-OCH2CH3
EE-EP 1 648 878 B1
167
EAH
-Br
-H
-OCF3
EAI
-Br
-H
-tert-butüül
EAJ
-Br
-H
-iso-propüül
EAK
-I
-Cl
-H
EAL
-I
-Br
-H
EAM
-I
-F
-H
EAN
-I
-CH3
-H
EAO
-I
-CF3
-H
EAP
-I
-OCH3
-H
EAQ
-I
-OCH2CH3
-H
EAR
-I
-OCF3
-H
EAS
-I
-tert-butüül
-H
EAT
-I
-iso-propüül
-H
EAU
-I
-CH3
-CH3
EAV
-I
-H
-H
EAW
-I
-H
-Cl
EAX
-I
-H
-Br
EAY
-I
-H
-F
EAZ
-I
-H
-CH3
EBA
-I
-H
-CF3
EBB
-I
-H
-OCH3
EBC
-I
-H
-OCH2CH3
EBD
-I
-H
-OCF3
EBE
-I
-H
-tert-butüül
EBF
-I
-H
-iso-propüül
EE-EP 1 648 878 B1
168
Tabel 17
N
R1
OCF3
N
O
NH
N
R8
S
R9
(Ih)
ja selle farmatseutiliselt vastuvõetavad soolad, milles:
Ühend
R1
R8
R9
EBG
-Cl
-Cl
-H
EBH
-Cl
-Br
-H
EBI
-Cl
-F
-H
EBJ
-Cl
-CH3
-H
EBK
-Cl
-CF3
-H
EBL
-Cl
-OCH3
-H
EBM
-Cl
-OCH2CH3
-H
EBN
-Cl
-OCF3
-H
EBO
-Cl
-tert-butüül
-H
EBP
-Cl
-iso-propüül
-H
EBQ
-Cl
-CH3
-CH3
EBR
-Cl
-H
-H
EBS
-Cl
-H
-CH3
EE-EP 1 648 878 B1
169
EBT
-Cl
-H
-CF3
EBU
-Cl
-H
-OCH3
EBV
-Cl
-H
-OCH2CH3
EBW
-Cl
-H
-OCF3
EBX
-Cl
-H
-tert-butüül
EBY
-Cl
-H
-iso-propüül
EBZ
-Cl
-H
-OCF3
ECA
-Cl
-H
-tert-butüül
ECB
-Cl
-H
-iso-propüül
ECC
-CH3
-Cl
-H
ECD
-CH3
-Br
-H
ECE
-CH3
-F
-H
ECF
-CH3
-CH3
-H
ECG
-CH3
-CF3
-H
ECH
-CH3
-OCH3
-H
ECI
-CH3
-OCH2CH3
-H
ECJ
-CH3
-OCF3
-H
ECK
-CH3
-tert-butüül
-H
ECL
-CH3
-iso-propüül
-H
ECM
-CH3
-CH3
-CH3
ECN
-CH3
-H
-H
ECO
-CH3
-H
-Cl
ECP
-CH3
-H
-Br
ECQ
-CH3
-H
-F
ECR
-CH3
-H
-CH3
ECS
-CH3
-H
-CF3
ECT
-CH3
-H
-OCH3
ECU
-CH3
-H
-OCH2CH3
ECV
-CH3
-H
-OCF3
ECW
-CH3
-H
-tert-butüül
ECX
-CH3
-H
-iso-propüül
ECY
-CF3
-Cl
-H
EE-EP 1 648 878 B1
170
ECZ
-CF3
-Br
-H
EDA
-CF3
-F
-H
EDB
-CF3
-CH3
-H
EDC
-CF3
-CF3
-H
EDD
-CF3
-OCH3
-H
EDE
-CF3
-OCH2CH3
-H
EDF
-CF3
-OCF3
-H
EDG
-CF3
-tert-butüül
-H
EDH
-CF3
-iso-propüül
-H
EDI
-CF3
-CH3
-CH3
EDJ
-CF3
-H
-H
EDK
-CF3
-H
-Cl
EDL
-CF3
-H
-Br
EDM
-CF3
-H
-F
EDN
-CF3
-H
-CH3
EDO
-CF3
-H
-CF3
EDP
-CF3
-H
-OCH3
EDQ
-CF3
-H
-OCH2CH3
EDR
-CF3
-H
-OCF3
EDS
-CF3
-H
-tert-butüül
EDT
-CF3
-H
-iso-propüül
EDU
-CHF2
-Cl
-H
EDV
-CHF2
-Br
-H
EDW
-CHF2
-F
-H
EDX
-CHF2
-CH3
-H
EDY
-CHF2
-CF3
-H
EDZ
-CHF2
-OCH3
-H
EEA
-CHF2
-OCH2CH3
-H
EEB
-CHF2
-OCF3
-H
EEC
-CHF2
-tert-butüül
-H
EED
-CHF2
-iso-propüül
-H
EEE
-CHF2
-CH3
-CH3
EE-EP 1 648 878 B1
171
EEF
-CHF2
-H
-H
EEG
-CHF2
-H
-Cl
EEH
-CHF2
-H
-Br
EEI
-CHF2
-H
-F
EEJ
-CHF2
-H
-CH3
EEK
-CHF2
-H
-CF3
EEL
-CHF2
-H
-OCH3
EEM
-CHF2
-H
-OCH2CH3
EEN
-CHF2
-H
-OCF3
EEO
-CHF2
-H
-tert-butüül
EEP
-CHF2
-H
-iso-propüül
EEQ
-OH
-Cl
-H
EER
-OH
-Br
-H
EES
-OH
-F
-H
EET
-OH
-CH3
-H
EEU
-OH
-CF3
-H
EEV
-OH
-OCH3
-H
EEW
-OH
-OCH2CH3
-H
EEX
-OH
-OCF3
-H
EEY
-OH
-tert-butüül
-H
EEZ
-OH
-iso-propüül
-H
EFA
-OH
-CH3
-CH3
EFB
-OH
-H
-H
EFC
-OH
-H
-Cl
EFD
-OH
-H
-Br
EFE
-OH
-H
-F
EFF
-OH
-H
-CH3
EFG
-OH
-H
-CF3
EFH
-OH
-H
-OCH3
EFI
-OH
-H
-OCH2CH3
EFJ
-OH
-H
-OCF3
EFK
-OH
-H
-tert-butüül
EE-EP 1 648 878 B1
172
EFL
-OH
-H
-iso-propüül
EFM
-NO2
-Cl
-H
EFN
-NO2
-Br
-H
EFO
-NO2
-F
-H
EFP
-NO2
-CH3
-H
EFQ
-NO2
-CF3
-H
EFR
-NO2
-OCH3
-H
EFS
-NO2
-OCH2CH3
-H
EFT
-NO2
-OCF3
-H
EFU
-NO2
-tert-butüül
-H
EFV
-NO2
-iso-propüül
-H
EFW
-NO2
-CH3
-CH3
EFX
-NO2
-H
-H
EFY
-NO2
-H
-Cl
EFZ
-NO2
-H
-Br
EGA
-NO2
-H
-F
EGB
-NO2
-H
-CH3
EGC
-NO2
-H
-CF3
EGD
-NO2
-H
-OCH3
EGE
-NO2
-H
-OCH2CH3
EGF
-NO2
-H
-OCF3
EGG
-NO2
-H
-tert-butüül
EGH
-NO2
-H
-iso-propüül
EGI
-CN
-Br
-H
EGJ
-CN
-Cl
-H
EGK
-CN
-F
-H
EGL
-CN
-CH3
-H
EGM
-CN
-CF3
-H
EGN
-CN
-OCH3
-H
EGO
-CN
-OCH2CH3
-H
EGP
-CN
-OCF3
-H
EGQ
-CN
-tert-butüül
-H
EE-EP 1 648 878 B1
173
EGR
-CN
-iso-propüül
-H
EGS
-CN
-CH3
-CH3
EGT
-CN
-H
-H
EGU
-CN
-H
-Cl
EGV
-CN
-H
-Br
EGW
-CN
-H
-F
EGX
-CN
-H
-CH3
EGY
-CN
-H
-CF3
EGZ
-CN
-H
-OCH3
EHA
-CN
-H
-OCH2CH3
EHB
-CN
-H
-OCF3
EHC
-CN
-H
-tert-butüül
EHD
-CN
-H
-iso-propüül
EHE
-Br
-Br
-H
EHF
-Br
-Cl
-H
EHG
-Br
-F
-H
EHH
-Br
-CH3
-H
EHI
-Br
-CF3
-H
EHJ
-Br
-OCH3
-H
EHK
-Br
-OCH2CH3
-H
EHL
-Br
-OCF3
-H
EHM
-Br
-tert-butüül
-H
EHN
-Br
-iso-propüül
-H
EHO
-Br
-CH3
-CH3
EHP
-Br
-H
-H
EHQ
-Br
-H
-Cl
EHR
-Br
-H
-Br
EHS
-Br
-H
-F
EHT
-Br
-H
-CH3
EHU
-Br
-H
-CF3
EHV
-Br
-H
-OCH3
EHW
-Br
-H
-OCH2CH3
EE-EP 1 648 878 B1
174
EHX
-Br
-H
-OCF3
EHY
-Br
-H
-tert-butüül
EHZ
-Br
-H
-iso-propüül
EIA
-I
-Cl
-H
EIB
-I
-Br
-H
EIC
-I
-F
-H
EID
-I
-CH3
-H
EIE
-I
-CF3
-H
EIF
-I
-OCH3
-H
EIG
-I
-OCH2CH3
-H
EIH
-I
-OCF3
-H
EII
-I
-tert-butüül
-H
EIJ
-I
-iso-propüül
-H
EIK
-I
-CH3
-CH3
EIL
-I
-H
-H
EIM
-I
-H
-Cl
EIN
-I
-H
-Br
EIO
-I
-H
-F
EIP
-I
-H
-CH3
EIQ
-I
-H
-CF3
EIR
-I
-H
-OCH3
EIS
-I
-H
-OCH2CH3
EIT
-I
-H
-OCF3
EIU
-I
-H
-tert-butüül
EIV
-I
-H
-iso-propüül
EE-EP 1 648 878 B1
175
Tabel 18
N
R1
OH
N
O
NH
N
R8
S
R9
(Ii)
ja selle farmatseutiliselt vastuvõetavad soolad, milles:
Ühend
R1
R8
R9
EIW
-Cl
-Cl
-H
EIX
-Cl
-Br
-H
EIY
-Cl
-F
-H
EIZ
-Cl
-CH3
-H
EJA
-Cl
-CF3
-H
EJB
-Cl
-OCH3
-H
EJC
-Cl
-OCH2CH3
-H
EJD
-Cl
-OCF3
-H
EJE
-Cl
-tert-butüül
-H
EJF
-Cl
-iso-propüül
-H
EJG
-Cl
-CH3
-CH3
EJH
-Cl
-H
-H
EJI
-Cl
-H
-CH3
EE-EP 1 648 878 B1
176
EJJ
-Cl
-H
-CF3
EJK
-Cl
-H
-OCH3
EJL
-Cl
-H
-OCH2CH3
EJM
-Cl
-H
-OCF3
EJN
-Cl
-H
-tert-butüül
EJO
-Cl
-H
-iso-propüül
EJP
-Cl
-H
-OCF3
EJQ
-Cl
-H
-tert-butüül
EJR
-Cl
-H
-iso-propüül
EJS
-CH3
-Cl
-H
EJT
-CH3
-Br
-H
EJU
-CH3
-F
-H
EJV
-CH3
-CH3
-H
EJW
-CH3
-CF3
-H
EJX
-CH3
-OCH3
-H
EJY
-CH3
-OCH2CH3
-H
EJZ
-CH3
-OCF3
-H
EKA
-CH3
-tert-butüül
-H
EKB
-CH3
-iso-propüül
-H
EKC
-CH3
-CH3
-CH3
EKD
-CH3
-H
-H
EKE
-CH3
-H
-Cl
EKF
-CH3
-H
-Br
EKG
-CH3
-H
-F
EKH
-CH3
-H
-CH3
EKI
-CH3
-H
-CF3
EKJ
-CH3
-H
-OCH3
EKK
-CH3
-H
-OCH2CH3
EKL
-CH3
-H
-OCF3
EKM
-CH3
-H
-tert-butüül
EKN
-CH3
-H
-iso-propüül
EKO
-CF3
-Cl
-H
EE-EP 1 648 878 B1
177
EKP
-CF3
-Br
-H
EKQ
-CF3
-F
-H
EKR
-CF3
-CH3
-H
EKS
-CF3
-CF3
-H
EKT
-CF3
-OCH3
-H
EKU
-CF3
-OCH2CH3
-H
EKV
-CF3
-OCF3
-H
EKW
-CF3
-tert-butüül
-H
EKX
-CF3
-iso-propüül
-H
EKY
-CF3
-CH3
-CH3
EKZ
-CF3
-H
-H
ELA
-CF3
-H
-Cl
ELB
-CF3
-H
-Br
ELC
-CF3
-H
-F
ELD
-CF3
-H
-CH3
ELE
-CF3
-H
-CF3
ELF
-CF3
-H
-OCH3
ELG
-CF3
-H
-OCH2CH3
ELH
-CF3
-H
-OCF3
ELI
-CF3
-H
-tert-butüül
ELJ
-CF3
-H
-iso-propüül
ELK
-CHF2
-Cl
-H
ELL
-CHF2
-Br
-H
ELM
-CHF2
-F
-H
ELN
-CHF2
-CH3
-H
ELO
-CHF2
-CF3
-H
ELP
-CHF2
-OCH3
-H
ELQ
-CHF2
-OCH2CH3
-H
ELR
-CHF2
-OCF3
-H
ELS
-CHF2
-tert-butüül
-H
ELT
-CHF2
-iso-propüül
-H
ELU
-CHF2
-CH3
-CH3
EE-EP 1 648 878 B1
178
ELV
-CHF2
-H
-H
ELW
-CHF2
-H
-Cl
ELX
-CHF2
-H
-Br
ELY
-CHF2
-H
-F
ELZ
-CHF2
-H
-CH3
EMA
-CHF2
-H
-CF3
EMB
-CHF2
-H
-OCH3
EMC
-CHF2
-H
-OCH2CH3
EMD
-CHF2
-H
-OCF3
EME
-CHF2
-H
-tert-butüül
EMF
-CHF2
-H
-iso-propüül
EMG
-OH
-Cl
-H
EMH
-OH
-Br
-H
EMI
-OH
-F
-H
EMJ
-OH
-CH3
-H
EMK
-OH
-CF3
-H
EML
-OH
-OCH3
-H
EMM
-OH
-OCH2CH3
-H
EMN
-OH
-OCF3
-H
EMO
-OH
-tert-butüül
-H
EMP
-OH
-iso-propüül
-H
EMQ
-OH
-CH3
-CH3
EMR
-OH
-H
-H
EMS
-OH
-H
-Cl
EMT
-OH
-H
-Br
EMU
-OH
-H
-F
EMV
-OH
-H
-CH3
EMW
-OH
-H
-CF3
EMX
-OH
-H
-OCH3
EMY
-OH
-H
-OCH2CH3
EMZ
-OH
-H
-OCF3
ENA
-OH
-H
-tert-butüül
EE-EP 1 648 878 B1
179
ENB
-OH
-H
-iso-propüül
ENC
-NO2
-Cl
-H
END
-NO2
-Br
-H
ENE
-NO2
-F
-H
ENF
-NO2
-CH3
-H
ENG
-NO2
-CF3
-H
ENH
-NO2
-OCH3
-H
ENI
-NO2
-OCH2CH3
-H
ENJ
-NO2
-OCF3
-H
ENK
-NO2
-tert-butüül
-H
ENL
-NO2
-iso-propüül
-H
ENM
-NO2
-CH3
-CH3
ENN
-NO2
-H
-H
ENO
-NO2
-H
-Cl
ENP
-NO2
-H
-Br
ENQ
-NO2
-H
-F
ENR
-NO2
-H
-CH3
ENS
-NO2
-H
-CF3
ENT
-NO2
-H
-OCH3
ENU
-NO2
-H
-OCH2CH3
ENV
-NO2
-H
-OCF3
ENW
-NO2
-H
-tert-butüül
ENX
-NO2
-H
-iso-propüül
ENY
-CN
-Br
-H
ENZ
-CN
-Cl
-H
EOA
-CN
-F
-H
EOB
-CN
-CH3
-H
EOC
-CN
-CF3
-H
EOD
-CN
-OCH3
-H
EOE
-CN
-OCH2CH3
-H
EOF
-CN
-OCF3
-H
EOG
-CN
-tert-butüül
-H
EE-EP 1 648 878 B1
180
EOH
-CN
-iso-propüül
-H
EOI
-CN
-CH3
-CH3
EOJ
-CN
-H
-H
EOK
-CN
-H
-Cl
EOL
-CN
-H
-Br
EOM
-CN
-H
-F
EON
-CN
-H
-CH3
EOO
-CN
-H
-CF3
EOP
-CN
-H
-OCH3
EOQ
-CN
-H
-OCH2CH3
EOR
-CN
-H
-OCF3
EOS
-CN
-H
-tert-butüül
EOT
-CN
-H
-iso-propüül
EOU
-Br
-Br
-H
EOV
-Br
-Cl
-H
EOW
-Br
-F
-H
EOX
-Br
-CH3
-H
EOY
-Br
-CF3
-H
EOZ
-Br
-OCH3
-H
EPA
-Br
-OCH2CH3
-H
EPB
-Br
-OCF3
-H
EPC
-Br
-tert-butüül
-H
EPD
-Br
-iso-propüül
-H
EPE
-Br
-CH3
-CH3
EPF
-Br
-H
-H
EPG
-Br
-H
-Cl
EPH
-Br
-H
-Br
EPI
-Br
-H
-F
EPJ
-Br
-H
-CH3
EPK
-Br
-H
-CF3
EPL
-Br
-H
-OCH3
EPM
-Br
-H
-OCH2CH3
EE-EP 1 648 878 B1
181
EPN
-Br
-H
-OCF3
EPO
-Br
-H
-tert-butüül
EPP
-Br
-H
-iso-propüül
EPQ
-I
-Cl
-H
EPR
-I
-Br
-H
EPS
-I
-F
-H
EPT
-I
-CH3
-H
EPU
-I
-CF3
-H
EPV
-I
-OCH3
-H
EPW
-I
-OCH2CH3
-H
EPX
-I
-OCF3
-H
EPY
-I
-tert-butüül
-H
EPZ
-I
-iso-propüül
-H
EQA
-I
-CH3
-CH3
EQB
-I
-H
-H
EQC
-I
-H
-Cl
EQD
-I
-H
-Br
EQE
-I
-H
-F
EQF
-I
-H
-CH3
EQG
-I
-H
-CF3
EQH
-I
-H
-OCH3
EQI
-I
-H
-OCH2CH3
EQJ
-I
-H
-OCF3
EQK
-I
-H
-tert-butüül
EQL
-I
-H
-iso-propüül
EE-EP 1 648 878 B1
182
4.5 MÄÄRATLUSED
Siin kasutatuna on eespool kasutatud terminitel järgmised tähendused.
"-(C1-C10)alküülrühm" tähendab hargnemata või hargnenud ahelaga mittetsüklilist
süsivesinikrühma, millel on 1-10 süsinikuaatomit. Tüüpilised hargnemata ahelaga
5
-(C1-C10)alküülrühmad hõlmavad metüül-, etüül-, n-propüül-, n-butüül-, n-pentüül-,
n-heksüül-, n-heptüül-, n-oktüül-, n-nonüül- ja n-detsüülrühma. Tüüpilised
hargnenud ahelaga -(C1-C10)alküülrühmad hõlmavad isopropüül-, sec-butüül-,
isobutüül-, tert-butüül-, isopentüül-, neopentüül-, 1-metüülbutüül-, 2-metüülbutüül-, 3-metüülbutüül-, 1,1-dimetüülpropüül-, 1,2-dimetüülpropüül-, 1-metüül-
10
pentüül-, 2-metüülpentüül-, 3-metüülpentüül-, 4-metüülpentüül-, 1-etüülbutüül-,
2-etüülbutüül-, 3-etüülbutüül-, 1,1-dimetüülbutüül-, 1,2-dimetüülbutüül-, 1,3-dimetüülbutüül-,
15
2,2-dimetüülbutüül-,
2,3-dimetüülbutüül-,
1-metüülheksüül-,
2-metüülheksüül-,
5-metüülheksüül-,
1,2-dimetüülpentüül-,
heksüül-,
1,3-dimetüülheksüül-,
3,3-dimetüülbutüül-,
3-metüülheksüül-,
4-metüülheksüül-,
1,3-dimetüülpentüül-,
3,3-dimetüülheksüül-,
1,2-dimetüül-
1,2-dimetüülheptüül-,
1,3-dimetüülheptüül- ja 3,3-dimetüülheptüülrühma.
"-(C1-C6)alküülrühm" tähendab hargnemata või hargnenud ahelaga mittetsüklilist
süsivesinikrühma, millel on 1-6 süsinikuaatomit. Tüüpilised hargnemata ahelaga
-(C1-C6)alküülrühmad hõlmavad metüül-, etüül-, n-propüül-, n-butüül-, n-pentüül20
ja
n-heksüülrühma.
hõlmavad
Tüüpilised
isopropüül-,
hargnenud
sec-butüül-,
ahelaga
isobutüül-,
-(C1-C6)alküülrühmad
tert-butüül-,
isopentüül-,
neopentüül-, 1-metüülbutüül-, 2-metüülbutüül-, 3-metüülbutüül-, 1,1-dimetüülpropüül-, 1,2-dimetüülpropüül-, 1-metüülpentüül-, 2-metüülpentüül-, 3-metüülpentüül-, 4-metüülpentüül-, 1-etüülbutüül-, 2-etüülbutüül-, 3-etüülbutüül-, 1,1-di25
metüülbutüül-,
1,2-dimetüülbutüül-,
1,3-dimetüülbutüül-,
2,2-dimetüülbutüül-,
2,3-dimetüülbutüül- ja 3,3-dimetüülbutüülrühma.
"-(C1-C4)alküülrühm" tähendab hargnemata või hargnenud ahelaga mittetsüklilist
süsivesinikrühma, millel on 1-4 süsinikuaatomit. Tüüpilised hargnemata ahelaga
-(C1-C4)alküülrühmad hõlmavad metüül-, etüül-, n-propüül- ja n-butüülrühma.
EE-EP 1 648 878 B1
183
Tüüpilised hargnenud ahelaga -(C1-C4)alküülrühmad hõlmavad isopropüül-, secbutüül-, isobutüül- ja tert-butüülrühma.
"-(C2-C10)alkenüülrühm"
tähendab
hargnemata
või
hargnenud
ahelaga
mittetsüklilist süsivesinikrühma, millel on 2-10 süsinikuaatomit ja mis sisaldab
5
vähemalt ühte süsinik-süsinik kaksiksidet. Tüüpilised hargnemata ja hargnenud
ahelaga
(C2-C10)alkenüülrühmad
hõlmavad
vinüül-,
allüül-,
1-butenüül-,
2-butenüül-, isobutüülenüül-, 1-pentenüül-, 2-pentenüül-, 3-metüül-1-butenüül-,
2-metüül-2-butenüül-,
2,3-dimetüül-2-butenüül-,
1-heksenüül-,
2-heksenüül-,
3-heksenüül-, 1-heptenüül-, 2-heptenüül-, 3-heptenüül-, 1-oktenüül-, 2-oktenüül-,
10
3-oktenüül-, 1-nonenüül-, 2-nonenüül-, 3-nonenüül-, 1-detsenüül-, 2-detsenüül-,
3-detsenüülrühma jms.
"-(C2-C6)alkenüülrühm"
tähendab
hargnemata
või
hargnenud
ahelaga
mittetsüklilist süsivesinikrühma, millel on 2-10 süsinikuaatomit ja mis sisaldab
vähemalt ühte süsinik-süsinik kaksiksidet. Tüüpilised hargnemata ja hargnenud
15
ahelaga (C2-C6)alkenüülrühmade näited hõlmavad vinüül-, allüül-, 1-butenüül-,
2-butenüül-, isobutüülenüül-, 1-pentenüül-, 2-pentenüül-, 3-methüül-1-butenüül-,
2-metüül-2-butenüül-,
2,3-dimetüül-2-butenüül-,
1-heksenüül-,
2-heksenüül-,
3-heksenüülrühma jms.
"-(C2-C10)alkünüülrühm"
20
tähendab
hargnemata
või
hargnenud
ahelaga
mittetsüklilist süsivesinikrühma, millel on 2-10 süsinikuaatomit ja mis sisaldab
vähemalt ühte süsinik-süsinik kolmiksidet. Tüüpilised hargnemata ja hargnenud
ahelaga
-(C2-C10)alkünüülrühmad
1-butünüül-,
4-pentünüül-,
25
2-butünüül-,
hõlmavad
1-pentünüül-,
1-heksünüül-,
atsetüülenüül-,
2-pentünüül-,
2-heksünüül-,
propünüül-,
3-metüül-1-butünüül-,
5-heksünüül-,
1-heptünüül-,
2-heptünüül-, 6-heptünüül-, 1-oktünüül-, 2-oktünüül-, 7-oktünüül-, 1-nonünüül-,
2-nonünüül-, 8-nonünüül-, 1-detsünüül-, 2-detsünüül-, 9-detsünüülrühma jms.
"-(C2-C6)alkünüülrühm"
tähendab
hargnemata
või
hargnenud
ahelaga
mittetsüklilist süsivesinikrühma, millel on 2-6 süsinikuaatomit ja mis sisaldab
vähemalt ühte süsinik-süsinik kolmiksidet. Tüüpilised hargnemata või hargnenud
EE-EP 1 648 878 B1
184
ahelaga
-(C2-C6)alkünüülrühmad
hõlmavad
atsetüülenüül-,
propünüül-,
1-butünüül-, 2-butünüül-, 1-pentünüül-, 2-pentünüül-, 3-methüül-1-butünüül-,
4-pentünüül-, 1-heksünüül-, 2-heksünüül-, 5-heksünüülrühma jms.
"-(C3-C10)tsükloalküülrühm" tähendab küllastunud tsüklilist süsivesinikrühma,
5
millel on 3-10 süsinikuaatomit. Tüüpilisteks -(C3-C10)tsükloalküülrühmadeks on
tsüklopropüül-,
tsüklobutüül-,
tsüklopentüül-,
tsükloheksüül-,
tsükloheptüül-,
tsüklooktüül-, tsüklononüül- ja tsüklodetsüülrühm.
"-(C3-C8)tsükloalküülrühm" tähendab küllastunud tsüklilist süsivesinikrühma, millel
on
10
3-8
süsinikuaatomit.
Tüüpilised
-(C3-C8)tsükloalküülrühmad
hõlmavad
tsüklopropüül-, tsüklobutüül-, tsüklopentüül-, tsükloheksüül-, tsükloheptüül- ja
tsüklooktüülrühma.
"-(C8-C14)bitsükloalküülrühm" tähendab bitsüklilist süsivesiniksüsteemi, millel on
8-14 süsinikuaatomit ja vähemalt üks küllastunud tsükliline alküülrühm. Tüüpilised
-(C8-C14)bitsükloalküülrühmad hõlmavad indanüül-, 1,2,3,4-tetrahüdronaftüül-,
15
5,6,7,8-tetrahüdronaftüül-, perhüdronaftüülrühma jms.
"-(C8-C14)tritsükloalküülrühm" tähendab tritsüklilist süsivesiniksüsteemi, millel on
8-14 süsinikuaatomit ja vähemalt üks küllastunud tsükkel. Tüüpilised -(C8-C14)tritsükloalküülrühmad
hõlmavad
perhüdroantratsenüül,
20
pürenüül,
atseantreneüül-,
1,2,3,4-tetrahüdroantratsenüül-,
1,2,3,4-tetrahüdropenantrenüül-,
5,6,7,8-tetrahüdrofenantrenüül-, perhüdrofenantrenüülrühma jms.
"-(C5-C10)tsükloakenüülrühm" tähendab tsüklilist mittearomaatset süsivesinikrühma, millel on tsüklilises süsteemis vähemalt üks süsinik-süsinik kaksikside ja
5-10
süsinikuaatomit.
Tüüpilised
-(C5-C10)tsükloalkenüülrühmad
hõlmavad
tsüklopentenüül-, tsüklopentadienüül-, tsükloheksenüül-, tsükloheksadienüül-,
25
tükloheptenüül-,
tsükloheptadienüül-,
tsükloheptatrienüül-,
tsüklooktenüül-,
tsüklooktadienüül-, tsüklooktatrienüül-, tsüklooktatetraenüül-, tsüklononenüül-,
tsüklononadienüül-, tsüklodetsenüül-, tsüklodekadienüülrühma jms.
EE-EP 1 648 878 B1
185
"-(C5-C8)tsükloakenüülrühm" tähendab tsüklilist mittearomaatset süsivesinikrühma, millel on tsüklilises süsteemis vähemalt üks süsinik-süsinik kaksikside ja
5-8 süsinikuaatomit. Tüüpilised -(C5-C8)tsükloalkenüülrühmad hõlmavad tsüklopentenüül-,
5
tsüklopentadienüül-,
tükloheptenüül-,
tsükloheksenüül-,
tsükloheptadienüül-,
tsükloheksadienüül-,
tsükloheptatrienüül-,
tsüklooktenüül-,
tsüklooktadienüül-, tsüklooktatrienüül-, tsüklooktatetraenüülrühma jms.
"-(C8-C14)bitsükloakenüülrühm" tähendab bitsüklilist süsivesiniksüsteemi, millel on
igas tsüklis vähemalt üks süsinik-süsinik kaksikside ja 8-14 süsinikuatomit.
Tüüpilised -(C8-C14)bitsükloalkenüülrühmad hõlmavad indenüül-, pentalenüül-,
10
naftalenüül-, asulenüül-, heptalenüül-, 1,2,7,8-tetrahüdronaftalenüülrühma jms.
"-(C8-C14)tritsükloakenüülrühm" tähendab tritsüklilist süsivesiniksüsteemi, millel
on igas tsüklis vähemalt üks süsinik-süsinik kaksikside ja 8-14 süsinikuaatomit.
Tüüpilised
-(C8-C14)tritsükloalkenüülrühmad
hõlmavad
antratsenüül-,
fenantrenüül-, fenalenüül-, atsenaftalenüül-, as-indatsenüül-, s-indatsenüülrühma
15
jms.
"-(3-7-lüliline)heterotsükkel" või "-(3-7-lüliline)heterotsükliline rühm" tähendab
3-7-lülilist
monotsüklilist
heterotsüklilist
rühma, mis
on kas küllastunud,
küllastumata, mittearomaatne või aromaatne. 3- või 4-lüliline heterotsükkel võib
sisaldada kuni 3 heteroaatomit, 5-lüliline heterotsükkel võib sisaldada kuni
20
4 heteroaatomit, 6-lüliline heterotsükkel võib sisaldada kuni 6 heteroaatomit ja
7-lüliline heterotsükkel võib sisadada kuni 7 heteroaatomit. Iga heteroaatom
valitakse sõltumatult lämmastiku, mis võib olla kvaternaarne, hapniku ja väävli,
sealhulgas sulfoksiidi ja sulfooni hulgast. -(3-7-lüliline)heteroarüülrühm võib olla
seotud
25
lämmastikuaatomi
-(3-7-lülilised)heteroarüülrühmad
või
süsinikuaatomi
hõlmavad
püridüül-,
kaudu.
Tüüpilised
furüül-,
tiofenüül-,
pürrolüül-, oksasolüül-, imidasolüül-, tiasolüül-, tiadiasolüül-, isoksasolüül-,
pürasolüül-, isotiasolüül-, püridasinüül-, pürimidinüül-, pürasinüül-, triasinüül-,
morfolinüül-,
pürrolidinonüül-,
pürrolidinüül-,
piperidinüül-,
piperasinüül-,
hüdantoinüül-, valerolaktamüül-, oksiranüül-, oksetanüül-, tetrahüdrofuranüül-,
EE-EP 1 648 878 B1
186
tetrahüdropüranüül-, tetrahüdropürindinüül-, tetrahüdropürimidinüül-, tetrahüdrotiofenüül-, tetrahüdrotiopüranüülrühma jms.
"-(3-5-lüliline)heterotsükkel" või "-(3-5-lüliline)heterotsükliline rühm" tähendab
3-5-lülilist
5
monotsüklilist
heterotsüklilist
rühma, mis
on kas küllastunud,
küllastumata, mittearomaatne või aromaatne. 3- või 4-lüliline heterotsükkel võib
sisaldada kuni 3 heteroaatomit ja 5-lüliline heterotsükkel võib sisaldada kuni 4
heteroaatomit. Iga heteroaatom valitakse sõltumatult lämmastiku, mis võib olla
kvaternaarne, hapniku ja väävli, sealhulgas sulfoksiidi ja sulfooni hulgast.
-(3-5-lüliline)heteroarüülrühm võib olla seotud lämmastikuaatomi või süsiniku-
10
aatomi kaudu. Tüüpilised -(3-5-lülilised)heteroarüülrühmad hõlmavad furüül-,
tiofenüül-,
pürrolüül-,
pürasolüül-,
oksasolüül-,
isotiasolüül-,
imidasolüül-,
triasinüül-,
tiasolüül-,
pürrolidinonüül-,
isoksasolüül-,
pürrolidinüül-,
hüdantoinüül-, oksiranüül-, oksetanüül-, tetrahüdrofuranüül-, tetrahüdrotiofenüülrühma jms.
15
"-(7-10-lüliline)bitsükloheterotsükkel"
või
"-(7-10-lüliline)bitsükloheterotsükliline
rühm" tähendab 7-10-lülilist bitsüklilist heterotsüklilist rühma, mis on kas
küllastunud, küllastumata, mittearomaatne või aromaatne. -(7-10-lüliline)bitsükloheterotsükkel sisaldab 1-4 heteroaatomit, mis valitakse sõltumatult
lämmastiku, mis võib olla kvaternaarne, hapniku ja väävli, sealhulgas sulfoksiidi ja
20
sulfooni
hulgast.
-(7-10-lüliline)bitsükloheterotsükkel
võib
lämmastikuaatomi või süsinikuaatomi kaudu. Tüüpilised
olla
seotud
-(7-10-lülilised)bi-
tsükloheterotsüklid hõlmavad kinolinüül-, isokinolinüül-, kromonüül-, kumarinüül-,
indolüül-,
indolisinüül-,
benso[b]furanüül-,
benso[b]tiofenüül-,
indasolüül-,
purinüül-, -4H-kinolisinüül-, isokinolüül-, kinolüül-, ftalasinüül-, naftüridinüül-,
25
karbasolüül-, β-karbolinüülrühma jms.
"-(C14)arüülrühm" tähendab 14-lülilist aromaatset karbotsüklilist rühma, nagu
antrüül- või fenantrüülrühm.
"-(5-10-lüliline)heteroarüülrühm" tähendab aromaatset 5-10-lülilist heterotsüklilist
rühma, mis sisaldab nii mono- kui ka bitsüklilist süsteemi, milles ühe või mõlema
EE-EP 1 648 878 B1
187
tsükli vähemalt üks süsinikuaatom on asendatud heteroaatomiga, mis on
sõltumatult valitud lämmastiku, hapniku ja väävli hulgast. Ühes teostuses sisaldab
üks
-(5-10-lülilisest)heteroarüültsüklitest
Järgmises
5
teostuses
sisaldavad
vähemalt
mõlemad
ühte
süsinikuaatomit.
-(5-10-lülilised)heteroarüültsüklid
vähemalt ühte süsinikuaatomit. Tüüpilised -(5-10-lülilised)heteroarüülrühmad
hõlmavad
püridüül-,
furüül-,
bensofuranüül-,
tiofenüül-,
bensotiofenüül-,
kinolinüül-, pürrolüül-, indolüül-, oksasolüül-, bensoksasolüül-, imidasolüül-,
bensimidasolüül-,
tiasolüül-,
bensotiasolüül-,
isoksasolüül-,
pürasolüül-,
isotiasolüül-, püridasinüül-, pürimidinüül-, pürasinüül-, triasinüül-, tsinnolinüül-,
10
ftalasinüül- ja kinasolinüülrühma.
"-CH2(halogeno)rühm"
tähendab
metüülrühma,
milles
üks
metüülrühma
vesinikuaatomitest on asendatud halogeeniga. Tüüpilised -CH2(halogeno)rühmad
hõlmavad -CH2F, -CH2Cl, -CH2Br ja -CH2I.
"-CH(halogeno)2rühm"
15
tähendab
metüülrühma,
milles
kaks
metüülrühma
vesinikuaatomitest on asendatud halogeeniga. Tüüpilised -CH(halogeno)2rühmad
hõlmavad -CHF2, -CHCl2, -CHBr2, -CHBrCl, -CHClI ja -CHI2.
"-C(halogeno)3rühm"
tähendab
metüülrühma,
milles
iga
metüülrühma
vesinikuaatom on asendatud halogeeniga. Tüüpilised -C(halogeno)3rühmad
hõlmavad -CF3, -CCl3, -CBr3 ja -CI3.
20
"Halogeen" või "halogenorühm" tähendab -F, -Cl, -Br või -I.
Termin "püridüülrühm" tähendab rühma
(R2)n
R1
N
,
EE-EP 1 648 878 B1
188
milles R1, R2 ja n on määratletud eespool piperidiiniühendite puhul.
Termin "pürasinüülrühm" tähendab rühma
(R2)p
N
N
R1
,
milles R1, R2 ja p on määratletud eespool piperidiiniühendite puhul.
5
Termin "pürimidinüülrühm" tähendab rühma
(R2)p
N
R1
N
,
milles R1, R2 ja p on määratletud eespool piperidiiniühendite puhul.
Termin "püridasinüülrühm" tähendab rühma
(R2)p
N
R1
N
,
10
milles R1, R2 ja p on määratletud eespool piperidiiniühendite puhul.
Termin "tiasanüülrühm" tähendab rühma
EE-EP 1 648 878 B1
189
N S
N
R1
,
milles R1 on määratletud eespool piperidiiniühendite puhul.
Termin “bensoimidasolüülrühm“ tähendab rühma
N
R8
5
NH
R9 ,
milles R8 ja R9 on määratletud eespool piperidiiniühendite puhul.
Termin “bensotiasolüülrühm“ tähendab rühma
N
R8
S
R9 ,
milles R8 ja R9 on määratletud eespool piperidiiniühendite puhul.
Termin “bensooksasolüülrühm“ tähendab rühma
EE-EP 1 648 878 B1
190
N
R8
O
R9 ,
milles R8 ja R9 on määratletud eespool piperidiiniühendite puhul.
Termin "loom" hõlmab lehma, ahvi, paaviani, šimpanssi, hobust, lammast, siga,
kana, kalkunit, vutti, kassi, koera, hiirt, rotti, küülikut, merisiga ja inimest.
5
Termin "farmatseutiliselt vastuvõetav sool" tähendab siin kasutatuna mis tahes
farmatseutiliselt vastuvõetavat soola, mille võib valmistada piperidiiniühendist,
sealhulgas soola mille võib valmistada piperidiiniühendite happelise ja aluselise
funktsionaalrühmaga, nagu lämmastikku sisaldav rühm. Soolade näited hõlmavad
sulfaat-, tsitraat-, atsetaat-, oksalaat-, kloriid-, bromiid-, jodiid-, nitraat-, bisulfaat-,
10
fosfaat-,
happefosfaat-,
isonikotinaat-,
laktaat-,
salitsülaat-,
happetsitraat-,
tartraat-, oleaat-, tannaat-, pantotenaat-, vesiniktartraat-, askorbaat-, suktsinaat-,
maleaat-, gentisinaat-, fumaraat-, glükonaat-, glükuronaat-, sahharaat-, formiaat-,
bensoaat-, glutamaat-, metaansulfonaat-, etaansulfonaat-, benseensulfonaat-,
p-tolueensulfonaat- ja pamoaatsooli (st 1,1’-metüleenbis(2-hüdroksü-3-naftoaat)).
15
Termin “farmatseutiliselt vastuvõetav sool” tähendab ka soola, mis on valmistatud
piperidiiniühendist, millel on happeline funktsionaalne rühm, nagu karboksüülhappe funktsionaalne rühm, ja farmatseutiliselt vastuvõetavast anorgaanilisest või
orgaanilisest alusest. Sobivad alused hõlmavad leelismetallide, nagu naatrium,
kaalium ja liitium, hüdroksiide, leelismuldmetallide, nagu kaltsium ja magneesium,
20
hüdroksiide, teiste metallide, nagu alumiinium ja tsink, hüdroksiide, ammoniaaki
ja orgaanilisi amiine, nagu asendamata või hüdroksüasendatud mono-, di- või
trialküülamiinid,
ditsükloheksüülamiin,
tributüülamiin,
püridiin,
N-metüül-N-
etüülamiin, dietüülamiin, trietüülamiin, mono-, bis- või tris(2-hüdroksü-madalam
alküül-amiinid), nagu mono-, bis- või tris(2-hüdroksüetüül)amiin, 2-hüdroksü-tert25
butüülamiin või tris(hüdroksümetüül)metüülamiin, N,N,-di-madalam alküül-N-
EE-EP 1 648 878 B1
191
(hüdroksü-madalam alküül)amiinid, nagu N,N-dimetüül-N-(2-hüdroksüetüül)amiin
või tri(2-hüdroksüetüül)amiin, N-metüül-D-glükamiin, ning aminohappeid, nagu
arginiin, lüsiin jms.
Termin “efektiivne kogus” tähendab piperidiiniühenditega seoses kasutatuna
5
efektiivset kogust (a) haigusseisundi ravimiseks või vältimiseks, või (b) VR1,
mGluR1 või mGluR5 funktsiooni inhibeerimiseks rakus.
Termin “efektiivne kogus” tähendab teiste raviainetega seoses kasutatuna kogust
raviaine terapeutilise toime saamiseks.
Kui esimene rühm on “asendatud ühe või enama” teise rühmaga, on üks või
10
enam
esimese
rühma
vesinikuaatomist
asendatud
vastava
arvu
teiste
rühmadega. Kui teiste rühmade arv on kaks või enam, võib iga teine rühm olla
sama või erinev. Ühes teostuses on teiste rühmade arv üks või kaks. Järgmises
teostuses on teiste rühmade arv üks.
Termin “THF” tähendab tetrahüdrofuraani.
15
Termin “DCM” tähendab diklorometaani.
Termin “DMF” tähendab dimetüülformamiidi.
Term “DAST” tähendab dietüülaminotrifluoroväävlit.
Termin “DMSO” tähendab dimetüülsulfoksiidi.
Termin “IBD” tähendab põletikulist soolehaigust.
20
Termin “IBS” tähendab ärritunud soole sündroomi.
EE-EP 1 648 878 B1
192
Termin “ALS” tähendab amüotroofilist lateraalskleroosi.
Termin
“ravi”
ja
“ravimine”
hõlmab
haigusseisundi
või
selle
sümptomi
leevendamist või kõrvaldamist.
Ravimine hõlmab inhibeerimist, näiteks haigusseisundi episoodide või selle
5
sümptomite sageduse üldist vähendamist.
Termin “vältima”, “vältimine” jms hõlmab haigusseisundi või selle sümptomi
tekkimise vältimist
4.6 PIPERIDIINIÜHENDITE VALMISTAMISE MEETODID
Piperidiiniühendeid võib valmistada tavalise orgaanilise sünteesiga või järgmiste
10
allpool skeemidel näidatud näidismeetoditega.
4.6.1 Piperidiiniühendite, milles X on O ja R4 on -OH, valmistamise meetodid
Piperidiiniühendid, milles X on O ja R4 on -OH, võib saada allpool skeemil 1
toodud illustreeriva meetodiga.
193
Skeem 1
EE-EP 1 648 878 B1
194
EE-EP 1 648 878 B1
milles R1, R2, R3, n, m ja p on määratletud eespool piperidiiniühendite puhul, R on
5
Ar2 või Ar3 ja X on halogeeniaatom.
Ühendi valemiga 2a-e lahusele tert-butüülliitiumi manulusel (1,7 M heptaanis,
6,45 ml, 11,12 mmooli) THF-s (20 ml) lisatakse temperatuuril -78 °C tilkhaaval
ühendit valemiga 1 veevabas THF-s (10 ml). Saadud reaktsioonisegu segatakse
temperatuuril -78 ºC umbes 3 tundi ja reaktsioon lõpetatakse NH4Cl vesilahuse
10
lisamisega temperatuuril umbes 0 ºC ning orgaaniline ning veekiht eraldatakse.
EE-EP 1 648 878 B1
195
Veekihti
ekstraheeritakse
THF-ga,
orgaanilised
kihid
ühendatakse
ning
ühendatud orgaanilised kihid kuivatatakse (Na2SO4). Saadud lahus kontsentreeritakse alarõhul, saades jäägi. Jääk puhastatakse kiirkromatograafiaga
silikageelkolonnis, elueerides etüülatsetaadi/heksaaniga (gradientelueerimine
5
30/70 kuni 70/30), saades piperidiiniühendi, milles X on O ja R4 on -OH (3a-e).
Ühendid valemiga 2a-e on kaubanduslikult saadaval või neid võib valmistada
vastava ala asjatundjatele tuntud meetoditega.
Ühendi valemiga a võib saada ühendi valemiga 4 viimisega reaktsiooni
isotsüanaadiga, nagu on näidatud allpool skeemil 2.
Skeem 2
10
milles R3 ja m on määratletud eespool piperidiiniühendite puhul ning R on Ar2 või
Ar3.
Isotsüanaadi
15
valemiga
R-NCO
lahusele
kloroformis
(30
ml)
lisatakse
temperatuuril umbes 25 oC ühend valemiga 4 (20 mmooli) kloroformis. Saadud
reaktsioonisegu segatakse temperatuuril umbes 25 ºC umbes 3 tundi. Seejärel
eemaldatakse lahusti alarõhul, saades jäägi. Jääk suspendeeritakse THF-s
(50 ml) ja saadud lahuselelisatakse 4 N HCl (50 ml) ning reaktsioonisegu
segatakse veel umbes 12 tundi. Seejärel valatakse reaktsioonisegu vette (200 ml)
20
ja pH reguleeritakse kaaliumkarbonaadi vesilahusega väärtusele üle 10. Saadud
lahust ekstraheeritakse etüülatsetaadiga ja etüülatsetaadi kihid ühendatakse ning
196
EE-EP 1 648 878 B1
kuivatatakse (MgSO4). Seejärel eemaldatakse lahusti alarõhul, saades jäägi,
mida
võib
puhastada
kiirkromatograafiaga
silikageelkolonnis,
elueerides
etüülatsetaadi/heksaaniga (gradientelueerimine 30/70 kuni 70/30), saades ühendi
valemiga 1.
5
Isotsüanaat valemiga R-NCO on kaubanduslikult saadaval või selle võib
valmistada amiini RNH2 viimisega reaktsiooni tuntud meetoditega fosgeeniga
(vt H. Eckert, B. Foster, Angew. Chem. Int. Ed. Engl., 1987, 26, 894; H. Eckert,
Ger. Offen. DE 3 440 141; Chem. Abstr., 1987, 106, 4294d; L. Contarca et al.,
Synthesis, 1996, 553-576). Amiini Ar2NH2 võib näiteks viia reaktsiooni
10
trifosgeeniga vastavalt allpool toodud skeemile.
Tavaliselt lisatakse trifosgeen lahus (umbes 0,3 ekv) DCM-s (umbes 0,3 M)
temperatuuril umbes 25 °C aeglaselt segatavale amiini (umbes 1,0 ekv) lahusele
DCM-s (umbes 0,3 M). Seejärel segatakse reaktsioonisegu temperatuuril umbes
15
25 °C umbes 10 minutit ja siis tõstetakse temperatuur umbes 70 °C-ni. Pärast
segamist temperatuuril umbes 70 °C umbes 3 tundi ja hutatakse reaktsioonisegu
temperatuurini umbes 25 °C, filtritakse ja filtraat kontsentreeritakse, saades
soovitud isotsüanaadi.
Ühendid valemiga 4 on kaubanduslikult saadaval või neid võib valmistada
20
vastava ala asjatundjatele tuntud meetoditega.
Piperidiiniühendid, milles X on O ja R4 on -OH, võib saada ka allpool skeemidel 3
ja 4 toodud illustreeriva meetodiga.
197
Skeem 3
5
EE-EP 1 648 878 B1
EE-EP 1 648 878 B1
198
milles R1, R2, R3, n, m ja p on määratletud eespool piperidiiniühendite puhul, X on
halogeeniaatom ja P on lämmastiku kaitserühm (vt T. W. Greene et al., Protective
Groups in Organic Synthesis, 1999, 3rd ed., 494-653).
5
Tert-BuLi (1,7 M heptaanis, 18,4 ml, 31,3 mmooli) või n-BuLi (1,6 M heptaanis,
19,5 ml, 31,3 mmooli) lahusele eetris (30 ml) lisatakse temperatuuril -78 ºC
lämmastikuatmosfääris tilkhaaval ühendi valemiga 2a-e (31,3 mmooli) lahus
eetris (20 ml). Saadud lahust segatakse temperatuuril -78 ºC umbes 1 tund.
Saadud lahusele lisatakse temperatuuril -78 ºC tilkhaaval eetris (20 ml)
10
lahustatud ühend valemiga 5 (25,0 mmooli) ja saadud segu segatakse
temperatuuril umbes -50 ºC 3 tundi. Seejärellõpetatakse reaktsioon NH4Cl
vesilahuse
lisamisega
temperatuuril
0
ºC
ja
saadud
reaktsioonisegu
ekstraheeritakse eetriga. Orgaanilised kihid ühendatakse, kuivatatakse (Na2SO4)
ja
15
kontsentreeritakse
alarõhul,
saades
jäägi,
mida
võib
puhastada
kiirkromatograafiaga silikageelkolonnis, elueerides etüülatsetaadi/heksaaniga
(gradientelueerimine 30/70 kuni 70/30), saades ühendi valemiga 6a-e. Seejärel
eemaldatakse lämmastiku kaitserühm, saades vastavalt ühendi valemiga 7a-e.
Seejärel viiakse ühend valemiga 7a-e reaktsiooni isotsüanaadiga valemiga
R-NCO,saades ühendi valemiga 3a-e, nagu on näidatud allpool skeemil 4.
20
EE-EP 1 648 878 B1
199
Skeem 4
(R2)n
N
OH
R-NCO
3a
R1
(R3)m
N
H
7a
(R2)p
N
N
OH
R-NCO
3b
R1
(R3)m
N
H
7b
(R2)p
N
N
OH
R-NCO
3c
R1
(R3)m
N
H
7c
EE-EP 1 648 878 B1
200
N
(R2)p
N
OH
R-NCO
3d
R1
(R3)m
N
H
7d
S
N
N
OH
R1
R-NCO
3e
(R3)m
N
H
7e
milles R1, R2, R3, n, m ja p on määratletud eespool piperidiiniühendite puhul, R on
Ar2 või Ar3 ja X on halogeeniaatom.
5
Ühendi valemiga 7a-e (1 mmooli) lahusele DCM-s (1 ml) lisatakse temperatuuril
umbes 25 °C tilkhaaval isotsüanaadi R-NCO (1 mmooli) lahus DCM-s (1 ml).
Saadud segu segatakse temperatuuril umbes 25 °C umbes 3 tundi. Seejärel
eemaldatakse lahusti alarõhul, saades jäägi, mida võib puhastada kiirkromatograafiaga
10
silikageelkolonnis,
elueerides
etüülatsetaadi/heksaaniga
(gradientelueerimine 10/90 kuni 70/30), saades ühendi valemiga 3a-e.
Ühend valemiga 5 on kaubanduslikult saadaval või selle võib valmistada ühendi
valemiga 8 lämmastikuaatomi kaitsmisega, nagu allpool on näidatud.
EE-EP 1 648 878 B1
201
O
(R3)m
N
H
8
.
Ühendid valemiga 8 on kaubanduslikult saadaval või neid võib valmistada
vastava ala asjatundjatele tuntud meetoditega.
Ühendi valemiga 8 lämmastikuaatomi kaitsmiseks võib kasutada mis tahes
5
vastava ala asjatundjatele tuntud lämmastiku kaitserühma. Sobivaid kaitserühmi
kirjeldatakse T. W. Greene et al. raamatus Protective Groups in Organic
Synthesis, 1999, 3rd ed., 494-653).
Isotsüanaadid valemiga R-NCO on kaubanduslikult saadaval või meid võib
valmistada, nagu eespoolon kirjeldatud.
10
4.6.2 Piperidiiniühendite, milles X on S ja R4 on -OH, valmistamise meetodid
Piperidiiniühendid, milles X on S ja R4 on -OH, võib valmistada meetodiga, mis on
analoogne sellega, mida on kirjeldatud skeemil 1 piperidiiniühendite, milles X on
O ja R4 on -OH (3a-e), saamisel, välja arvatud see, et ühendi valemiga 1 asemel
kasutatakse allpool toodud ühendit valemiga 9
O
(R3)m
N
S
NH
R
15
9
EE-EP 1 648 878 B1
202
milles R3 ja m on määratletud eespool piperidiiniühendite puhul ja R on Ar2 või
Ar3.
Ühendi valemiga 9 võib valmistada meetodiga, mis on analoogne sellega, mida
on kirjeldatud skeemil 2 ühendi valemiga 1 saamisel, välja arvatud see, et
5
isotsüanaadi R-NCO asemel kasutatakse isotiotsüanaati valemiga R-NCS.
Isotiotsüanaadid on kaubanduslikult saadaval või neid võib valmistada amiini
valemiga Ar2NH2 viimisega reaktsiooni tiofosgeeniga, nagu on näidatud allpool
toodud skeemil (vt Tett. Lett., 2000, 41 (37), 7207-7209; Org. Prep. Proced., Int.,
1991, 23 (6), 729-734; J. Heterocycle Chem., 1991, 28 (4), 1091-1097;
10
J. Fluorine Chem., 1988, 41 (3), 303-310; Tett. Lett., 2001, 42 (32), 5414-5416).
C(S)Cl2
R-NH2
R-NCS
.
Alternatiivselt võib isotiotsüanaadid valemiga R-NCS valmistada amiini valemiga
RNH2 viimisega reaktsiooni süsinikdisulfiidiga trietüülamiini manulusel THF-s,
millele järgneb viimine reakrtsiooni vesinikperoksiidi ja vesinikkloriidhappega
15
vees, nagu on näidatud allpool toodud skeemil (vt J. Org. Chem., 1997, 62 (13),
4539-4540).
.
Piperidiiniühendid, milles X on S ja R4 on -OH, võib valmistada meetodiga, mis on
analoogne sellega, mida on kirjeldatud skeemdel 3 ja 4 piperidiiniühendite, milles
20
X on O ja R4 on -OH (3a-e), saamisel, välja arvatud see, et isotsüanaadi valemiga
R-NCO asemel kasutatakse isotiotsüanaate valemiga R-NCS.
EE-EP 1 648 878 B1
203
4.6.3 Piperidiiniühendite, milles X on N-CN ja R4 on -OH, valmistamise
meetodid
Piperidiiniühendid, milles X on N-CN ja R4 on -OH, võib saada, nagu on näidatud
allpool skeemil 5.
Skeem 5
5
Ar1
OH
Ar1
OH
(R3)m
(R3)m
N
+
NC
N
N
RNH2
O
NC
N
NH
R
10
milles Ar1, R3 ja m on määratletud eespool piperidiiniühendite puhul ning R on Ar2
või Ar3.
Ühend valemiga 10 viiakse 0,5-24 tunniks reaktsiooni amiiniga valemiga R-NH2
10
aprotoonses orgaanilises lahustis, nagu dietüüleeter, di-n-propüüleeter, THF,
DCM või tolueen temperatuuril vahemikus 25 °C kuni lahusti tagasijooksutemperatuur, saades piperidiiniühendi, milles X on N-CN ja R4 on -OH. Ühes
teostuses on aprotoonseks lahustiks di-n-propüüleeter. Järgmises teostuses
kuumutatakse
15
reaktsioonisegu,
mis
koosneb
di-n-propüüleetrist,
ühendist
valemiga 10 ja amiinist valemiga R-NH2, temperatuuril 70-80 °C. Järgmises
teostuses kuumutatakse reaktsioonisegu, mis koosneb di-n-propüüleetrist,
EE-EP 1 648 878 B1
204
ühendist valemiga 10 ja amiinist valemiga R-NH2, temperatuuril umbes 75 °C
umbes 12 tundi.
Ühendi valemiga 10 võib saada, nagu on näidatud allpool skeemil 6:
Skeem 6
Ar1
OH
CN
(R3)m
N
7a-e
+
O
O
NC
N
O
10
5
milles Ar1 on määratletud eespool piperidiiniühendite puhul.
Ühend valemiga 7a-e viiakse reaktsiooni difenüültsüanokarbodiimidaadiga
(kaubanduslikult saadavalfirmast Sigma-Aldrich, St. Louis, MO (www.sigmaaldrich.com)) aprotoonses lahustis, nagu dietüüleeter, di-n-propüüleeter, THF,
10
DCM või tolueen, saades ühendi valemiga 10. Ühes teostuses on aprotoonseks
lahustiks DCM ja ühendit valemiga 7a-e ning difenüültsüanokarbodiimidaati
sisaldaval reaktsioonisegul lastakse reageerida temperatuuril umbes 25 °C.
Järgmises teostuses on aprotoonseks lahustiks tolueen ja ühendit valemiga 7a-e
ning
15
difenüültsüanokarbodiimidaati
sisaldaval
reaktsioonisegul
lastakse
reageerida temperatuuril umbes 110 °C. Ühendil valemiga 7a-e ja difenüültsüanokarbodiimidaadil
lastakse
tavaliselt
reageerida
0,5-24
tundi.
Tavaliselt
kasutatakse ühendit valemiga 10 täiendava puhastamiseta.
Ühendeid valemiga 7a-e võib saada, nagu on kirjeldatud eespool osas 4.6.1.
EE-EP 1 648 878 B1
205
4.6.4 Piperidiiniühendite, milles X on N-OH ja R4 on -OH, valmistamise
meetodid
Piperidiiniühendid, milles X on N-OH ja R4 on -OH, võib valmistada meetodiga,
mis on analoogne sellega, mida on kirjeldatud skeemil 1 piperidiiniühendite,
5
milles X on O ja R4 on -OH (3a-e), saamisel, välja arvatud see, et ühendi
valemiga 1 asemel kasutatakse allpool toodud ühendit valemiga 11
O
(R3)m
N
PO N
NH
R
11
milles R3 ja m on määratletud eespool piperidiiniühendite puhul, R on Ar2 või Ar3
10
ja P on hapniku kaitserühm, millele järgneb hapniku kaitserühma eemaldamine.
Ühendi valemiga 11 võib saada, nagu on näidatud allpool skeemil 7:
Skeem 7
206
EE-EP 1 648 878 B1
milles R3 ja m on määratletud eespool piperidiiniühendite puhul, R on Ar2 või Ar3
ja P on lämmastiku kaitserühm.
Ühend valemiga 12 (umbes 0,3 mmooli) viiakse reaktsiooni hüdroksüülamiiniga
(50% (massi järgi) vees, umbes 5,8 mmooli) umbes 1,5 ml etanoolis segamisega
5
temperatuuril umbes 80 °C umbes 2 tundi. Seejärel s egu kontsentreeritakse
alarõhul, saades ühendi valemiga 13. Seejärel kaitstakse ühendi valemiga 13
hüdroksüülrühm hapniku kaitserühmaga, saamaks ühendit valemiga 11. Ühendi
valemiga 13 hapnikuaatomi kaitsmiseks võib kasutada mis tahes vastava ala
asjatundjatele tuntud hapniku kaitserühma. Sobivaid hapniku kaitserühmi
10
kirjeldatakse T. W. Greene et al. raamatus Protective Groups in Organic
Synthesis, 1999, 3rd ed., 17-200). Ühes teostuses puhastatakse ühend valemiga
11 kolonnkromatograafia või ümberkristallimisega.
Ühendi valemiga 12 võib saada, nagu on näidatud allpool skeemil 8:
Skeem 8
15
milles R3 ja m on määratletud eespool piperidiiniühendite puhul ning R on Ar2 või
Ar3.
Eespool kirjeldatud viisil saadud ühendi valemiga 9 (umbes 0,6 mmooli) lahus
DCM-s viiakse reaktsiooni jodometaaniga (umbes 0,9 mmooli) umbes 3 ml
20
tetrahüdrofuraanis segamisega temperatuuril umbes 25 °C umbes 12 tundi.
EE-EP 1 648 878 B1
207
Jodometaani liig eemaldatakse segust alarõhul. Seejärel lisatakse segule
trietüülamiini (umbes 1,74 mmooli) lahus umbes 2,5 ml etüülatsetaadis ja segu
segatakse umbes 2 tundi. Seejärel segu kontsentreeritakse alarõhul, saades
ühendi valemiga 12, mille võib seejärel puhastada. Ühes teostuses puhastatakse
5
ühend valemiga 12 kolonnkromatograafia või ümberkristallimisega.
4.6.5 Piperidiiniühendite, milles X on N-OR10 ja R4 on -OH, valmistamise
meetodid
Piperidiiniühendid, milles X on N-OR10 ja R4 on -OH, võib valmistada meetodiga,
mis on analoogne sellega, mida on kirjeldatud skeemil 1 piperidiiniühendite,
10
milles X on O ja R4 on -OH (3a-e), saamisel, välja arvatud see, et ühendi
valemiga 1 asemel kasutatakse allpool toodud ühendit valemiga 14
O
(R3)
N
R10O N
NH
R
14
milles R3, R10 ja m on määratletud eespool piperidiiniühendite puhul ning R on Ar2
15
või Ar3.
Ühendi valemiga 14 võib valmistada ühendi valemiga 13, mis on saadud, nagu
näidatud eespool skeemil 7, viimisega reaktsiooni X-(C1-C4)alküülrühmaga, milles
X on -I, -Br, -Cl või -F, naatriumhüdriidi DMF-s manulusel temperatuuril umbes
25 °C. Ühes teostuses X on -I või -Br.
20
208
EE-EP 1 648 878 B1
4.6.6 Piperidiiniühendite, milles R4 on muu rühm kui -OH, valmistamise
meetodid
Piperidiiniühendid, milles R4 on halogenorühm, -OCF3, -(C1-C6)alküül-, -CH2OH,
-CH2Cl, -CH2Br, -CH2I, -CH2F, -CH(halogeno)2rühm, -CF3, -OR10, -SR13, -COOH,
5
-COOR10, -C(O)R10, -C(O)H, -OC(O)R10, -OC(O)NHR10, -NHC(O)R13, -SO2R10,
-CON(R13)2 või NO2, võib sada piperidiiniühenditest, milles R4 on -OH.
Piperidiiniühendid, milles R4 on -F, võib saada piperidiiniühendi, milles R4 on -OH,
viimisega reaktsiooni DAST-ga meetodiga,mida on kirjeldanud M. Schlosser et al.
ajakirjas Tetrahedron, 1996, 52 (24), 8257-62.
10
Piperidiiniühendid, milles R4 on -Cl, võib saada piperidiiniühendi, milles R4 on
-OH, viimisega reaktsiooni SOCl2 või PCl5-ga meetodiga, mida on kirjeldatud
ajakirjas J. Amer. Chem. Soc., 1998, 120 (4), 673-79 või CH3COCl-ga
meetodiga,mida on kirjeldatud ajakirjas Tett. Lett., 2000, 41 (47), 9037-42.
Piperidiiniühendid, milles R4 on -Br, võib saada piperidiiniühendi, milles R4 on
15
-OH, viimisega reaktsiooni püridiini ja SOBr2-ga meetodiga, mida on kirjeldatud
ajakirjas J. Organometallic Chemistry,2001, 627 (2), 179-88 või piperidiiniühendi,
milles R4 on -OH, viimisega reaktsiooni püridiini ja PPh3/Br2-ga meetodiga, mida
on kirjeldatud ajakirjas J. Amer. Chem. Soc., 1990, 112 (9), 3607-14.
Piperidiiniühendid, milles R4 on -I, võib saada piperidiiniühendi, milles R4 on -OH,
20
viimisega reaktsiooni HI-ga äädikhappe anhüdriidis meetodiga,mida on kirjeldatud
ajakirjas J. Amer. Chem. Soc., 1965, 87 (3), 539-542.
Piperidiiniühendid, milles R4 on -CH3, võib saada piperidiiniühendi, milles R4 on
-OH, viimisega reaktsiooni PCl5 ja CH3TiCl3-ga meetodiga, mida on kirjeldatud
ajakirjas Angewandte Chemie, 1980, 92 (11), 933-4.
EE-EP 1 648 878 B1
209
Piperidiiniühendid, milles R4 on -(C1-C6)alküülrühm, võib saada piperidiiniühendi,
milles R4 on -OH, viimisega reaktsiooni p-tolueensulfoonhappega tolueenis,
millele järgneb reaktsioon n-butüülliitiumi ja X-(C1-C6)alküülühendiga, milles X on
halogeen, meetodiga, mida on kirjeldanud Charles J. Barnett et al. ajakirjas
5
J.
Org.
Chem.,
1989,
54
(20),
4795-4800,
millele
järgneb
produkti
hüdrogeenimine meetodiga, mida on kirjeldanud Thomas E. D’Ambra et al.
ajakirjas J. Org. Chem., 1989, 54 (23), 5632-5, nagu on kirjeldatud allpool toodud
skeemil.
10
Piperidiiniühendid, milles R4 on -CH2OH, võib saada piperidiiniühendi, milles R4
on -COOH, viimisega reaktsiooni LiAlH4-ga vastava ala asjatundjatele tuntud
meetoditega. Piperidiiniühendid, milles R4 on -CH2OH, võib saada piperidiiniühendi, milles R4 on -C(O)H, viimisega reaktsiooni NaBH4-ga vastava ala
asjatundjatele tuntud meetoditega.
15
Piperidiiniühendid, milles R4 on -COOH, võib saada piperidiiniühendi, milles R4 on
-CN, viimisega reaktsiooni KOH-ga vastava ala asjatundjatele tuntud meetoditega.
Piperidiiniühendid, milles R4 on -CN, võib saada piperidiiniühendi, milles R4 on
-OH, viimisega reaktsiooni KCN ja SOCl2-ga meetodiga, mida on kirjeldatud
20
ajakirjas Armyanskii Khimicheskii Zhurnal., 1977, 30 (9) 723-7.
Piperidiiniühendid, milles R4 on -C(O)H, võib saada piperidiiniühendi, milles R4 on
-CN, viimisega reaktsiooni di-iso-butüülalumiinumhüdriidiga (DIBAL-H) vastava
ala asjatundjatele tuntud meetoditega.
EE-EP 1 648 878 B1
210
Piperidiiniühendid, milles R4 on -OCF3, võib saada piperidiiniühendi, milles R4 on
-OH, viimisega reaktsiooni CS2, metüüljodiidi ning bromosuktsiinimiidi ja
püridiini/HF-ga DCM-s meetodiga, mida on kirjeldatud ajakirjades Chemical
Communications (Cambridge), 1997, 3, 309-10 või Bulletin of the Chemical
5
Society of Japan, 2000, 73 (2), 471-484.
Piperidiiniühendid, milles R4 on -CH2Cl, võib saada eespool kirjeldatud viisil
valmistatud piperidiiniühendi, milles R4 on -CH2OH, viimisega reaktsiooni PCl5-ga
meetodiga, mida on kirjeldatud ajakirjas J. Amer. Chem. Soc., 1998, 120 (4),
673-9.
10
Piperidiiniühendid, milles R4 on -CH2OH, võib saada eespool kirjeldatud viisil
valmistatud piperidiiniühendi, milles R4 on -CH2OH, viimisega reaktsiooni
SOBr2-ga meetodiga, mida on kirjeldatud ajakirjas J. Organomet. Chem., 2001,
627 (2), 179-88, või viimisega reaktsiooni PPh3/Br2-ga meetodiga, mida on
kirjeldatud ajakirjas J. Amer. Chem. Soc., 1990, 112 (9), 3607-14.
15
Piperidiiniühendid, milles R4 on -CH2F, võib saada eespool kirjeldatud viisil
valmistatud piperidiiniühendi, milles R4 on -CH2OH, viimisega reaktsiooni 1
ekvivalendi DAST-ga meetodiga, mida on kirjeldanud M. Schlosser et al. ajakirjas
Tetrahedron, 1996, 52 (24), 8257-62 ja Organic Letters, 2001, 3 (17), 2713-15.
Piperidiiniühendid, milles R4 on -CH2I, võib saada eespool kirjeldatud viisil
20
valmistatud piperidiiniühendi, milles R4 on -CH2OH, viimisega reaktsiooni
PPh3/I2-ga meetodiga, mida on kirjeldatud ajakirjas Organic Process Research
and Development, 2002, 6 (2), 190-1.
Piperidiiniühendid, milles R4 on -CH(halogeno)2rühm, võib saada eespool
kirjeldatud viisil valmistatud piperidiiniühendi, milles R4 on -C(O)H, viimisega
25
reaktsiooni
(F3CSO2)2O-ga,millele
Mg(halogeno)2ühendiga
CS2-s
Synthesis, 1986, 12, 1076-8.
järgneb
meetodiga,
mida
viimine
on
reaktsiooni
kirjeldatud
ajakirjas
EE-EP 1 648 878 B1
211
Piperidiiniühendid, milles R4 on -CHF2, võib saada eespool kirjeldatud viisil
valmistatud piperidiiniühendi, milles R4 on -C(O)H, viimisega reaktsiooni 2
ekvivalendi DAST-ga meetodiga, mida on kirjeldanud M. Schlosser et al. ajakirjas
Tetrahedron, 1996, 52 (24), 8257-62 ja Organic Letters, 2001, 3 (17), 2713-15.
5
Piperidiiniühendid, milles R4 on -CF3, võib saada eespool kirjeldatud viisil
valmistatud piperidiiniühendi, milles R4 on -C(O)H, viimisega reaktsiooni
vask(I)jodiidi ja naatriumtrifluoroatsetaadiga meetodiga, mida on kirjeldatud US
patendis 4,866,197 (Bauman).
Piperidiiniühendid, milles R4 on -OR10, võib saada eespool kirjeldatud viisil
10
valmistatud piperidiiniühendi, milles R4 on -OH, viimisega reaktsiooni R10-X-ga,
milles X on halogeen, NaOH manulusel meetodiga,mida on kirjeldatud ajakirjas
European Journal of Medicinal Chemistry, 1989, 24 (4), 391-6.
Piperidiiniühendid, milles R4 on -SR13, võib saada eespool kirjeldatud viisil
valmistatud piperidiiniühendi, milles R4 on -OH, viimisega reaktsiooni R13-SH-ga
15
meetodiga, mida on kirjeldatud US patendis 4 409 229 (Ong et al.) või ajakirjas
Journal of Medicinal Chemistry, 1981, 24 (1), 74-9.
Piperidiiniühendid, milles R4 on -COOR10, võib saada eespool kirjeldatud viisil
valmistatud piperidiiniühendi, milles R4 on -COOH, esterdamisega R10-OH-ga.
Karboksüülhapete esterdamise meetodid on vastava ala asjatundjatele tuntud.
20
Piperidiiniühendid, milles R4 on -OC(O)R10, võib saada eespool kirjeldatud viisil
valmistatud
piperidiiniühendi,
milles
R4
on
-OH,
viimisega
reaktsiooni
R10C(O)Cl-ga meetodiga, mida on kirjeldatud ajakirjas European Journal of
Medicinal Chemistry, 1989, 24 (4), 391-6. Happekloriidid R10C(O)Cl võib
valmistada vastavast karboksüülhappest R10COOH vastava ala asjatundjatele
25
tuntud meetoditega.
212
EE-EP 1 648 878 B1
Piperidiiniühendid, milles R4 on -NHC(O)R13, võib saada piperidiiniühendi, milles
R4 on -OH, viimisega reaktsiooni R10CN-ga H2SO4 manulusel, millelejärgneb
viimine reaktsiooni K2CO3-ga DCM-s, nagu on kirjeldatud ajakirjas Bioorganic and
Medicinal Chemistry Letters, 2000, 10 (17), 2001-2014.
5
Piperidiiniühendid, milles R4 on -OC(O)NH2, võib saada piperidiiniühendi, milles
R4 on -OH, viimisega reaktsiooni Cl3CCONCO-ga DCM-s temperatuuril 0 °C
segamisega umbes 2 tundi, seejärel lisatakse saadud segule K2CO3 metanoolisvees ning saadud segu segatakse umbes 4 tundi temperatuuril 0 °C ja umbes
2 tundi temperatuuril umbes 25 °C meetodiga, mida on kirjeldanud Christopher P.
10
Holmes et al. ajakirjas J. Org. Chem., 1989, 54 (1), 98-108.
Piperidiiniühendid, milles R4 on -OC(O)NHR10, võib saada piperidiiniühendi,
milles R4 on -OH, viimisega reaktsiooni isotsüanaadiga valemiga R10NCO
kuumutamisega tagasijooksul THF-s umbes 24 tundi temperatuuril umbes 25 °C
meetodiga, mida on kirjeldanud Andre Hallot et al. ajakirjas J. Med. Chem., 1986,
15
29 (3), 369-75.
Piperidiiniühendid, milles R4 on -SO2R10, -NO2, -CN, -COR10, -COOR10 ja
CON(R13)2, võib valmistada allpool toodud illustreerivate meetoditega.
Ühend valemiga 15 viiakse reaktsiooni ühendiga valemiga 16a-e aluse manulusel
meetodiga, mida on kirjeldatud ajakirjades Journal of Heterocycle Chemistry,
20
1986, 23 (1), 73-75 või Organic Chemistry and Procedures International, 1996,
28 (4), 478-80, saades ühendi valemiga 17a-e, nagu on kirjeldatud allpool
skeemil 9.
213
Skeem 9
5
EE-EP 1 648 878 B1
214
EE-EP 1 648 878 B1
milles R1, R2, R3, n, m ja p on määratletud eespool piperidiiniphendite puhul, Y on
-SO2R10, -NO2, -CN, -COR10, -COOR10 või CON(R13)2 ja P on lämmastiku
kaitserühm.
5
Seejärel eemaldatakse lämmastiku kaitserühm ühendilt valemiga 17a-e, saades
ühendi valemiga 18a-e. Ühendi valemiga 15 lämmastiku kaitsmiseks võib
kasutada mis tahes vastava ala asjatundjatele tuntud lämmastiku kaitserühma.
Selleks, et saada piperidiiniühendeid valemiga (I), milles X on O ja R4 on
-SO2R10, -NO2, -CN, -COR10, -COOR10 või CON(R13)2, viiakse ühend valemiga
10
18a-e seejärel reaktsiooni isotsüanaadiga valemiga R-NCO meetodiga, mis on
analoogne eespool skeemil 4 kirjeldatuga ja mida kirjeldatakse allpool skeemil 10.
Skeem 10
215
5
EE-EP 1 648 878 B1
milles R1, R2, R3, n, m ja p on määratletud eespool piperidiiniphendite puhul, Y on
-SO2R10, -NO2, -COR10 või CON(R13)2 ja R on Ar2 või Ar3.
EE-EP 1 648 878 B1
216
Ühend valemiga 18a-e viiakse reaktsiooni ühendiga valemiga R-NCO meetodiga,
mis on analoogne skeemil 4 kirjeldatuga.
Selleks, et saada piperidiiniühendeid, milles X on S ja R4 on -SO2R10, -NO2, -CN,
-COR10, -COOR10 või CON(R13)2, viiakse ühend valemiga 18a-e reaktsiooni
5
isotiotsüanaadiga valemiga R-NCS meetodiga, mis on analoogne eespool osas
4.6.2 kirjeldatuga.
Selleks, et saada piperidiiniühendeid, milles X on N-CN ja R4 on -SO2R10, -NO2,
-CN, -COR10, -COOR10 või CON(R13)2, viiakse ühend valemiga 18a-e reaktsiooni
difenüültsüanokarbodiimidaadiga ja seejärel amiiniga valemiga R-NH2 meetodiga,
10
mis on analoogne eespool osas 4.6.3 kirjeldatuga.
Selleks, et saada piperidiiniühendeid, milles X on N-OH ja R4 on -SO2R10, -NO2,
-CN, -COR10, -COOR10 või CON(R13)2,viiakse piperidiiniühend, milles X on S ja
R4 on -SO2R10, -NO2, -CN, -COR10, -COOR10 ja CON(R13)2, reaktsiooni
metüüljodiidiga meetodiga, mis on analoogne eespool skeemil 8 kirjeldatuga,
15
saades ühendi valemiga 19
Ar1
Y
(R3)m
N
H3C S
N
R
19
milles Ar1, R3, m ja Y on määratletud eespool piperidiinühendite puhul ja R on Ar2
või Ar3.
EE-EP 1 648 878 B1
217
Seejärel viiakse ühend valemiga 19 reaktsiooni hüdroksüülamiiniga etanoolis
meetodiga, mis on analoogne eespool skeemil 8 kirjeldatuga, saades
piperidiiniühendi, milles X on N-OH ja R4 on -SO2R10, -NO2, -CN, -COR10,
-COOR10 või CON(R13)2.
5
Selleks, et saada piperidiiniühendeid, milles X on N-OR10 ja R4 on -SO2R10, -NO2,
-CN, -COR10, -COOR10 või CON(R13)2,viiakse piperidiiniühend, milles X on NOH
ja R4 on -SO2R10, -NO2, -CN, -COR10, -COOR10 ja CON(R13)2, reaktsiooni
X-(C1-C4)alküülühendiga, milles X on -I, -Br, -Cl või -F, trietüülamiini manulusel
meetodiga, mis on analoogne eespool osas 4.6.6 kirjeldatuga.
10
Ühend valemiga 15 on kaubanduslikult saadaval või selle võib valmistada
vastava ala asjatundjatele tuntud meetoditega.
Ühendid valemiga 16a-e, milles Y on -SO2R10, võib valmistada ühendi valemiga
16a-e, milles Y on halogeen, viimisega reaktsiooni R10SO2H-ga meetodiga, mida
on kirjeldatud ajakirjas J. Org. Chem., 2002, 67 (13),
15
4387-91 või rahvus-
vahelises publikatsioonis WO 02/48098.
Ühendid valemiga 16a-e, milles Y on -CN, võib valmistada ühendi valemiga
16a-e, milles Y on halogeen, viimisega reaktsiooni kaaliumtsüaniidiga meetodiga,
mida on kirjeldatud ajakirjas Farmaco, 1990, 45 (9), 945-53.
Ühendid valemiga 16a-e, milles Y on -COOR10, võib valmistada ühendi valemiga
20
16a-e, milles Y on halogeen, viimisega reaktsiooni (a) kaaliumtsüaniidi, (b) vee
ning (c) R10OH ja SO2Cl-ga meetodiga, mida on kirjeldatud ajakirjas Farmaco,
1990, 45 (9), 945-53.
Ühendid valemiga 16a-e, milles Y on -COR10, võib valmistada ühendi valemiga
16a-e, milles Y on halogeen, viimisega reaktsiooni R10C(O)H ja trimetüül25
silüültsüaniidiga meetodiga, mida on kirjeldatud rahvusvahelises publikatsioonis
WO 01/81333.
218
EE-EP 1 648 878 B1
Ühendid valemiga 16a-e, milles Y on -CON(R13)2, võib valmistada ühendi
valemiga 16a-e, milles Y on halogeen, viimisega reaktsiooni (a) kaaliumtsüaniidi,
(b) vee ning (c) NH(R13)2 ja SO2Cl-ga meetodiga, mida on kirjeldatud ajakirjas
Farmaco, 1990, 45 (9), 945-53.
5
Ühendid valemiga 16a-e, milles Y on -NO2, võib valmistada ühendi valemiga
2a-e, milles X on -CH3, viimisega reaktsiooni NaNH2-ga vedelas NH3-s ja seejärel
CH3CH2CH3-ONO2-ga temperatuuril alla -33 ºC, saades nitronaadi, mis seejärel
viiakse reaktsiooni happelistes tingimustes, saades ühendi 16a-e, milles Y on
-NO2, meetodiga, mida on kirjeldanud Henry Feuer et al. ajakirjas J. Am. Chem.
10
Soc., 1969, 91 (7), 1856-7 ning nagu on kirjeldatud allpool toodud skeemil:
milles R1, R2, n ja p on määratletud eespool piperidiiniühendite puhul.
EE-EP 1 648 878 B1
219
Ühendid valemiga 16a-e on kaubanduslikult saadaval või neid võib valmistada
vastava ala asjatundjatele tuntud meetoditega.
Teatud piperidiiniühenditel võib olla üks või mitu asümmeetrilist tsentrit ja seetõttu
eksisteerivad need erinevates enantiomeersetes ja diastereomeersetes vormides.
5
Piperidiiniühend võib olla optilise isomeeri või diastereomeeri vormis. Niisiis
käsitleb leiutis piperidiiniühendeid ja nende kasutamist, nagu siin on kirjeldatud,
nende optiliste isomeeride, diastereomeeride ja nende segude, sealhulgas
ratseemilise segu vormis. Piperidiiniühendite optilised isomeerid võib valmistada
tuntud meetoditega, nagu kiraalne kromatograafia või diastereomeersete soolade
10
moodustamine optiliselt aktiivsest happest või alusest.
Peale selle piperidiiniühendi ühe või enama vesiniku-, süsiniku või teise aatomi
asendada vesiniku-, süsiniku- või teise aatomi isotoobiga. Sellised ühendid, mis
kuuluvad samuti käesoleva leiutise ulatusse, on kasulikud teaduslike ja
diagnostiliste
15
vahenditena
metabolismi
farmakokineetilistes
uuringutes
ja
seondumiskatsetes.
4.7 PIPERIDIINIÜHENDITE TERAPEUTILISED KASUTUSED
Leiutise kohaselt manustatakse piperidiiniühendeid seda vajavale loomale
haigusseisundi ravimiseks või vältimiseks.
Ühes teostuses võib piperidiiniühendi efektiivset kogust kasutada ükskõik millise
20
haigusseisundi ravimiseks või vältimiseks, mis on ravitav või välditav VR1
inhibeerimisega. VR1 inhibeerimisega ravitavate või välditavate haigusseisundite
näited hõlmavad valu, UI-d, haavandit, IBD ja IBS-i.
Järgmises teostuses võib piperidiiniühendi efektiivset kogust kasutada ükskõik
millise haigusseisundi ravimiseks või vältimiseks, mis on ravitav või välditav
25
mGluR5 inhibeerimisega. mGluR5 inhibeerimisega ravitavate või välditavate
EE-EP 1 648 878 B1
220
haigusseisundite
näited
hõlmavad
valu,
sõltuvushäiret,
Parkinsoni
tõbe,
parkinsonismi, ärevust, kihelust ja psühhoosi.
Järgmises teostuses võib piperidiiniühendi efektiivset kogust kasutada ükskõik
millise haigusseisundi ravimiseks või vältimiseks, mis on ravitav või välditav
5
mGluR1 inhibeerimisega. mGluR1 inhibeerimisega ravitavate või välditavate
haigusseisundite näited hõlmavad valu, UI-d, sõltuvushäiret, Parkinsoni tõbe,
parkinsonismi, ärevust, epilepsiat, insulti, epileptilisi hooge, kihelust, psühhoosi,
kognitiivset häiret, mäluhäiret, ajutalitluse häiret, Huntingtoni koread, ALS-i,
dementsust, retinopaatiat, lihasspasme, migreeni, oksendamist, düskineesiat ja
10
depressiooni.
Piperidiiniühendeid võib kasutada ägeda või kroonilise valu ravimiseks või
vältimiseks. Piperidiiniühendite kasutamisega ravitava või välditava valu näited
hõlmavad,
kuid mitte
ainult,
vähivalu, sünnitusvalu,
müokardiinfarktivalu,
pankreasevalu, koolikuvalu, operatsioonijärgset valu, peavalu, lihasvalu, artriitilist
15
valu ja periodontaalse haigusega, sealhulgas gingiviidi ja periodontiidiga seotud
valu.
Piperidiiniühendeid võib kasutada ka põletiku või põletikulise haigusega seotud
valu inhibeerimiseks, ravimiseks või vältimiseks loomal. Sellist valu põhjustab
kehakudede põletik, mis võib olla paikne põletikureaktsioon ja/või süsteemne
20
põletik. Piperidiiniühendeid võib kasutada näiteks põletikuliste haigustega
kaasneva valu, sealhulgas transplanteeritud elundi hülgamisreaksiooni, elundi
transplanteerimisest, sealhulgas, kuid mitte ainult, südame, kopsu, maksa või
neeru transplanteerimisest, põhjustatud reoksügeenimiskahjustuse (vt Grupp et
al., J. Mol. Cell Cardiol., 1999, 31, 297-303), liigeste krooniliste põletikuliste
25
haiguste, sealhulgas artriidi, reumatoidartriidi, osteoartriidi ja luu suurenenud
resorptsiooniga seotud luuhaiguste, põletikuliste soolehaiguste, nagu ileiit,
haavandiline koliit, Barreti sündroom ja Crohni tõbi, põletikuliste kopsuhaiguste,
nagu astma, täiskasvanu respiratoorse distressi sündroom ja krooniline
obstruktiivne hingamisteede haigus, silma põletikuliste haiguste, nagu sarvkesta
30
düstroofia, trahhoom, onkotserkiaas, uveiit, sümpaatiline oftalmiit ja endoftalmiit,
EE-EP 1 648 878 B1
221
igemete
krooniliste
põletikuliste
haiguste,
nagu
gingiviit
ja
periodontiit,
tuberkuloosi, leepra, neerude põletikulisted haiguste, sealhulgas ureemiliste
komplikatsioonide, glomerulonefriidi ja nefroosi, naha põletikuliste haiguste,
sealhulgas sklerodermatiidi, psoriaasi ja ekseemi, kesknärvisüsteemi põletikuliste
5
haiguste, sealhulgas närvisüsteemi krooniliste demüeliniseerivate haiguste,
hulgiskleroosi, AIDS-iga seotud neurodegeneratsiooni ja Alzheimeri tõve,
nakkusliku meningiidi, entsefalomüeliidi, Parkinsoni tõve, Huntingtoni tõve,
amüotroofilise lateraalskleroosi ja viirusliku või autoimmuunse entsefaliidi,
autoimmuunhaiguste, nagu I ja II tüüpi diabeet, diabeetiliste komplikatsioonide,
10
sealhulgas diabeetilise katarakti, glaukoomi, retinopaatia, nefropaatia (nagu
mikroalbuminuuria ja progresseeruv diabeetiline nefropaatia), polüneuropaatia,
mononeuropaatiate, autonoomse neuropaatia, jalgade gangreeni, aterosklerootilise pärgarteritõve, perifeersete arterite haiguse, mitteketootilise hüperglükeemilise, hüperosmolaarse kooma, jalahaavandite, liigeseprobleemide ja
15
naha või limaskesta komplikatsioonide (nagu nakkus, laigud jalasäärtel, Candida
nakkus või diabeetikute lipoidne nekrobioos), immuunkompleksi vahendatud
vaskuliidi ning süsteemse erütematoosluupuse (SLE), südame põletikuliste
haiguste, nagu kardiomüopaatia, südame isheemiatõbi, hüperkolesteroleemia ja
ateroskleroos, samuti mitmesuguste muude haigustega, millel võivad olla olulised
20
põletikulised komponendid, sealhulgas preeklampsia, krooniline maksapuudulikkuse, aju- ja seljaajutrauma, ning vähiga kaasneva valu ravimiseks või vältimiseks. Piperidiiniühendeid võib kasutada ka sellise valu inhibeerimiseks,
ravimiseks või vältimiseks, mis on seotud põletikulise haigusega, milleks võib olla
näiteks organismi süsteemne põletik, mille näideteks on grampositiivne või
25
gramnegatiivne šokk, hemorraagiline või anafülaktiline šokk või vähi keemiaravist
tingitud šokk vastuseks põletikueelsetele tsütokiinidele, näiteks põletikueelsete
tsütokiinidega seotud šokk. Selline šokk võib olla põhjustatud näiteks vähi
ravimiseks manustatavast kemoterapeutikumist.
Piperidiiniühendeid võib kasutada UI ravimiseks või vältimiseks. Piperidiini30
ühendite
kasutamisega
ravitava
või
välditava
UI
näited
hõlmavad
sundinkontinentsi, rõhkinkontinentsi, ülevooluinkontinentsi, neurogeenset põit ja
täielikku inkontinentsi.
EE-EP 1 648 878 B1
222
Piperidiiniühendeid
võib
kasutada
haavandi
ravimiseks
või
vältimiseks.
Piperidiiniühendite kasutamisega ravitavate või välditavate haavandite näited
hõlmavad kaksteistsõrmikuhaavandit, maohaavandit, marginaalset haavandit,
söögitoruhaavandit või stresshaavandit.
5
Piperidiiniühendeid võib kasutada IBD, sealhulgas Crohni tõve ja haavandilise
koliidi, ravimiseks või vältimiseks.
Piperidiiniühendeid
võib
kasutada
IBS-i
ravimiseks
või
vältimiseks.
Piperidiiniühendite kasutamisega ravitava või välditava IBS-i näited hõlmavad
spastilise käärsoole tüüpi IBS-i ja valdavalt kõhukinnisusega IBS-i.
10
Piperidiiniühendeid
impulsikontrolli
võib
häire,
kasutada
alkoholiga
sõltuvushäire,
seotud
häire,
sealhulgas
nikotiiniga
söömishäire,
seotud
häire,
amfetamiiniga seotud häire, kanepiga seotud häire, kokaiiniga seotud häire,
hallutsinogeeniga seotud häire, inhaleeritava ainega seotud häirete ja opiaatidega
seotud häire, mis kõik jagatakse veel alarühmadesse, nagu allpool kirjeldatud,
15
ravimiseks või vältimiseks.
Söömishäired hõlmavad psüühilist buliimiat (bulimia nervosa), mitteväljutavat
tüüpi ja väljutavat tüüpi buliimiat, anoreksiat ja teisiti täpsustamata (TTta)
söömishäiret.
Impulsikontrolli
20
häired
hõlmavad
episoodilist
impulsiivset
käitumist,
kleptomaaniat, püromaaniat, haiguslikku hasartmängurlust, trihhotillomaaniat ja
teisiti täpsustamata (TTta) impulsikontrolli häiret.
Alkoholiga seotud häired hõlmavad alkoholist põhjustatud psühhootilist häiret
meelepetetega,
võõrutusnähte,
25
alkoholi
kuritarvitamist,
alkoholimürgistuse
deliiriumi,
alkoholimürgistust,
alkoholi
alkoholivõõrutuse
deliiriumi,
alkoholist põhjustatud püsivat dementsust, alkoholist põhjustatud püsivat
amnestilist häiret, alkoholisõltuvust, alkoholist põhjustatud psühhootilist häiret
EE-EP 1 648 878 B1
223
hallutsinatsioonidega, alkoholist põhjustatud meeleoluhäiret, alkoholist põhjustatud ärevushäiret, alkoholist põhjustatud seksuaalset düsfunktsiooni, alkoholist
põhjustatud unehäiret ja teisiti täpsustamata (TTta) alkoholiga seotud häiret.
Nikotiiniga seotud häired hõlmavad nikotiinisõltuvust, nikotiini võõrutusnähte ja
5
teisiti täpsustamata (TTta) nikotiiniga seotud häiret.
Amfetamiiniga
seotud
häired
hõlmavad
amfetamiinisõltuvust,
amfetamiini
kuritarvitamist, amfetamiinimürgistust, amfetamiini võõrutusnähte, amfetamiinimürgistuse deliiriumi, amfetamiinist põhjustatud psühhootilist häiret meelepetetega, amfetamiinist põhjustatud psühhootilist häiret hallutsinatsioonidega,
10
amfetamiinist põhjustatud meeleoluhäiret, amfetamiinist põhjustatud ärevushäiret,
amfetamiinist põhjustatud seksuaalset düsfunktsiooni, amfetamiinist põhjustatud
unehäiret ja teisiti täpsustamata (TTta) amfetamiiniga seotud häiret.
Kanepiga seotud häired hõlmavad kanepisõltuvust, kanepi kuritarvitamist,
kanepimürgistust, kanepimürgistuse deliiriumi, kanepist põhjustatud psühhootilist
15
häiret meelepetetega, kanepist põhjustatud psühhootilist häiret hallutsinatsioonidega, kanepist põhjustatud ärevushäiret ja teisiti täpsustamata (TTta)
kanepiga seotud häiret.
Kokaiiniga seotud häired hõlmavad kokaiinisõltuvust, kokaiini kuritarvitamist,
kokaiinimürgistust, kokaiini võõrutusnähte, kokaiinimürgistuse deliiriumi, kokaiinist
20
põhjustatud psühhootilist häiret meelepetetega, kokaiinist põhjustatud psühhootilist häiret hallutsinatsioonidega, kokaiinist põhjustatud meeleoluhäiret, kokaiinist
põhjustatud ärevushäiret, kokaiinist põhjustatud seksuaalset düsfunktsiooni,
kokaiinist põhjustatud unehäiret ja teisiti täpsustamata (TTta) kokaiiniga seotud
häiret.
25
Hallutsinogeeniga seotud häired hõlmavad hallutsinogeenisõltuvust, hallutsinogeeni kuritarvitamist, hallutsinogeenimürgistust, hallutsinogeeni võõrutusnähte,
hallutsinogeenimürgistuse
deliiriumi,
hallutsinogeenist
põhjustatud
püsivat
EE-EP 1 648 878 B1
224
tajuhäiret
(mälupetted),
hallutsinogeenist
põhjustatud
psühhootilist
häiret
meelepetetega, hallutsinogeenist põhjustatud psühhootilist häiret hallutsinat-
5
sioonidega,
hallutsinogeenist
põhjustatud
ärevushäiret,
põhjustatud
meeleoluhäiret,
hallutsinogeenist
hallutsinogeenist
põhjustatud
seksuaalset
düsfunktsiooni, hallutsinogeenist põhjustatud unehäiret ja teisiti täpsustamata
(TTta) hallutsinogeeniga seotud häiret.
Inhaleeritava ainega seotud häired hõlmavad inhaleeritava aine sõltuvust,
inhaleeritava aine kuritarvitamist, inhaleeritava aine mürgistust, inhaleeritava aine
mürgistuse deliiriumi, inhaleeritavast ainest põhjustatud psühhootilist häiret
10
meelepetetega,
inhaleeritavast
ainest
põhjustatud
psühhootilist
häiret
hallutsinatsioonidega, inhaleeritavast ainest põhjustatud ärevushäiret ja teisiti
täpsustamata (TTta) inhaleeritava ainega seotud häiret.
Opiaatidega seotud häired hõlmavad opiaadisõltuvust, opiaadi kuritarvitamist,
opiaadi võõrutusnähte, opiaadimürgistust, opiaadimürgistuse deliiriumi, opiaadist
15
põhjustatud
psühhootilist
häiret
meelepetetega,
opiaadist
põhjustatud
psühhootilist häiret hallutsinatsioonidega, opiaadist põhjustatud ärevushäiret ja
teisiti täpsustamata (TTta) opioaadiga seotud häiret.
Piperidiiniühendeid võib kasutada Parkinsoni tõve ja parkinsonismi ning
Parkinsoni tõve ja parkinsonismiga seotud sümptomite, sealhulgas bradükineesi,
20
lihasjäikuse, puhkeseisundi värina ja püstipüsimise häire, ravimiseks või
vältimiseks.
Piperidiiniühendeid võib kasutada generaliseerunud ärevushäire või tõsise
ärevuse
25
ja
ärevusega
tahhükardia,
düspnoe,
depressiooni,
seotud
sümptomite,
depressiooni,
paanikahäire,
sealhulgas
sealhulgas
agorafoobia
ja
rahutuse,
kroonilise
muude
söömishäirete ja isiksushäirete, ravimiseks või vältimiseks.
pinge,
“neurootilise”
spetsiifiliste
foobiate,
EE-EP 1 648 878 B1
225
Piperidiiniühendeid võib kasutada epilepsia, sealhulgas partsiaalsete epileptiliste
hoogude,
generaliseerunud
epileptiliste
hoogude,
ja
epilepsiaga
seotud
sümptomite, sealhulgas, kuid mitte ainult, lihtsate partsiaalsete hoogude,
Jacksoni epilepsia, komplekssete partsiaalsete (psühhomotoorsete) hoogude,
5
krampidega hoogude (grand mal või toonilis-kloonilised hood), petit mal
(absaans) hood ning epileptilise staatuse, ravimiseks või vältimiseks.
Piperidiiniühendeid võib kasutada insultide, sealhulgas isheemiliste insultide ja
hemorraagiliste insultide, ravimiseks või vältimiseks.
Piperidiiniühendeid võib kasutada krampide, sealhulgas infantiilsete spasmide,
10
febriilsete krampide ja epileptiliste hoogude, ravimiseks või vältimiseks.
Piperidiiniühendeid
võib
kasutada
kiheluse,
sealhulgas
kuivast
nahast,
sügelistest, dermatiidist, herpetiformsest, atoopilisest dermatiidist, tupe- ja
15
pärakukihelusest,
higivilliklööbest,
kontaktdermatiidist,
ravimireaktsioonidest,
nõgestõvetaolistest
löövetest,
putukahammustustest,
psoriaasist,
nõgestõvest,
punasest
täitõvest,
raseduseaegsest
lihhenist,
kroonilisest
lihtlihhenist, eksfoliatiivsest dermatiidist, follikuliidist, villilisest pemfigoidist või
klaaskiu dermatiidist põhjustatud kiheluse ravimiseks või vältimiseks.
Piperidiiniühendeid võib kasutada psühhoosi, sealhulgas skisofreenia, sealhulgas
paranoidse
20
katatoonse
skisofreenia,
skisofreenia,
hebefreense
või
desorganiseeritud
diferentseerumata
skisofreenia,
skisofreenia,
negatiivsete
sümptomitega või defitsiitse skisofreenia ja mittedefitsiitse skisofreenia, luulude,
sealhulgas erotomaanset tüüpi luulu, suurusluulu, kiivusluulu, jälitusluulu ja
somaatilise luulu, ning lühiajalise psühhoosi, ravimiseks või vältimiseks.
Piperidiiniühendeid võib kasutada kognitiivse häire, sealhulgas deliiriumi ja
25
dementsuse, nagu multiinfarktne dementsus, poksija dementsus, AIDSist
põhjustatud dementsus ja Alzheimeri tõvest põhjustatud dementsus, ravimiseks
või vältimiseks.
EE-EP 1 648 878 B1
226
Piperidiiniühendeid
võib
kasutada
mäluhäire,
sealhulgas
dissotsiatsiivse
amneesia ja dissotsiatiivse fuuga, ravimiseks või vältimiseks.
Piperidiiniühendeid võib kasutada ajutalitluse häire, sealhulgas sellise, mis on
põhjustatud kirurgiast või elundi transplantatsioonist, ajuverevarustuse häirest,
5
seljaajuvigastustest,
peavigastusest,
hüpoksiast,
südameseiskumisest
või
hüpoglükeemiast, ravimiseks või vältimiseks.
Piperidiiniühendeid võib kasutada Huntingtoni korea ravimiseks või vältimiseks.
Piperidiiniühendeid võib kasutada ALS-i ravimiseks või vältimiseks.
Piperidiiniühendeid võib kasutada retinopaatia, sealhulgas arteriosklerootilise
10
retinopaatia,
retinopaatia,
diabeetilise
arteriosklerootilise
mitteproliferatiivse
retinopaatia
retinopaatia,
ja
proliferatiivse
hüpertensiivse
retinopaatia,
ravimiseks või vältimiseks.
Piperidiiniühendeid võib kasutada lihasspasmide ravimiseks või vältimiseks.
Piperidiiniühendeid võib kasutada migreeni ravimiseks või vältimiseks.
15
Piperidiiniühendeid võib kasutada oksendamise, sealhulgas iiveldusoksendamise,
kuiva oksendamise (öökimise) ja regurgitatsiooni, ravimiseks või vältimiseks.
Piperidiiniühendeid võib kasutada düskineesia, sealhulgas tardiivdüskineesia ja
sapiteede düskineesia ravimiseks või vältimiseks.
Piperidiiniühendeid võib kasutada depressiooni, sealhulgas raske depressiooni ja
20
bipolaarse häire ravimiseks või vältimiseks.
Taotlejad arvavad, et piperidiiniühendid on VR1 antagonistid.
227
EE-EP 1 648 878 B1
Leiutis käsitleb veel in vitro meetodeid VR1 funktsiooni inhibeerimiseks rakus, mis
hõlmavad VR1 ekspresseerima võimelise raku kokkuviimist piperidiiniühendi
efektiivse kogusega. Seda meetodit võib rakendada in vitro näiteks testina VR1
ekspresseerivate rakkude selekteerimiseks, ning seega on see kasulik osana
5
testist, et valida valu, UI, haavandi, IBD või IBS-i ravimiseks või vältimiseks
kasulikke ühendeid. Leiutises kirjeldatakse ka meetodit VR1 funktsiooni
inhibeerimiseks in vivo looma rakus, ühes teostuses inimese rakus, looma raku
kokkuviimisega piperidiiniühendi efektiivse kogusega.Kirjeldatakse ka, et meetod
on kasulik valu ravimiseks või vältimiseks loomal. Järgmises teostuses on meetod
10
on kasulik UI ravimiseks või vältimiseks loomal. Kirjeldatakse ka, et meetod on
kasulik haavandi ravimiseks või vältimiseks loomal. Kirjeldatakse ka, et meetod
on kasulik IBD ravimiseks või vältimiseks loomal. Kirjeldatakse ka, et meetod on
kasulik IBS-i ravimiseks või vältimiseks loomal.
VR1 ekspresseerima võimelisi rakke sisaldava koe näited hõlmavad närvi-, aju-,
15
neeru-, kuseteede epiteelkude ja põiekude. VR1 ekspresseerivate rakkude
testimise meetodid on tehnika tasemest tuntud.
Taotlejad arvavad, et piperidiiniühendid on mGluR5 antagonistid.
Kirjeldatakse
meetodeid
mGluR5
funktsiooni
inhibeerimiseks
rakus,
mis
hõlmavad mGluR5 ekspresseerima võimelise raku kokkuviimist piperidiiniühendi
20
kogusega, mis on efektiivne mGluR5 funktsiooni inhibeerimiseks rakus. Seda
meetodit võib rakendada in vitro näiteks testina mGluR5 ekspresseerivate
rakkude selekteerimiseks, ning seega on see kasulik osana testist, et valida valu,
sõltuvushäire, Parkinsoni tõve, parkinsonismi, ärevuse, kiheluse või psühhoosi
ravimiseks või vältimiseks kasulikke ühendeid. Meetod on kasulik ka mGluR5
25
funktsiooni inhibeerimiseks in vivo looma rakus, ühes teostuses inimese rakus,
looma raku kokkuviimisega piperidiiniühendi kogusega, mis on efektiivne mGluR5
funktsiooni inhibeerimiseks rakus.
Kirjeldatakse ka, et meetod on kasulik valu ravimiseks või vältimiseks seda
vajaval loomal. Kirjeldatakse ka, et meetod on kasulik sõltuvushäire ravimiseks
EE-EP 1 648 878 B1
228
või vältimiseks seda vajaval loomal. Kirjeldatakse ka, et meetod on kasulik
Parkinsoni tõve ravimiseks või vältimiseks seda vajaval loomal. Kirjeldatakse ka,
et meetod on kasulik parkinsonismi ravimiseks või vältimiseks seda vajaval
loomal. Kirjeldatakse ka, et meetod on kasulik ärevuse ravimiseks või vältimiseks
5
seda vajaval loomal. Kirjeldatakse ka, et meetod on kasulik kiheluse ravimiseks
või vältimiseks seda vajaval loomal. Kirjeldatakse ka, et meetod on kasulik
psühhoosi ravimiseks või vältimiseks seda vajaval loomal.
mGluR5 ekspresseerima võimeliste rakkude näideteks on närvi- ja gliiarakud
kesknärvisüsteemis, eriti ajus, eriti nucleus accumbens’is. mGluR5 ekspres10
seerivate rakkude testimise meetodid on tehnika tasemest tuntud.
Taotlejad arvavad, et piperidiiniühendid on mGluR1 antagonistid.
Kirjeldatakse
meetodeid
mGluR1
funktsiooni
inhibeerimiseks
rakus,
mis
hõlmavad mGluR1 ekspresseerima võimelise raku kokkuviimist piperidiiniühendi
kogusega, mis on efektiivne mGluR1 funktsiooni inhibeerimiseks rakus. Seda
15
meetodit võib rakendada in vitro, näiteks testina mGluR1 ekspresseerivate
rakkude selekteerimiseks, ning seega on see kasulik osana testist, et
selekteerida valu, UI, sõltuvushäire, Parkinsoni tõve, parkinsonismi, ärevuse,
epilepsia, insuldi, krampide, kiheluse, psühhoosi, kognitiivse häire, mäluhäire,
ajutalitluse
20
häire,
Huntingtoni
korea,
ALS-i,
dementsuse,
retinopaatia,
lihasspasmide, migreeni, oksendamise, düskineesia või depressiooni ravimiseks
või vältimiseks kasulikke ühendeid. Meetod on kasulik ka mGluR1 funktsiooni
inhibeerimiseks in vivo looma rakus, ühes teostuses inimese rakus, looma raku
kokkuviimisega piperidiiniühendi kogusega, mis on efektiivne mGluR1 funktsiooni
inhibeerimiseks rakus. Kirjeldatakse ka, et meetod on kasulik valu ravimiseks või
25
vältimiseks seda vajaval loomal. Kirjeldatakse ka, et meetod on kasulik UI
ravimiseks või vältimiseks seda vajaval loomal. Kirjeldatakse ka, et meetod on
kasulik
sõltuvushäire
ravimiseks
või
vältimiseks
seda
vajaval
loomal.
Kirjeldatakse ka, et meetod on kasulik Parkinsoni tõve ravimiseks või vältimiseks
seda vajaval loomal. Kirjeldatakse ka, et meetod on kasulik parkinsonismi
30
ravimiseks või vältimiseks seda vajaval loomal. Kirjeldatakse ka, et meetod on
229
EE-EP 1 648 878 B1
kasulik ärevuse ravimiseks või vältimiseks seda vajaval loomal. Kirjeldatakse ka,
et meetod on kasulik epilepsia ravimiseks või vältimiseks seda vajaval loomal.
Kirjeldatakse ka, et meetod on kasulik insuldi ravimiseks või vältimiseks seda
vajaval loomal. Kirjeldatakse ka, et meetod on kasulik epilepsiahoo ravimiseks või
5
vältimiseks seda vajaval loomal. Kirjeldatakse ka, et meetod on kasulik kiheluse
ravimiseks või vältimiseks seda vajaval loomal. Kirjeldatakse ka, et meetod on
kasulik psühhoosi ravimiseks või vältimiseks seda vajaval loomal. Kirjeldatakse
ka, et meetod on kasulik kognitiivse häire ravimiseks või vältimiseks seda vajaval
loomal. Kirjeldatakse ka, et meetod on kasulik mäluhäire ravimiseks või
10
vältimiseks seda vajaval loomal. Kirjeldatakse ka, et meetod on kasulik ajutalitluse häire ravimiseks või vältimiseks seda vajaval loomal. Kirjeldatakse ka, et
meetod on kasulik Huntingtoni korea ravimiseks või vältimiseks seda vajaval
loomal. Kirjeldatakse ka, et meetod on kasulik ALS-i ravimiseks või vältimiseks
seda vajaval loomal. Kirjeldatakse ka, et meetod on kasulik dementsuse
15
ravimiseks või vältimiseks seda vajaval loomal. Kirjeldatakse ka, et meetod on
kasulik retinopaatia ravimiseks või vältimiseks seda vajaval loomal. Kirjeldatakse
ka, et meetod on kasulik lihasspasmide ravimiseks või vältimiseks seda vajaval
loomal. Kirjeldatakse ka, et meetod on kasulik migreeni ravimiseks või vältimiseks
seda vajaval loomal. Kirjeldatakse ka, et meetod on kasulik oksendamise ravimi-
20
seks või vältimiseks seda vajaval loomal. Kirjeldatakse ka, et meetod on kasulik
düskineesia ravimiseks või vältimiseks seda vajaval loomal. Kirjeldatakse ka, et
meetod on kasulik depressiooni ravimiseks või vältimiseks seda vajaval loomal.
mGluR1 ekspresseerima võimeliste rakkude näited hõlmavad väikeaju Purkinje
rakke (närvirakud), Purkinje rakkude rakukehi (granulaarsed), väikeaju rakkude
25
dendriite, haistmissibulate glomeerulite neuroneid ja neuropiilirakke, suurajukoore
pindmise kihi rakke, hipokampuse rakke, talamuse rakke, ülakünka rakke ja
kolmiknärvi seljaajutuuma rakke. mGluR1 ekspresseerivate rakkude testimise
meetodid on tehnika tasemest tuntud.
EE-EP 1 648 878 B1
230
4.8 TERAPEUTILINE/PROFÜLAKTILINE MANUSTAMINE JA
LEIUTISEKOHASED KOOSTISED
Oma toime tõttu on piperidiiniühendid edukalt kasutatavad veterinaar- ja
humaanmeditsiinis. Nagu eespool on kirjeldatud, on piperidiiniühendid kasulikud
5
haigusseisundi ravimiseks või vältimiseks.
Kasutamisel loomal manustatakse piperidiiniühendeid komponendina koostises,
mis sisaldab farmatseutiliselt vastuvõetavat kandjat või abiainet. Käesolevaid,
piperidiiniühendeid sisaldavaid koostisi võib manustada suukaudselt. Leiutise
kohaseid piperidiiniühendeid võib manustada ka mis tahes muul tavalisel viisil,
10
näiteks infusiooni teel või boolussüstimisega, imendumisega läbi epiteeli või
limaskestade (nt suu-, päraku- ja soolelimaskesta jne), ning neid võib manustada
koos teise terapeutilise toimeainega. Manustamine võib olla süsteemne või
paikne. Tuntakse mitmesuguseid manustamissüsteeme, näiteks kapseldamine
liposoomidesse, mikroosakestesse, mikrokapslitesse, kapslitesse jne, ning neid
15
võib kasutada piperidiiniühendi manustamiseks.
Manustamisviisid
hõlmavad
intradermaalset,
intramuskulaarset,
intraperitoneaalset, intravenoosset, subkutaanset, intranasaalset, epiduraalset,
suukaudset, sublingvaalset, intratserebraalset, intravaginaalset, transdermaalset,
rektaalset, inhalatsiooni teel või paikset manustamist, eriti kõrva, ninna, silma või
20
nahasse. Manustamisviis jäetakse arsti otsustada. Enamikel juhtudest põhjustab
manustamine piperidiiniühendite vabanemise vereringesse.
Konkreetsetes
teostustes
võib
olla
soovitav
piperidiiniühendite
paikne
manustamine. Seda võib saavutada näiteks paikse infusiooniga operatsiooni ajal,
paikse
25
manustamisega
näiteks
haavade
sidumisel
pärast
operatsiooni,
süstimisega, kateetri abil, suposiidi või klüsmi abil või implantaadi abil, nimetatud
implantaat on valmistatud poorsest, mittepoorsest või želatiinmaterjalist, nagu
silikoonkummist membraanid või kiud.
EE-EP 1 648 878 B1
231
Teatud teostustes võib olla soovitav viia piperidiiniühendid kesknärvisüsteemi või
seedetrakti mis tahes sobival viisil, sealhulgas intraventrikulaarse, intratekaalse ja
epiduraalse
süstimise
ning
klüsmiga.
Intraventrikulaatrset
süstimist
võib
kergendada intraventrikulaarse kateetri abil, mis kinnitatakse näiteks mahuti,
5
nagu Ommaya mahuti, külge.
Kasutada võib ka kopsu manustamist, näiteks inhalaatori või nebulisaatori ja ainet
pihustava preparaadi abil, või perfusiooni teel fluorosüsivesinikus või sünteetilises
kopsusurfaktandis. Teatud teostustes võib piperidiiniühenditest valmistada
suposiidi koos traditsiooniliste sideainete ja abiainetega, nagu triglütseriidid.
10
Veel ühes teostuses võib piperidiiniühendeid manustada vesiiklis, eriti liposoomis
(vt Langer, Science, 1990, 249, 1527-1533; Treat et al., Liposomes in the
Therapy of Infectious Disease and Cancer, 1989, 317-327, 353-365).
Veel järgmises teostuses võib piperidiiniühendeid manustada toimeainet
kontrollitult vabastavas süsteemis või prolongeeritult vabastavas süsteemis
15
(vt Goodson, Medical Applications of Controlled Release, supra, 1984, 2,
115-138). 115-138 (1984)). Kasutada võib teisi toimeainet kontrollitult või
prolongeeritult vabastavaid süsteeme, mida käsitleb oma ülevaates Langer
(Science, 1990, 249, 1527-1533). Ühes teostuses võib kasutada pumpa (Langer,
Science, 1990, 249, 1527-1533; Sefton, CRC Crit. Ref. Biomed. Eng., 1987, 14,
20
201; Buchwald et al., Surgery, 1980, 88, 507; Saudek et al., N. Engl. J. Med.,
1989, 321, 574). Järgmises teostuses võib kasutada polümeerseid materjale
(vt Medical Applications of Controlled Release (Langer and Wise, ed., 1974);
Controlled Drug Bioavailability, Drug Product Design and Performance (Smolen
and Ball, ed., 1984); Ranger and Peppas, J. Macromol. Sci. Rev. Macromol.
25
Chem., 1983, 23, 61; Levy et al., Science, 1985, 228, 190; During et al., Ann.
Neurol., 1989, 25, 351; Howard et al., J. Neurosurg., 1989, 71, 105). Veel
järgmises teostuses võib toimeainet kontrollitult või prolongeeritult vabastava
süsteemi paigaldada piperidiiniühendite toime märklaudkoha, näiteks lülisamba,
aju või seedetrakti, lähedale, sellisel juhul vajatakse vaid osa süsteemsest
30
annusest.
EE-EP 1 648 878 B1
232
Selleks, et saada loomale manustamiseks sobiv ravimvorm, võivad käesolevad
koostised valikuliselt sisaldada sobivas koguses farmatseutiliselt vastuvõetavat
abiainet.
Sellisteks farmatseutilisteks abiaineteks võivad olla vedelikud, nagu vesi ja õlid,
5
sealhulgas naftast saadud, loomset, taimset või sünteetilist päritolu, nagu
maapähkliõli, sojaoaõli, mineraalõli, seesamiõli jms. Farmatseutilisteks abiaineteks võib olla soolalahus, kummiaraabik, želatiin, tärklisepasta, talk, keratiin,
kolloidne ränidioksiid, uurea jms. Lisaks võib kasutada lisaaineid, stabilisaatoreid,
paksendavaid,
10
libi-
ja
värvaineid.
Ühes
teostuses
on
farmatseutiliselt
vastuvõetavad abiained loomale manustamisel steriilsed. Piperidiiniühendi
intravenoossel manustamisel on eriti kasulikuks abiaineks vesi. Samuti võib
vedelate abiainetena kasutada soolalahuseid ning dekstroosi ja glütserooli
vesilahuseid,
eriti
süstelahuste
puhul.
Sobivad
farmatseutilised
abiained
hõlmavad ka tärklist, glükoosi, laktoosi, sahharoosi, želatiini, linnaseekstrakti, riisi,
15
jahu,
kriiti,
silikageeli,
naatriumstearaati,
glütseroolmonostearaati,
talki,
naatriumkloriidi, kuivatatud lõssipulbrit, glütserooli, propüleenglükooli, vett,
etanooli jms. Käesolevad koostised võivad valikuliselt sisaldada ka väikeses
koguses märgavaid aineid või emulgaatoreid või pH-d puhverdavaid aineid.
Käesolevad koostised võib valmistada lahuste, suspensioonide, emulsioonide,
20
tablettide, pillide, pelletite, kapslite, vedelikke sisaldavate kapslite, pulbrite,
toimeainet prolongeeritult vabastavate preparaatide, suposiitide, emulsioonide,
aerosoolide, pihude, suspensioonide või mis tahes muude kasutamiseks sobivate
ravimvormidena. Ühes teostuses on koostis kapsli vormis (vt US patent
5,698,155). Sobivate farmatseutiliste abiainete teisi näiteid kirjeldatakse raamatus
25
Remington’s Pharmaceutical Sciences, 19th ed., 1995, 1447-1676 (Alfonso R.
Gennaro eds.).
Ühes teostuses valmistatakse piperidiiniühenditest tavaliste meetoditega koostis,
mis on kohandatud suukaudseks manustamiseks inimestele. Suukaudselt
manustatavad koostised võivad olla näiteks tablettide, losengide, vesi- või
30
õlisuspensioonide, graanulite, pulbrite, emulsioonide, kapslite, siirupite või
EE-EP 1 648 878 B1
233
eliksiiride vormis. Selleks, et saada farmatseutiliselt suupärast preparaati, võivad
suukaudselt manustatavad koostised sisaldada ühte või enamat ainet, näiteks
magusaineid, nagu fruktoos, aspartaam või sahhariin, maitseaineid, nagu
piparmündimaitseaine, igihaljaõli või kirsimaitseaine, värvaineid ja konservante.
5
Peale selle võib tableti või pilli vormis koostisi katta, et aeglustada nende
lagunemist ja imendumist seedetraktis, tagades nii toimeaine pideva vabanemise
pikema ajaperioodi jooksul. Suukaudselt manustatavate ravimkoostiste puhul võib
sobivalt kasutada ka selektiivse permeaablusega membraanidega ümbritsetud
osmootselt toimivat ühendit. Nendes viimastes süsteemides imab osmootselt
10
toimiv aine kapslit ümbritsevast keskkonnast vedelikku ja pundub, tõrjudes aine
või ainet sisaldava koostise läbi ava kapslist välja. Sellised manustamissüsteemid
võivad anda praktiliselt null-järku vabanemisprofiili vastupidiselt toimeainet
viivitamatult
vabastavate
preparaatide
puhul
esinevale
pulseerivale
vabanemisprofiilile. Võib kasutada ka toimeaine vabanemist ajaliselt viivitavat
15
ainet, nagu glütseroolmonostearaat või glütseroolstearaat. Suukaudsed ravimkoostised võivad sisaldada standardseid abiaineid, nagu mannitool, laktoos,
tärklis, magneesiumstearaat, naatriumsahhariin, tselluloos ja magneesiumkarbonaat. Ühes teostuses on abiained farmatseutilist marki.
Järgmises
20
teostuses
võib
piperidiiniühenditest
valmistada
preparaadi
intravenoosseks manustamiseks. Tavaliselt sisaldavad intravenoosselt manustatavad koostised steriilset isotoonilist veepõhist puhvrit. Valikuliselt võivad
koostised
sisaldada
ka
solubiliseerivat
ainet.
Koostised
intravenoosseks
manustamiseks võivad valu vähendamiseks süstekohas sisaldada valikuliselt
lokaalanesteetikumi, nagu lidokaiin. Üldiselt lisatakse komponendid kas eraldi või
25
segatuna kokku üksikannusvormis, näiteks kuiva lüofiliseeritud pulbri või veevaba
kontsentraadina hermeetiliselt suletud anumas, nagu ampull või kotike, millel on
näidatud toimeaine kogus. Kui piperidiiniühendeid tuleb manustada infusiooni
teel, võib neid annustada näiteks infusioonipudelist, mis sisaldab steriilset
farmatseutilist marki vett või soolalahust. Kui piperidiiniühendeid tuleb manustada
30
süstimise teel, võib esitada steriilse süstevee või soolalahusega ampulli, nii et
koostisosi võib segada enne manustamist.
EE-EP 1 648 878 B1
234
Piperidiiniühendeid võib manustada vastava ala asjatundjatele tuntud toimeainet
kontrollitult
või prolongeeritult
vabastavate
vahenditega
või manustamis-
seadmetega. Näited hõlmavad neid, mida on kirjeldatud US patentides
3,845,770, 3,916,899, 3,536,809, 3,598,123, 4,008,719, 5,674,533, 5,059,595,
5
5,591,767, 5,120,548, 5,073,543, 5,639,476, 5,354,556 ja 5,733,566. Selliseid
ravimvorme
võib
prolongeeritud
kasutada
ühe
vabanemise
või
enama
saamiseks,
toimeaine
kasutades
kontrollitud
näiteks
või
hüdro-
propüülmetüültselluloosi, muid polümeermaatrikseid, läbilaskvaid membraane,
osmootseid süsteeme, mitmekihilisi katteid, mikroosakesi, liposoome, mikro10
kerasid või nende kombinatsiooni, saamaks erinevates proportsioonides soovitud
vabanemisprofiili.
Vastava
ala
asjatundjatele
tuntud
sobivaid
toimeainet
kontrollitult või prolongeeritult vabastavaid preparaate, sealhulgas siin kirjeldatuid,
saab kergesti valida kasutamiseks koos leiutisekohase toimeainega. Seega
käsitleb leiutis suukaudseks manustamiseks sobivaid üksikannusvorme, nagu
15
tabletid, kapslid, želatiinkapslid ja kaetud tabletid, mis on kohandatud toimeaine
kontrollitud või prolongeeritud vabastamiseks.
Toimeainet kontrollitult või prolongeeritult vabastavate ravimkoostiste ühiseks
eesmärgiks on parandada medikamentoosset ravi võrreldes sellega, mis
saadakse nende mittekontrollitult või mitteprolongeeritult vabastavate analoo20
gidega. Ühes teostuses sisaldab toimeainet kontrollitult või prolongeeritult vabastav koostis piperidiiniühendit minimaalses koguses, et ravida või ohjata
haigusseisundit minimaalse aja jooksul. Toimeainet kontrollitult või prolongeeritult
vabastavate koostiste eelised hõlmavad ravimi pikendatud toimet, harvemat
annustamist ja patsiendi raviga nõustumise paranemist. Lisaks võivad toimeainet
25
kontrollitult või prolongeeritult vabastavad koostised mõjutada soodsalt toime
algusaega või muid omadusi, nagu piperidiiniühendi tasemed veres, ja
vähendada seega ebasoovitavate kõrvaltoimete esinemist.
Toimeainet kontrollitult või prolongeeritult vabastavad koostised võivad esialgu
vabastada piperidiiniühendit koguses, mis avaldab kohe soovitud terapeutilist või
30
profülaktilist
toimet,
piperidiiniühendi
ning
ülejäänud
seejärel
kogused,
vabastada
hoidmaks
järk-järgult
seda
ja
pidevalt
terapeutilise
või
EE-EP 1 648 878 B1
235
profülaktilise toime taset pikema aja jooksul. Hoidmaks piperidiiniühendi püsivat
taset organismis, võib piperidiiniühend vabaneda ravimvormist kiirusega, mis
asendab metaboliseeritud ja organismist eritatud piperidiiniühendi koguse.
Toimeaine
5
kontrollitud
või
prolongeeritud
vabastamist
võib
stimuleerida
mitmesuguste tingimustega, sealhulgas pH muutmise, temperatuuri, ensüümide
kontsentratsiooni või kättesaadavuse, vee kontsentratsiooni või kättesaadavuse
või muude füsioloogiliste tingimuste muutmise või ühendite kasutamisega.
Haigusseisundi ravimiseks või vältimiseks efektiivse piperidiiniühendi koguse võib
määrata standardsete kliiniliste meetoditega. Lisaks võib valikuliselt optimaalsete
10
annusevahemike kindlaksmääramiseks kasutada in vitro või in vivo teste. Täpne
kasutatav annus sõltub ka manustamisviisist ja haigusseisundi tõsidusest ning
arsti poolt tehtavast otsusest ja/või iga looma olukorrast. Sobivad efektiivsed
annused on aga vahemikus 0,01-2500 mg/kg kehamassi kohta, kuigi tavaliselt on
need 100 mg/kg kehamassi kohta. Ühes teostuses on püridiiniühendi efektiivne
15
annus
vahemikus
0,01-100
mg/kg
kehamassi
kohta,
teises
teostuses
0,02-50 mg/kg kehamassi kohta ja järgmises teostuses 0,025-20 mg/kg
kehamassi kohta. Ühes teostuses manustatakse efektiivne kogus iga 24 tunni
tagant, kuni haigusseisund leeveneb. Järgmises teostuses manustatakse
efektiivne kogus iga 12 tunni tagant, kuni haigusseisund leeveneb. Järgmises
20
teostuses manustatakse efektiivne kogus iga 8 tunni tagant, kuni haigusseisund
leeveneb. Järgmises teostuses manustatakse efektiivne kogus iga 6 tunni tagant,
kuni haigusseisund leeveneb. Järgmises teostuses manustatakse efektiivne
kogus iga 4 tunni tagant, kuni haigusseisund leeveneb. Siin kirjeldatavad
efektiivsed annused viitavad kogu manustatavale annusele, mis tähendab seda,
25
et rohkem kui ühe piperidiiniühendi manustamisel vastab efektiivne annus kogu
manustatud kogusele.
Kui VR1, mGluR5 või mGluR1 ekspresseerima võimeline rakk viiakse
piperidiiniühendiga kokku in vitro, on lahuse või suspensiooni farmatseutiliselt
vastuvõetavas kandjas või abiaines efektiivne kogus VR1-, mGluR5- või
30
mGluR1-retseptori
funktsiooni
inhibeerimiseks
rakus
tavaliselt
vahemikus
0,01 µg/l kuni 5 mg/l, ühes teostuses 0,01 µg/l kuni 2,5 mg/l, järgmises teostuses
236
EE-EP 1 648 878 B1
0,01 µg/ml kuni 0,5 mg/l ning järgmises teostuses 0,01 µg/l kuni 0,25 mg/l. Ühes
teostuses on piperidiiniühendit sisaldava lahuse või suspensiooni maht umbes
0,01 µl kuni umbes 1 ml. Järgmises teostuses on lahuse või suspensiooni maht
umbes 200 µl.
5
Kui VR1, mGluR5 või mGluR1 ekspresseerima võimelised rakud viiakse kokku
piperidiiniühendiga in vivo, on retseptori funktsiooni inhibeerimiseks rakus
efektiivne kogus tavaliselt vahemikus 0,01-2500 mg/kg kehamassi kohta, kuigi
tavaliselt on see vahemikus 100 mg/kg kehamassi kohta või alla selle.
Ühes teostuses on piperidiiniühendi efektiivne annus vahemikus 0,01-100 mg/kg
10
kehamassi kohta, teises teostuses 0,020-50 mg/kg kehamassi kohta ja järgmises
teostuses 0,025-20 mg/kg kehamassi kohta. Ühes teostuses manustatakse
efektiivne annus iga 24 tunni tagant. Järgmises teostuses manustatakse
efektiivne annus iga 12 tunni tagant. Järgmises teostuses manustatakse
efektiivne annus iga 8 tunni tagant. Järgmises teostuses manustatakse efektiivne
15
annus iga 6 tunni tagant. Järgmises teostuses manustatakse efektiivne annus iga
4 tunni tagant.
Kui VR1, mGluR5 või mGluR1 ekspresseerima võimeline rakk viiakse
piperidiiniühendiga kokku in vitro, on lahuse või suspensiooni farmatseutiliselt
vastuvõetavas kandjas või abiaines efektiivne kogus retseptori funktsiooni
20
inhibeerimiseks rakus tavaliselt vahemikus 0,01 µg/l kuni 5 mg/l, ühes teostuses
0,01 µg/l kuni 2,5 mg/l, järgmises teostuses 0,01 µg/ml kuni 0,5 mg/l ning
järgmises teostuses 0,01 µg/l kuni 0,25 mg/l. Ühes teostuses on lahuse või
suspensiooni maht umbes 1 µl kuni umbes 1 ml. Järgmises teostuses on lahuse
või suspensiooni maht umbes 200 µl.
25
Kui VR1, mGluR5 või mGluR1 ekspresseerima võimeline rakk viiakse
piperidiiniühendiga kokku in vivo, on efektiivne kogus retseptori funktsiooni
inhibeerimiseks rakus tavaliselt vahemikus 0,01-100 mg/kg kehamassi kohta
ööpäevas, ühes teostuses 0,1-50 mg/kg kehamassi kohta ööpäevas ja järgmises
teostuses 1-20 mg/kg kehamassi kohta ööpäevas.
EE-EP 1 648 878 B1
237
Piperidiiniühendeid võib enne ravimi kasutamist inimestel testida soovitud
terapeutilise või profülaktilise toime suhtes in vitro või in vivo. Ohutuse ja
efektiivsuse näitamiseks võib kasutada loommudeli süsteeme.
Käesolevad meetodid haigusseisundi ravimiseks või vältimiseks seda vajaval
5
loomal võivad hõlmata veel teise raviaine manustamist loomale, kellele
manustatakse piperidiiniühendit. Ühes teostuses manustatakse teist raviainet
efektiivses koguses.
Käesolevad kasutamised ravimi valmistamiseks VR1 funktsiooni inhibeerimiseks
VR1 ekspresseerima võimelises rakus võivad hõlmata veel raku kokkuviimist
10
teise raviaine efektiivse kogusega.
Käesolevad kasutamised ravimi valmistamiseks mGluR5 funktsiooni pärssimiseks
mGluR5 ekspresseerima võimelises rakus võivad hõlmata veel raku kokkuviimist
teise raviaine efektiivse kogusega.
Käesolevad kasutamised ravimi valmistamiseks mGluR1 funktsiooni pärssimiseks
15
mGluR1 ekspresseerima võimelises rakus võivad hõlmata veel raku kokkuviimist
teise raviaine efektiivse kogusega.
Teiste raviainete efektiivsed kogused on vastava ala asjatundjatele tuntud. Siiski
on vastava ala asjatundja ülesandeks määrata teiste raviainete annuse
optimaalne, efektiivne vahemik. Leiutise ühes teostuses, milles loomale
20
manustatakse teist raviainet, on piperidiiniühendi efektiivne kogus väiksem, kui
selle efektiivne annus oleks teise raviaine mittemanustamisel. Sellisel juhul,
olemata seotud teooriaga, arvatakse, et piperidiiniühendid ja teised raviained
toimivad haigusseisundi ravimises või vältimises sünergistlikult.
Teine
25
raviaine
hõlmab
opioidagonisti,
mitteopiodset
analgeetikumi,
mittesteroidset põletikuvastast ainet, migreenivastast ainet, COX-2 inhibiitorit,
oksendamisvastast
ainet,
β-adrenoblokaatorit,
krambivastast
ainet,
EE-EP 1 648 878 B1
238
antidepressanti, Ca2+-kanali blokaatorit, vähivastast ainet, ainet UI ravimiseks või
vältimiseks, ainet haavandi ravimiseks või vältimiseks, ainet IBD ravimiseks või
vältimiseks, ainet IBS-i ravimiseks või vältimiseks, ainet sõltuvushäire ravimiseks,
ainet Parkinsoni tõve ja parkinsonismi ravimiseks, ainet ärevuse ravimiseks, ainet
5
epilepsia ravimiseks, ainet insuldi ravimiseks, ainet krampide ravimiseks, ainet
kihelusega seotud haigusseisundi ravimiseks, ainet psühhoosi ravimiseks, ainet
Huntingtoni korea ravimiseks, ainet ALS-i ravimiseks, ainet kognitiivse häire
ravimiseks, ainet migreeni ravimiseks, ainet oksendamise ravimiseks, ainet
düskineesia ravimiseks või ainet depressiooni ravimiseks ning nende segusid.
10
Kasutatavate
opioidagonistide
näited
hõlmavad
alfentaniili,
allüülprodiini,
alfaprodiini, anileridiini, bensüülmorfiini, besitramiidi, buprenorfiini, butorfanooli,
klonitaseeni, kodeiini, desomorfiini, dekstromoramiidi, desotsiini, diampromiidi,
diamorfooni, dihüdrokodeiini, dihüdromorfiini, dimenoksadooli, dimefeptanooli,
dimetüültiambuteeni,
15
etoheptasiini,
heroiini,
etüülmetüültiambuteeni,
hüdrokodooni,
ketobemidooni,
dioksafetüülbutüraati,
etüülmorfiini,
hüdromorfooni,
levorfanooli,
dipipanooni,
etonitaseenfentanüüli,
hüdroksüpetidiini,
levofenatsüülmorfaani,
eptasotsiini,
isometadooni,
lofentaniili,
meperidiini,
meptasinooli, metasotsiini, metadooni, metopooni, morfiini, mürofiini, nalbufiini,
nartseiini, nikomorfiini, norlevorfanooli, normetadooni, nalorfiini, normorfiini,
20
norpipanooni, oopiumit, oksükodooni, oksümorfooni, papaveretumit, pentasotsiini,
fenadoksooni, fenomorfaani, fenasotsiini, fenoperidiini, piminodiini, piritramiidi,
proheptasiini, promedooli, properidiini, propiraami, propoksüfeeni, sufentaniili,
tilidiini, tramadooli, nende farmatseutiliselt vastuvõetavaid sooli ja nende segusid.
Teatud teostustes valitakse opioidagonist kodeiini, hüdromorfooni, hüdrokodooni,
25
oksükodooni, dihüdrokodeiini, dihüdromorfiini, morfiini, tramadooli, oksümorfooni,
nende farmatseutiliselt vastuvõetavate soolade ja nende segude hulgast.
Kasutatavate mitteopioidsete analgeetikumide näited hõlmavad mittesteroidseid
põletikuvastaseid aineid, nagu aspiriin, ibuprofeen, diklofenak, naprokseen,
benoksaprofeen, flurbiprofeen, fenoprofeen, flubufeen, ketoprofeen, indoprofeen,
30
piroprofeen, karprofeen, oksaprosiin, pramoprofeen, muroprofeen, trioksaprofeen,
EE-EP 1 648 878 B1
239
suprofeen,
aminoprofeen,
indometatsiin,
sulindak,
tiaprofeenhape,
tolmetiin,
fluprofeen,
buklokshape,
tiopinak,
zidometatsiin,
zomepirak,
atsemetatsiin, fentiasak, klidanak, okspinak, mefenaamhape, meklofenaamhape,
flufenaamhape, nifluumhape, tolfenaamhape, diflurisaal, flufenisaal, piroksikaam,
5
sudoksikaam, isoksikaam ja nende farmatseutiliselt vastuvõetavad soolad ja
nende segud. Muud sobivad mitteopioidsed analgeetikumid hõlmavad järgmisi
analgeetikumide, antipüreetikumide, mittesteroidsete põletikuvastaste ravimite
mittepiiravaid keemilisi rühmi:
naatriumsalitsülaat,
10
salitsüülhappe derivaadid, nagu aspiriin,
koliinmagneesiumtrisalitsülaat,
salsalaat,
diflunisaal,
salitsüülsalitsüülhape, sulfasalasiin ja olsalasiin; para-aminofennooli derivaadid,
nagu atseetaminofeen ja fenatsetiin; indool- ja indeenäädikhapped, nagu
indometatsiin, sulindak ja etodolak; heteroarüüläädikhapped, nagu tolmetiin,
diklofenak ja ketorolak; antraniilhapped (fenamaadid), nagu mefenaamhape ja
meklofenaamhape; enoolhapped, nagu oksikaamid (piroksikaam, tenoksikaam) ja
15
pürasolidiindioonid (fenüülbutasoon, oksüfentartasoon), ning alkanoonid, nagu
nabumetoon. MSPVR-ide üksikasjalikumat kirjeldust vaadata Paul A., Insel,
Analgesic-Antipyretic and Anti-inflammatory Agents and Drugs Employed in the
Treatment of Gout, in Goodman & Gilman’s The Pharmacological Basis of
Therapeutics, 9th ed., 1996, 617-57 (Perry B. Molinhoff and Raymond W. Ruddon,
20
eds.) ning Glen R. Hanson, Analgesic, Antipyretic and Anti-Inflammatory Drugs in
Remington: The Science and Practice of Pharmacy, 19th ed., 1995, 2, 1196-1221
(A. R. Gennaro, eds.).
Kasutatavate COX-2 inhibiitorite ja 5-lipooksügenaasi inhibiitorite, samuti nende
kombinatsioonide näiteid kirjeldatakse US patendis 6,136,839. Kasutatavate
25
COX-2 inhibiitorite näitedhõlmavad tselekoksiibi.
Kasutatavate migreenivastaste ainete näited hõlmavad alpiropriidi, bromokriptiini,
dihüdroergotamiini,
dolasetrooni,
ergokorniini,
ergokorniniini,
ergokrüptiini,
ergonoviini, tungalterast valmistatud aineid, ergotamiini, flumedroksoonatsetaati,
fonasiini,
30
ketanseriini,
lisuriidi,
lomerisiini,
metüülergonoviini,
metüsergiidi,
metoprolooli, naratriptaani, oksetorooni, pisotüliini, propranolooli, risperidooni,
risatriptaani, sumatriptaani, timolooli, trasodooni, zolmitriptaani ja nende segusid.
EE-EP 1 648 878 B1
240
Teiseks raviaineks võib olla ka aine, mis on kasulik piperidiiniühendite mis tahes
võimalike kõrvaltoimete vähendamiseks. Teiseks raviaineks võib olla näiteks
oksendamisvastane aine. Kasutatavate oksendamisvastaste ainete näited
hõlmavad
5
metoklopromiidi,
domperidooni,
prokloorperasiini,
prometasiini,
kloorpromasiini, trimetobensamiidi, ondansetrooni, granisetrooni, hüdroksüsiini,
atsetüülleutsiini,
monoetanoolamiini,
alisapriidi,
asasetrooni,
benskinamiidi,
bietanautiini, bromopriidi, buklisiini, klebopriidi, tsüklisiini, dimenhüdrinaati,
difenidooli,
dolasetrooni,
oksüpemdüüli,
10
meklisiini,
pipamasiini,
metallataali,
skopolamiini,
metopimasiini,
sulpiriidi,
nabilooni,
tetrahüdrokannabinooli,
tietüülperasiini, tioproperasiini, tropisetrooni ja nende segusid.
Kasutatavate β-adrenoblokaatorite näited hõlmavad atsebutolooli, alprenolooli,
amosulabooli, arotinolooli, atenolooli, befunolooli, betaksolooli, bevantolooli,
bisoprolooli, bopindolooli, bukumolooli, bufetolooli, bufuralooli, bunitrolooli,
bupranolooli,
15
butidriinvesinikkloriidi,
karvedilooli,
tseliprolooli,
butofilolooli,
tsetamolooli,
karasolooli,
kloranolooli,
karteolooli,
dilevalooli,
epanolooli,
esmolooli, indenolooli, labetalooli, levobunolooli, mepindolooli, metipranolooli,
metoprolooli,
moprolooli,
nadolooli,
nadoksolooli,
nebivalooli,
nifenalooli,
nipradilooli, oksprenolooli, penbutolooli, pindolooli, praktolooli, pronetalooli,
propranolooli, sotalooli, sulfinalooli, talinolooli, tertatolooli, tilisolooli, timolooli,
20
toliprolooli ja ksibenolooli.
Kasutatavate
albutoiini,
krambivastaste
aloksidooni,
atrolaktamiidi,
beklamiidi,
ainete
näited
hõlmavad
aminoglutetimiidi,
buramaati,
atsetüülfeneturiidi,
4-amino-3-hüdroksüvõihapet,
kaltsiumbromiidi,
karbamasepiini,
tsinromiidi, klometiasooli, klonasepaami, detsimemiidi, dietadiooni, dimetadiooni,
25
doksenitroiini,
fluoresooni,
bromiidi,
metetoiini,
eterobarbi,
gabapentiini,
etadiooni,
5-hüdroksütrüptofaani,
magneesiumsulfaati,
metsuksimiidi,
etosuksimiidi,
mefenütoiini,
etotoiini,
felbamaati,
lamotrigiini,
magneesium-
mefobarbitaali,
metarbitaali,
5-metüül-5-(3-fenantrüül)-hüdantoiini,
3-metüül-5-
fenüülhüdantoiini, narkobarbitaali, nimetasepaami, nitrasepaami, okskarbasepiini,
30
parametadiooni,
fensuksimiidi,
fenatsemiidi,
fenetarbitaali,
fenüülmetüülbarbituurhapet,
feneturiidi,
fenütoiini,
fenobarbitaali,
fetenülaatnaatriumi,
EE-EP 1 648 878 B1
241
kaaliumbromiidi,
pregabaliini,
primidooni,
progabiidi,
naatriumbromiidi,
solaanumit, strontsiumbromiidi, suklofeniidi, sultiaami, tetrantoiini, tiagabiini,
topiramaati, trimetadiooni, valproehapet, valpromiidi, vigabatriini ja zonisamiidi.
Kasutatavate antidepressantide näited hõlmavad binedaliini, karoksasooni,
5
tsitalopraami, dimetasaani, fenkamiini, indalpiini, indeloksasiinvesinikkloriidi,
nefopaami,
nomifensiini,
oksitriptaani,
oksüpertiini,
paroksetiini,
sertraliini,
tiasesiimi, trasodooni, benmoksiini, iproklosiidi, iproniasiidi, isokarboksasiidi,
nialamiidi, oktamoksiini, fenelsiini, kotiniini, rolitsüpriini, rolipraami, maprotiliini,
metralindooli,
10
mianseriini,
amitriptülliinoksiidi,
mirtasepiini,
amoksapiini,
desipramiini,
dibensepiini,
imipramiini,
imipramiin-N-oksiidi,
butriptüliini,
dimetakriini,
adinasolaami,
amitriptülliini,
klomipramiini,
demeksiptiliini,
dotiepiini,
iprindooli,
doksepiini,
lofepramiini,
fluatsisiini,
melitratseeni,
metapramiini, nortriptüliini, noksiptiliini, opipramooli, pisotüliini, propisepiini,
protriptüliini,
15
kinupramiini,
trimipramiini,
adrafiniili,
benaktüsiini,
bupropiooni, butatsetiini, dioksadrooli, duloksetiini, etoperidooni, febarbamaati,
femoksetiini,
fenpentadiooli,
hüperitsiini,
levofatsetoperaani,
moklobemiidi,
fluoksetiini,
tandospirooni,
ritanseriini,
tosalinooni,
fluvoksamiini,
medifoksamiini,
nefasodooni,
pürisuktsideanooli,
20
tianeptiini,
hematoporfüriini,
milnatsipraani,
oksaflosaani,
piberaliini,
roksindooli,
rubiidiumkloriidi,
tofenatsiini,
toloksatooni,
minapriini,
prolintaani,
sulpiriidi,
tranüültsüpromiini,
L-trüptofaani, venlafaksiini, viloksasiini ja zimelidiini.
Kasutatavate Ca2+-kanali blokaatorite näited hõlmavad bepridiili, klentiaseemi,
diltiaseemi,
fendiliini,
gallopamiili,
mibefradiili,
prenüülamiini,
semotiadiili,
terodiliini, verapamiili, amlodipiini, aranidipiini, bamidipiini, benidipiini, tsilnidipiini,
25
efonidipiini, elgodipiini, felodipiini, isradipiini, latsidipiini, lerkanidipiini, manidipiini,
nikardipiini,
nifedipiini,
nilvadipiini,
nimodipiini,
nisoldipiini,
nitrendipiini,
tsinnarisiini,
flunarisiini,
lidoflasiini,
lomerisiini,
bentsüklaani,
etafenooni,
fantofarooni ja perheksiliini.
Kasutatavate vähivastaste ainete näited hõlmavad atsivitsiini, aklarubitsiini,
30
akodasoolvesinikkloriidi,
akroniini,
adoselesiini,
aldesleukiini,
altretamiini,
EE-EP 1 648 878 B1
242
ambomütsiini, ametantroonatsetaati, aminoglutetimiidi, amsakriini, anastrosooli,
antramütsiini, asparaginaasi, asperliini, asatsütidiini, asetepat, asotomütsiini,
batimastaati,
bensodepat,
bisnafiiddimesülaati,
5
bikalutamiidi,
biselesiini,
bisantreenvesinikkloriidi,
bleomütsiinsulfaati,
brekinaarnaatriumi,
bropirimiini, busulfaani, kaktinomütsiini, kalusterooni, karatsemiidi, karbetimeeri,
karboplatiini, karmustiini, karubitsiinvesinikkloriidi, karselesiini, tsedefingooli,
kloorambutsiili,
tsirolemütsiini,
tsüklofosfamiidi,
tsütarabiini,
tsisplatiini,
kladribiini,
dakarbasiini,
krisnatoolmesülaati,
daktinomütsiini,
daunorubitsiin-
vesinikkloriidi, detsitabiini, deksormaplatiini, desaguaniini, desaguaniinmesülaati,
10
diasikooni,
dotsetakseeli,
doksorubitsiini,
doksorubitsiinvesinikkloriidi,
droloksifeeni, droloksifeentsitraati, dromostanoloonpropionaati, duasomütsiini,
edatreksaati, eflornitiinvesinikkloriidi, elsamitrutsiini, enloplatiini, enpromaati,
epipropidiini,
epirubitsiinvesinikkloriidi,
estramustiini,
15
estramustiinfosfaatnaatriumi,
etoposiidfosfaati,
floksuridiini,
erbulosooli,
etopriini,
etanidasooli,
fadrosoolvesinikkloriidi,
fludarabiinfosfaati,
esorubitsiinvesinikkloriidi,
fluorouratsiili,
etoposiidi,
fasarabiini,
fenretiniidi,
flurotsütabiini,
foskidooni,
fostrietsiinnaatriumi, gemtsitabiini, gemtsitabiinvesinikkloriidi, hüdroksüuureat,
idarubitsiinvesinikkloriidi,
ifosfamiidi,
ilmofosiini,
interleukiin
II
(sealhulgas
rekombinantset interleukiin II ehk rIL2), interferoon-alfa-2a, interferoon-alfa-2b,
20
interferoon-alfa-n1, interferoon-alfa-n3, interferoon-beeta-Ia, interferoon-gammaIb,
iproplatiini,
leuproliidatsetaati,
irinotekaanvesinikkloriidi,
liarosoolvesinikkloriidi,
losoksantroonvesinikkloriidi,
vesinikkloriidi,
25
lanreotiidatsetaati,
lometreksoolnaatriumi,
masoprokooli,
megestroolatsetaati,
letrosooli,
maitansiini,
lomustiini,
meklooretamiin-
melengestroolatsetaati,
melfalaani,
menogariili, merkaptopuriini, metotreksaati, metotreksaatnaatriumi, metopriini,
meturedepat, mitindomiidi, mitokartsiini, mitokromiini, mitogilliini, mitomaltsiini,
mitomütsiini, mitosperi, mitotaani, mitoksantroonvesinikkloriidi, mükofenoolhapet,
nokodasooli,
nogalamütsiini,
ormaplatiini,
oksisuraani,
paklitakseeli,
pegaspargaasi, peliomütsiini, pentamustiini, peplomütsiinsulfaati, perfosfamiidi,
30
pipobromaani,
piposulfaani,
piroksantroonvesinikkloriidi,
plikamütsiini,
plomestaani, porfimeernaatriumi, porfiromütsiini, prednimustiini, prokarbasiinvesinikkloriidi, puromütsiini, puromütsiinvesinikkloriidi, pürasofuriini, ribopriini,
roglefimiidi,
safingooli,
safingoolvesinikkloriidi,
semustiini,
simtraseeni,
sparfosaatnaatriumi,
spiromustiini,
243
EE-EP 1 648 878 B1
sparsomütsiini,
spirogermaaniumvesinikkloriidi,
spiroplatiini,
talisomütsiini,
streptonigriini,
tekogalaannaatrsiumi,
streptosotsiini,
tegafuuri,
sulofenuuri,
teloksantroonvesinikkloriidi,
temoporfiini, teniposiidi, teroksirooni, testolaktooni, tiamipriini, tioguaniini, tiotepat,
5
tiasofuriini, tirapasamiini, toremifeentsitraati, trestoloonatsetaati, tritsiribiinfosfaati,
trimetreksaati, trimetreksaatglükuronaati, triptoreliini, tubulosoolvesinikkloriidi,
uramustiini, uredepat, vapreotiidi, verteporfiini, vinblastiinsulfaati, vinkristiinsulfaati,
vindesiini,
vinleurosiinsulfaati,
10
vindesiinsulfaati,
vinepidiinsulfaati,
vinorelbiintartraati,
vinrosidiinsulfaati,
vinglütsinaatsulfaati,
vinsolidiinsulfaati,
vorosooli, zeniplatiini, zinostatiini, zorubitsiinvesinikkloriidi.
Teiste vähivastaste ravimite näited hõlmavad 20-epi-1,25-dihüdroksüvitamiini D3,
5-etünüüluratsiili,
abiraterooni,
aklarubitsiini,
atsüülfulveeni,
adetsüpenooli,
adoselesiini, aldesleukiini, ALL-TK antagoniste, altretamiini, ambamustiini,
amidoksi, amifostiini, aminolevuliinhapet, anirubitsiini, amsakriini, anagreliidi,
15
anastrosooli, andrografoliidi, angiogeneesi inhibiitoreid, antagonisti D, antagonisti
G, antareliksit, antidorsaliseerivat morfogeneetilist valku 1 (anti-dorsaliseerivat
morphogenetic protein-1), antiandrogeeni eesnäärme kartsinoomi ravimiseks,
antiöstrogeeni, antineoplastooni, antisense-oligonukleotiide, afidikoliinglütsinaati,
apoptoosigeeni modulaatoreid, apoptoosi regulaatoreid, apuriinhapet, ara-CDP-
20
DL-PTBA,
arginiini
deaminaasi,
asulakriini,
atamestaani,
atrimustiini,
aksinastatiini 1, aksinastatiini 2, aksinastatiini 3, asasetrooni, asatoksiini,
asatürosiini, bakatiin III derivaate, balanooli, batimastaati, BCR/ABL antagoniste,
bensokloriine, bensoüülstaurosporiini, beeta-laktaami derivaate, beeta-aletiini,
beetaklamütsiini B, betuliinhapet, bFGF inhibiitorit, bikalutamiidi, bisantreeni,
25
bisasiridinüülspermiini, bisnafiidi, bistrateeni A, biselesiini, breflaati, bropirimiini,
budotitaani, butioniinsulfoksimiini, kaltsipotriooli, kalfostiini C, kamptotetsiini
derivaate,
kanarüpoks
IL-2,
kapetsitabiini,
karboksamiidaminotriasooli,
karboksüamidotriasooli, CaRest M3, CARN 700, kõhrest saadud inhibiitorit,
karselesiini, kaseiinkinaasi inhibiitoreid (ICOS), kastanospermiini, tsekropiini B,
30
tsetroreliksit, kloriine, klorokinoksaliinsulfoonamiidi, tsikaprosti, cis-porfüriini,
kladribiini, klomifeeni analooge, klotrimasooli, kollismütsiini A, kollismütsiini B,
kombretastatiini A4, kombretastatiini analoogi, konageniini, krambestsidiini 816,
EE-EP 1 648 878 B1
244
krisnatooli, krüptofütsiini 8, krüptofütsiin A derivaate, kuratsiini A, tsüklopentantrakinoone,
tsükloplataami,
tsüpemütsiini,
tsütarabiinokfosfaati,
tsütolüütilist faktorit, tsütostatiini, dakliksimaabi, detsitabiini, dehüdrodidemniini B,
desloreliini, deksametasooni, deksifosfamiidi, deksrasoksaani, deksverapamiili,
5
diasikvooni, didemniini B, didoksi, dietüülnorspermiini, dihüdro-5-asatsütidiini,
9-dihüdrotaksooli,
dokosanooli,
dioksamütsiini,
dolasetrooni,
difenüülspiromustiini,
doksifluridiini,
dotsetakseeli,
droloksifeeni,
dronabinooli,
duokarmütsiini SA, ebseleeni, ekomustiini, edelfosiini, edrekolomaabi, eflornitiini,
elemeeni, emitefuuri, epirubitsiini, epristeriidi, estramustiini analoogi, östrogeeni
10
agoniste, östrogeeni antagoniste, etanidasooli, etoposiidfosfaati, eksemestaani,
fadrosooli,
fasarabiini,
fenretiniidi,
fleselastiini,
fluasterooni,
forfenimeksi,
formestaani,
filgrastiimi,
fludarabiini,
fostrietsiini,
finasteriidi,
flavopiridooli,
fluorodaunorunitsiinvesinikkloriidi,
fotemustiini,
gadoliiniumteksafüriini,
galliumnitraati, galotsitabiini, ganireliksi, želatinaasi inhibiitoreid, gemtsitabiini,
15
glutatiooni inhibiitoreid, hepsulfaami, hereguliini, heksametüleenbisatseetamiidi,
hüperitsiini, ibandroonhapet, idarubitsiini, idoksifeeni, idramantooni, ilmofosiini,
ilomastaati,
imidasoakridoone,
imikimoodi,
immunostimulantseid
peptiide,
insuliinisarnase kasvufaktori 1 retseptori inhibiitorit, interferooni agoniste,
interferoone,
20
iroplakti,
interleukiine,
irsogladiini,
iobenguaani,
isobengasooli,
jododoksorubitsiini,
isohomohalikondriini
4-ipomeanooli,
B,
itasetrooni,
jasplakinoliidi, kahalaliidi F, lamellariin-N-triatsetaati, lanreotiidi, leinamütsiini,
lenograstiimi, lentinaansulfaati, leptolstatiini, letrosooli, leukeemiat inhibeerivat
faktorit,
leukotsüütide
alfa-interferooni,
leuproliidi+östrogeeni+progesterooni,
leuproreliini, levamisooli, liarosooli, lineaarset polüamiini analoogi, lipofiilset
25
disahhariidpeptiidi, lipofiilseid plaatinaühendeid, lissoklinamiidi 7, lobaplatiini,
lombritsiini, lometreksooli, lonidamiini, losoksantrooni, lovastatiini, loksoribiini,
lurtotekaani, luteetsiumteksafüriini, lüsofülliini, lüütilisi peptiide, maitansiini,
mannostatiini A, marimastaati, masoprokooli, maspiini, matrilüsiini inhibiitoreid,
maatriksi metalloproteinaasi inhibiitoreid, menogariili, merbarooni, metereliini,
30
metioninaasi,
metoklopramiidi,
MIF
inhibiitorit,
mifepristooni,
miltefosiini,
mirimostiimi, mittevastavat kaheahelalist RNA-d, mitoguasooni, mitolaktooli,
mitomütsiini analooge, mitonafiidi, fibroblasti kasvufaktori-saporiini mitotoksiini,
mitoksantrooni, mofaroteeni, molgramostiimi, monokloonset antikeha, inimese
EE-EP 1 648 878 B1
245
koorioni gonadotropiini, monofosforüüllipiidi A + müobakteri rakuseina sk,
mopidamooli, mitme ravimiresistentsuse geeni inhibiitorit, mitme kasvaja
supressoril 1 põhinevat ravi, vähivastast ainet lämmastikulise ipriidi analoogi,
mükaperoksiidi B, mükobakteri rakuseina ekstrakti, müriaporooni, N-atsetüül5
dinaliini,
N-asendatud
naloksooni+pentasotsiini,
nemorubitsiini,
bensamiide,
napaviini,
neridroonhapet,
nafareliini,
nagrestippi,
nartograstiimi,
nedaplatiini,
endopeptidaasi,
nilutamiidi,
nafterpiini,
neutraalset
nisamütsiini, lämmastikoksiidi modulaatoreid, nitroksiidi antioksüdanti, nitrullüüni,
O6-bensüülguaniini,
10
oktreotiidi,
okitsenooni,
oligonukleotiide,
onapristooni,
ondansetrooni, oratsiini, oraalset tsütokiini indutseerijat, ormaplatiini, osaterooni,
oksaliplatiini, oksaunomütsiini, paklitakseeli, paklitakseeli analooge, paklitakseeli
derivaate, palauamiini, palmitoüülrisoksiini, pamidroonhapet, panaksütriooli,
panomifeeni,
parabaktiini,
paselliptiini,
pentosaanpolüsulfaatnaatriumi,
15
perfosfamiidi,
perillüülalkoholi,
inhibiitoreid,
pitsibaniili,
pegaspargaasi,
pentostatiini,
pentrosooli,
fenasinomütsiini,
pilokarpiinvesinikkloriidi,
peldesiini,
perflubrooni,
fenüülatsetaati,
pirarubitsiini,
fosfataasi
piritreksiimi,
platsetiini A, platsetiini B, plasminogeeni aktivaatori inhibiitorit, plaatinakompleksi,
plaatinaühendeid, plaatina-triamiini kompleksi, porfimeernaatriumi, porfiromütsiini,
prednisooni, propüül-bis-akridooni, prostaglandiini J2, proteasoomi inhibiitoreid,
20
A-valgul
põhinevat
proteiinkinaasi
inhibiitoreid,
C
immuunmodulaatorit,
inhibiitoreid,
puriini
proteiinkinaasi
mikroalgaali,
nukleosiidi
proteiini
fosforülaasi
C
türosiini
inhibiitoreid,
inhibiitorit,
fosfataasi
purpuriine,
pürasoloakridiini, püridoksüülitud hemoglobiini polüoksüetüleeni konjugaati, raf
antagoniste,
25
raltitrekseedi,
ramosetrooni,
ras
farnesüülvalgu
transferaasi
inhibiitoreid, ras inhibiitoreid, ras-GAP inhibiitorit, demetüülitud retelliptiini,
reenium Re 186 etidronaati, risoksiini, ribosüüme, RII retinamiidi, rogletimiidi,
rohitukiini,
romurtiidi,
rokinimeksi,
rubiginooni
B1,
ruboksüüli,
safingooli,
saintopiini, SarCNU, sarkofütooli A, sargramostiimi, Sdi 1 mimeetikume,
semustiini,
30
vananemisest
signaaliülekande
antigeeni
siduvat
saadud
inhibiitoreid,
valku,
inhibiitorit
signaaliülekande
sisofiraani,
1,
sense-oligonukleotiide,
modulaatoreid,
sobusoksaani,
üheahelalist
naatriumborokaptaati,
naatriumfenüülatsetaati, solverooli, somatomediini siduvat valku, sonermiini,
sparfoshapet, spikamütsiini D, spiromustiini, splenopentiini, spongistatiini 1,
EE-EP 1 648 878 B1
246
skvalamiini,
tüvirakkude
inhibiitorit,
tüvirakkude
jagunemise
inhibiitoreid,
stipiamiidi, stromelüsiini inhibiitoreid, sulfinosiini, superaktiivset vasoaktiivse
soolepeptiidi
antagonisti,
glükoosaminoglükaane,
5
suradistat,
suramiini,
tallimustiini,
tasaroteeni,
tekogalaannaatriumi,
inhibiitoreid,
temoporfiini,
svainsoniini,
tamoksifeenmetjodiidi,
tegafuuri,
temosolomiidi,
sünteetilisi
tauromustiini,
tellurapürüüliumi,
teniposiidi,
telomeraasi
tetraklorodekaoksiidi,
tetrasomiini, taliblastiini, tiokoraliini, trombopoetiini, trombopoetiini mimeetikumi,
tümalfasiini,
tümopoetiiniretseptori
agonisti,
tümotrinaani,
türoidnääret
stimuleerivat hormooni, tinaetüületiopurpuriini, tirapasamiini, titanotseenbikloriidi,
10
topsentiini,
toremifeeni,
totipotentsete
tüvirakkude
faktorit,
translatsiooni
inhibiitoreid, tretinoiini, triatsetüüluridiini, tritsiribiini, trimetreksaati, triptoreliini,
tropisetrooni, turosteriidi, türosiinkinaasi inhibiitoreid, türfostiine, UBC inhibiitoreid,
ubenimeksi,
urogenitaalsiinusest
urokinaasiretseptori
15
antagoniste,
saadud
vapreotiidi,
kasvu
inhibeerivat
varioliini
B,
faktorit,
vektorisüsteemi,
erütrotsüütide geeniravi, velaresooli, veramiini, verdiine, verteporfiini, vinorelbiini,
vinksaltiini,
vitaksiini,
vorosooli,
zanoterooni,
zeniplatiini,
zilaskorbi
ja
zinostatiinstimalameeri.
UI
ravimiseks
või
vältimiseks
kasutatavate
raviainete
näited
hõlmavad
propaanteliini, imipramiini, hüosküamiini, oksübutüniini ja ditsüklomiini.
20
Haavandi ravimiseks või vältimiseks kasutatavate raviainete näited hõlmavad
antatsiide, nagu alumiiniumhüdroksiid, magneesiumhüdroksiid, naatriumvesinikkarbonaat
ja
kaltsiumvesinikkarbonaat,
sukralfaat,
vismutiühendeid,
nagu
vismutsubsalitsülaat ja vismutsubtsitraat, H2-antagoniste, nagu tsimetidiin,
ranitidiin, famotidiin ja nisatidiin, H+,K+-ATPaasi inhibiitoreid, nagu omeprasool,
25
iansoprasool ja lansoprasool, karbenoksolooni, misprostooli ja antibiootikume,
nagu tetratsükliin, metronidasool, timidasool, klaritromütsiin ja amoksitsilliin.
IBD ravimiseks või vältimiseks kasutatavate raviainete näited hõlmavad
antikolinergilisi
ravimeid,
difenoksülaati,
loperamiidi,
desodoreeritud
oopiumitinktuuri, kodeiini, laia spektriga antibiootikume nagu metronidasool,
EE-EP 1 648 878 B1
247
sulfasalasiini, olsalasiini, mesalamiini, prednisooni, asatiopriini, merkaptopuriini ja
metotreksaati.
IBS-i ravimiseks või vältimiseks kasutatavate raviainete näited hõlmavad
propanteliini, muskariiniretseptori antagoniste, nagu pirensapiin, metoktramiin,
5
ipratroopium,
tiotroopium,
skopolamiin,
metskopolamiin,
homatropiin,
homatropiinmetüülbromiid ja metanteliin, ning kõhulahtisuse vastaseid ravimeid,
nagu difenoksülaat ja loperamiid.
Sõltuvushäire ravimiseks või vältimiseks kasutatavate raviainete näited hõlmavad
metadooni, desipramiini, amantadiini, fluoksetiini, buprenorfiini, opioidiagonisti,
10
3-fenoksüpüridiini, levometadüülatsetaatvesinikkloriidi ja serotoniini antagoniste.
Parkinsoni tõve ja parkinsonismi ravimiseks või vältimiseks kasutatavate
raviainete näited hõlmavad karbidopat/levodopat, pergoliidi, bromokriptiini,
ropinirooli, pramipeksooli, entakapooni, tolkapooni, selegiliini, amantadiini ja
triheksüfenidüülvesinikkloriidi.
15
Ärevuse ravimiseks või vältimiseks kasutatavate raviainete näited hõlmavad
bensodiasepiine, nagu alprasolaam, brotisolaam, kloordiasepoksiid, klobasaam,
klonasepaam, kloorasepaat, demoksepaam, diasepaam, estasolaam, flumaseniil,
flurasepaam,
halasepaam,
lorasepaam,
midasolaam,
nitrasepaam,
nordasepaam, oksasepaam, prasepaam, kvasepaam, temasepaam ja triasolaam,
20
mittebensodiasepiinseid aineid, nagu buspiroon, gepiroon, ipsapiroon, tiospiroon,
zolpikoon, zolpideem ja zaleploon, trankvilisaatoreid, nagu barbituaadid, näiteks
amobarbitaal,
aprobarbitaal,
butabarbitaal,
butalbitaal,
mefobarbitaal,
metoheksitaal, pentobarbitaal, fenobarbitaal, sekobarbitaal ja tiopentaal, ning
propaandioolkarbamaate, nagu meprobamaat ja tübamaat.
25
Epilepsia ravimiseks kasutatavate raviainete näited hõlmavad karbamasepiini,
etosuktsimiidi, gabapentiini, lamotrigiini, fenobarbitaali, fenütoiini, primidooni,
EE-EP 1 648 878 B1
248
valproehapet, trimetadiooni, bensodiasepiine, γ-vinüül-GABAt, atsetasoolamiidi ja
felbamaati.
Insuldi ravimiseks või vältimiseks kasutatavate raviainete näited hõlmavad
antikoagulante nagu hepariin, trombi lahustavaid aineid, nagu streptokinaas või
5
koe plasminogeeni aktivaator, turset vähendavaid aineid, nagu mannitool või
kortikosteroidid, ja atsetüülsalitsüülhapet.
Epilepsiahoogude
ravimiseks
kasutatavate
raviainete
näited
hõlmavad
karbamasepiini, etosuktsimiidi, gabapentiini, lamotrigiini, fenobarbitaali, fenütoiini,
primidooni,
10
valproehapet,
trimetadiooni,
bensodiasepiine,
γ-vinüül-GABAt,
atsetasoolamiidi ja felbamaati.
Kiheluse ravimiseks või vältimiseks kasutatavate raviainete näited hõlmavad
naltreksooni,
nalmefeeni,
danasooli,
tritsüklilisi
antidepressante,
nagu
amitriptülliin, imipramiin ja doksepiin, antidepressante, nagu allpool toodud,
mentooli,
15
kamprit,
fenooli,
pramoksiini,
kapsaitsiini,
tõrva,
steroide
ja
antihistamiinseid aineid.
Psühhoosi ravimiseks või vältimiseks kasutatavate raviainete näited hõlmavad
fenotiasiine,
nagu
toridasiinvesinikkloriid,
kloorpromasiinvesinikkloriid,
tioksanteene,
nagu
mesoridasiinbesülaat
kloroprotikseen
ja
ja
tiotikseen-
vesinikkloriid, klosapiini, risperidooni, olansapiini, kvetiapiini, kvetiapiinfumaraati,
20
haloperidooli,
haloperidooldekanoaati,
loksapiinsuktsinaati,
molindoon-
vesinikkloriidi, pimosiidi ja ziprasidooni.
Huntingtoni korea ravimiseks või vältimiseks kasutatavate raviainete näited
hõlmavad haloperidooli ja pimosiidi.
ALS-i ravimiseks või vältimiseks kasutatavate raviainete näited hõlmavad
25
baklofeeni, neurotroofseid faktoreid, rilusooli, tisanidiini, bensodiasepiine, nagu
klonasepaan ja dantroleen.
EE-EP 1 648 878 B1
249
Kognitiivsete häirete ravimiseks või vältimiseks kasutatavate raviainete näited
hõlmavad aineid dementsuse ravimiseks või vältimiseks nagu takriin, donepesiili,
ibuprofeeni, antipsühhootilisi ravimeid, nagu tioridasiin ja haloperidool, ning
antidepressante, nagu allpool toodud.
5
Migreeni ravimiseks või vältimiseks kasutatavate raviainete näited hõlmavad
sumatriptaani, metüsergiidi, ergotamiini, kofeiini ja beetablokaatoreid, nagu
propranolool, verapamiil ja divalproeks.
Oksendamise ravimiseks või vältimiseks kasutatavate raviainete näited hõlmavad
5-HT3-retseptori antagoniste, nagu ondansetroon, dolasetroon, granisetroon ja
10
tropisetroon,
dopamiiniretseptori
antagoniste,
nagu
prokloorperasiin,
tietüülperasiin, kloorpromasiin, metoklopramiid ja domperidoon, glükokortikoide
nagu deksametasoon ning bensodiasepiine, nagu lorasepaam ja alprasolaam.
Düskineesia ravimiseks või vältimiseks kasutatavate raviainete näited hõlmavad
reserpiini ja tetrabenasiini.
15
Depressiooni ravimiseks või vältimiseks kasutatavate raviainete näited hõlmavad
tritsüklilisi
antidepressante,
klomipramiin,
desipramiin,
nagu
amitriptülliin,
doksepiin,
imipramiin,
amoksapiin,
bupropioon,
maprotiliin,
nefasadoon,
nortriptüliin, protriptüliin, trasodoon, trimipramiin ja venlafaksiin, selektiivseid
20
serotoniini
tagasihaarde
inhibiitoreid,
fluoksetiin,
fluvoksamiin,
paroksetiin
nagu
ja
tsitalopraam,
setraliin,
(S)-tsitalopraam,
monoamiini
oksüdaasi
inhibiitoreid, nagu isokarboksasiid, pargüliin, fenelsiin ja tranüültsüpromiin, ning
psühhostimulaatoreid, nagu dekstroamfetamiin ja metüülfenidaat.
Piperidiiniühend ja teine raviaine võivad toimida aditiivselt või, ühes teostuses,
sünergistlikult. Ühes teostuses manustatakse piperidiiniühend samaaegselt teise
25
raviainega, näiteks võib manustada koostist, mis sisaldab efektiivses koguses
piperidiiniühendit ja efektiivses koguses teist raviainet. Alternatiivselt võib
samaaegselt manustada koostise, mis sisaldab efektiivses koguses piperidiini-
EE-EP 1 648 878 B1
250
ühendit, ja teise koostise, mis sisaldab efektiivses koguses teist raviainet.
Järgmises teostuses manustatakse piperidiiniühendi efektiivne kogus enne või
pärast
teise
raviaine
efektiivse
koguse
manustamist.
Selles
teostuses
manustatakse piperidiiniühend siis, kui teine raviaine avaldab ome terapeutilist
5
toimet, või manustatakse teine raviaine siis, kui piperidiiniühend avaldab oma
terapeutilist toimet haigusseisundi ravimiseks või vältimiseks.
Leiutisekohane koostis valmistatakse meetodiga, mis hõlmab piperidiiniühendi või
selle farmatseutiliselt vastuvõetava soola ning farmatseutiliselt vastuvõetava
kandja või abiaine segamist. Segamise võib teostada ühendi (või soola) ja
10
farmatseutiliselt vastuvõetava kandja või abiaine segamise tuntud meetoditega.
Ühes teostuses esineb piperidiiniühend koostises efektiivses koguses.
4.9 KOMPLEKTID
Leiutis hõlmab komplekte, mis lihtsustavad piperidiiniühendi manustamist
loomale.
15
Tavaline leiutisekohane komplekt sisaldab piperidiiniühendi üksikannusvormi.
Ühes teostuses on üksikannusvormiks anum, mis võib olla steriilne ja mis
sisaldab piperidiiniühendi efektiivset kogust ning farmatseutiliselt vastuvõetavat
kandjat või abiainet. Komplekt võib lisaks sisaldada etiketti või trükitud juhiseid,
milles
20
õpetatakse
piperidiiniühendi
kasutamist
haigusseisundi
ravimiseks.
Komplekt võib sisaldada veel ka teise raviaine üksikannusvormi, näiteks teist
anumat, mis sisaldab teise raviaine efektiivset kogust ja farmatseutiliselt
vastuvõetavat kandjat või abiainet. Järgmises teostuses sisaldab komplekt
anumat, mis sisaldab efektiivses koguses piperidiiniühendit, efektiivses koguses
teist raviainet ja farmatseutiliselt vastuvõetavat kandjat või abiainet. Teiste
25
raviainete näited hõlmavad eespool loetletuid.
251
EE-EP 1 648 878 B1
Leiutisekohased komplektid võivad sisaldada veel seadet, mis on kasutatav
üksikannusvormide manustamiseks. Sellise seadme näited hõlmavad süstalt,
tilgutuskotti, plaastrit, inhalaatorit ja klüsmikotti.
Järgnevad näited on toodud leiutisest arusaamise hõlbustamiseks.
5
252
EE-EP 1 648 878 B1
5. NÄITED
5.1 NÄIDE 1. PIPERIDIINIÜHENDITE CYE JA EKG SÜNTEESIMINE
253
EE-EP 1 648 878 B1
2-amino-6-fluorobensotiasool (15,0 g, 89,2 mmooli) lahustati DMF-s (100 ml) ja
jahutati lämmastikuatmosfääris temperatuurini umbes 0 °C. Reaktsioonisegule
lisati 1,1-karbonüüldiimidasool (15,2 g, 93,6 mmooli) ja reaktsioonisegu segati
5
temperatuuril umbes 0 °C umbes 1 tund. Seejärel las ti reaktsioonisegul
soojeneda temperatuurini umbes 25 °C ja segati umbes 3 tundi. Seejärel
lahjendati saadud reaktsioonisegu atsetooniga (100 ml) ja filtriti, saades
atsüülimidaksooli A (14,5 g, 55,2 mmooli) kollaka tahke ainena. Atsüülimidaksool
A suspendeeriti veevabas DMF-s (100 ml), saadud suspensioonile lisati
10
1,4-dioksa-8-asaspiro[4,5]dekaan (7,9 g, 55,2 mmooli) ja suspensiooni segati
lämmastikuatmosfääris umbes 1 tund temperatuuril umbes 100 °C. Seejärel
eemaldati lahusti alarõhul, saadud jääk valati naatriumvesinikkarbonaadi 1 M
vesilahusesse ja segati umbes 1 tund. Seejärel reaktsioonisegu filtriti ja filtraat
kuivatati vaakumis. Saadud tahket ainet pesti dietüüleetriga (150 ml), saades
15
ühendi B kollaka tahke ainena (19,0 g, saagis 65%).
EE-EP 1 648 878 B1
254
Ühend B (19,0 g) suspendeeriti etüülatsetaadi (150 ml) ja vesinikkloriidhappe
(50
ml)
segus
ning
kuumutati
tagasijooksul
umbes
4
tundi.
Saadud
reaktsioonisegu jahutati seejärel temperatuurini umbes 25 °C, valati vette
(400 ml) ja saadud lahuse pH reguleeriti kaaliumkarbonaadiga väärtusele üle 10.
5
Saadud lahust ekstraheeriti seejärel etüülatsetaadiga. Etüülatsetaat kuivatati
(MgSO4) ja eemaldati alarõhul, saades tahke aine, mida pesti dietüüleetriga,
saades ühendi valemiga C helekollase tahke ainena (12,0 g, saagis 82%).
n-butüülliitiumi lahusele (1,6 M heksaanis, 6,31 ml, 10,24 mmooli) dietüüleetris
(5 ml) lisati temperatuuril umbes -78 °C lämmastiku atmosfääris tilkhaaval
10
2-bromo-3-metüülpüridiini (1,76 g, 10,24 mmooli) lahus veevabas etüüleetris
(95 ml). Seejärel lasti reaktsioonisegul soojeneda temperatuurini umbes 50 °C ja
segati umbes 1 tund. Saadud segule lisati seejärel tilkhaaval THF-s (15 ml)
lahustatud ühend valemiga C (1 g, 3,41 mmooli) ja segu segati temperatuuril
50 °C umbes 1 tund. Seejärel lõpetati reaktsioon am mooniumkloriidi küllastunud
15
vesilahuse lisamisega temperatuuril umbes 0 °C ja s aadud segu ekstraheeriti
dietüüleetriga. Eetrikiht kuivatati (Na2SO4) ja kontsentreeriti alarõhul, saades
tahke
aine,
mida
puhastati
kiirkromatograafiaga
silikageelkolonnis
(gradientelueerimine etüülatsetaat/heksaan 30/70 kuni 70/30), saades ühendi
EKG valge tahke ainena.
20
Ühendi EKG (0,74 g, 1,92 mmooli) suspensioonile DCM-s (10 ml) lisati
temperatuuril
-78
°C
lämmastikuatmosfääris
tilkhaav al
DAST
(0,62
g,
3,84 mmooli). Seejärel lasti saadud segul soojeneda temperatuurini umbes
-50 °C ja segati umbes 2 tundi. Seejärel lõpetati reaktsioon NaHCO3 küllastunud
vesilahuse lisamisega ja segu ekstraheeriti DCM-ga. DCM kuivatati (Na2SO4) ja
25
DCM eemaldati alarõhul, saades tahke aine, mis puhastati silikageelkolonnis,
elueerides etüülatsetaadi/heksaaniga 30/70, saades ühendi CYE valge tahke
ainena.
Ühendite B, C, EKG ja CYE struktuuri kinnitati 1H-TMR analüüsiga.
255
Ühend B:
EE-EP 1 648 878 B1
1
H-TMR (CDCl3) δ: 9,67 (br s, 1H), 756 (s, 1H), 7,44 (br, s, 1H), 7,23
(d, J = 7,9 Hz, 1H), 3,97 (m, 4H), 2,58 (t, J = 6,2 Hz, 4H), 2,49 (m, 4H) ppm.
Ühend C:
1
H-TMR (CDCl3) δ: 9,44 (br s, 1H), 7,57 (m, 1H), 7,51 (d, J = 6,6 Hz,
1H), 7,17 (m, 1H), 3,95 (t, J = 6,0 Hz, 4H), 2,61 (t, J = 6,0 Hz, 4H) ppm.
5
Ühend EKG:
1
H-TMR (CDCl3) δ: 8,35 (d, J = 4,5 Hz, 1H), 7,78 (dd, J = 4,5, 8,7
Hz, 1H), 7,45 (m, 2H), 7,16 (dd, J = 8,7, 11,6 Hz, 1H), 7,10 (m, 1H), 6,68 (br s,
1H), 4,16 (m, 1H), 3,58 (t, J = 12,4 Hz, 2H), 2,47 (s, 3H), 2,42 (m, 3H), 1,50
(d, J = 12,4 Hz, 2H) ppm.
Ühend CYE:
10
1
H-TMR (CDCl3) δ: 10,40 (br s 1H), 8,32 (d, J = 4,5 Hz, 1H), 7,47
(d, J = 7,7 Hz, 2H), 7,13 (m, 2H), 4,41 (d, J = 12,0, Hz, 2H), 3,44 (t, J = 12,4 Hz,
2H), 2,47 (s, 3H), 2,36 (m, 3H), 2,07 (t, J = 12,4 Hz, 2H) ppm.
5.2 NÄIDE 2. PIPERIDIINIÜHENDITE AYH JA AMT SÜNTEESIMINE
Ühendid AYH ja AMT saadi meetodiga, mis on analoogne sellega, mida kasutati
ühendite EKG ja CYE saamiseks, nagu on kirjeldatud eespool näites 1, välja
15
arvatud see, et 2-amino-6-fluorobensotiasooli asemel kasutati 4-tert-butüülaniliini.
5.3 NÄIDE 3. PIPERIDIINIÜHENDITE EKE JA CYC SÜNTEESIMINE
Ühendid EKE ja CYC saadi meetoditega, mis on analoogsed nendega, mis on
eespool kirjeldatud.
Ühendite EKE ja CYC struktuuti kinnitati 1H-TMR-i ja mass-spektromeerilise (MS)
20
analüüsiga.
Ühend EKE: 1H-TMR (CDCl3) δ: 8,40 (dd, J = 1,0, 4,7 Hz, 1H), 7,77 (d, J = 2,0
Hz, 1H), 7,59 (d, J = 8,6 Hz, 1H), 7,55 (dd, J = 0,8, 7,6 Hz, 1H), 7,36 (dd, J = 2,0,
8,6 Hz, 1H), 7,22 (dd, J = 4,7, 7,6 Hz, 1H), 6,75 (br s, 1H), 4,20 (m, 2H), 3,64
EE-EP 1 648 878 B1
256
(t, J = 12,2 Hz, 2H), 2,50 (s, 3H), 2,40 (dt, J = 4,9, 13,1 Hz, 2H), 1,73 (br s, 1H),
1,58 (d, J = 12,7 Hz, 2H) ppm.
MS: 403,2 m/z (m+1).
Ühend CYC: 1H-TMR (CDCl3) δ: 9,24 (br s, 1H), 8,36 (d, J = 4,6 Hz, 1H), 7,77
5
(d, J = 2,0 Hz, 1H), 7,56 (d, J = 8,6 Hz, 1H), 7,50 (d, J = 7,6 Hz, 1H), 7,37
(dd, J = 2,0, 8,6 Hz, 1H), 7,15 (dd, J = 4,7, 7,6 Hz, 1H), 4,15 (m, 2H), 3,48
(t, J = 12,7 Hz, 2H), 2,52 (d, J = 5,9 Hz, 3H), 2,17 (dt, J = 1,6, 9,9 Hz, 2H), 1,67
(m, 2H) ppm.
MS: 405,1 m/z (m+1).
5.4 NÄIDE 4. PIPERIDIINIÜHENDITE SEONDUMINE mGluR5-ga
10
Selleks, et näidata piperidiiniühendite seondumist mGluR5-ga ja seega nende
kasulikkust näiteks valu ravimises ja vältimises, võib kasutada järgmist testi.
Rakukultuurid. Gliiarakkude primaarkultuur valmistatakse Sprague- Dawley
rottide 18-päevaste embrüote suurajukoorest. Suurajukoored tükeldatakse ja
15
homogeniseeritakse tritureerimisega. Saadud rakuhomogenaat külvatakse polüD-lüsiiniga kaetud T175 plaatidele (Biocoat, kaubanduslikult saadaval firmast
Becton
Dickinson
and
Company
Inc.,
Franklin
Lakes,
NJ)
Dulbecco
modifitseeritud Eagle söötmesse (DMEM, pH 7,4), mis on puhverdatud 25 mM
HEPES-ga ja täiendatud 15% vasikaloote seerumiga (FCS, kaubanduslikult
20
saadaval firmast Hyclone Laboratories Inc. Omaha, NE) ning inkubeeritakse
temperatuuril 37 °C ja 5% CO2 atmosfääris. 24 tunni pärast vähendatakse FCS-i
lisandit 10%-ni. Kuuendal päeval eemaldatakse oligodendrotsüüdid ja mikrogliia
tugeva kopsimisega vastu pudelite külgi. Üks päev pärast seda puhastamisetappi
tehakse järgmised astrotsüütide kultuurid, külvates need polü-D-lüsiiniga kaetud
25
96 süvendiga T175 plaatidele (Biocoat) tihedusega 65 000 rakku/süvendi kohta
DMEM-i, mis sisaldab 10% FCS-i. 24 tunni pärast pestakse astrotsüüte
257
EE-EP 1 648 878 B1
seerumivaba söötmega ja seejärel kultiveeritakse temperatuuril 37 °C ja 5% CO2
atmosfääris ilma glutamaadita DMEM-is, millele on lisatud 0,5% FCS-i, 20 mM
HEPES-t, 10 ng/ml epidermaalset kasvufaktorit (EGF), 1 mM naatriumpüruvaati
ja 1-kordset penitsilliini/streptomütsiini lahust (pH 7,5). Meetod võimaldab
5
mGluR5 ekspresseerimist astrotsüütide poolt, nagu on näidanud S. Miller et al.
ajakirjas Neuroscience, 1995, 15 (9), 6103-6109.
Testimise eeskiri. Pärast 3-5-päevast inkubeerimist EGF-ga pestakse astrotsüüte
lahusega, mis sisaldab 127 mM NaCl, 5 mM KCI, 2 mM MgCl2, 700 mM
NaH2PO4, 2 mM CaCl2, 5 mM NaHCO3, 8 mM HEPES-t, 10 mM glükoosi (pH 7,4)
10
(proovipuhver) ja lisatakse Fluo-4 värvi (kaubanduslikult saadaval firmsast
Molecular Probes Inc. of Eugene, OR), kasutades 0,1 ml Fluo-4 sisaldavat
proovipuhvrit (lõppkontsentratsioon 3 mM). 90 minutit pärast värvi lisamist
pestakse rakke kaks korda 0,2 ml proovipuhvriga ja resuspendeeritakse 0,1 ml
proovipuhvris. Seejärel pannakse astrotsüüte sisaldavad plaadid seadmesse
15
Fluorometric Imaging Plate Reader (FLIPR, kaubanduslikult saadaval firmast
Molecular Devices Corporation of Sunnyvale, CA), et määrata kaltsiumi
sissevoolu glutamaadi manulusel ja antagonisti manulusel või puudumisel. Pärast
fluorestsentsi jälgimist 15 sekundit, et kindlaks teha algtase, lisatakse
rakukultuuriplaadile DMSO lahused, mis sisaldavad proovipuhvris mitmesugustes
20
kontsentratsioonides lahjendatud piperidiiniühendit (konkureeriva seondumise
kõverate puhul 0,05 ml 4-kordseid lahjendusi) ja fluorestsentsi jälgitakse 2 minuti
jooksul. Seejärel lisatakse igasse süvendisse 0,05 ml 4-kordset glutamaadilahust
(agonist), saades glutamaadi lõppkontsentratsiooniks igas süvendis 10 mM.
Pärast agonisti lisamist jälgitakse fluorestsentsi plaatidel veel 60 sekundit. DMSO
25
lõppkontsentratsioon testis on 1,0%. Igas testis määratakse fluorestsents aja
funktsioonina ning andmeid analüüsitakse programmidega Microsoft Excel ja
GraphPad Prism. IC50 määramiseks joonistatakse annuse-vastuse kõverad,
kasutades mittelineaarset regressiooni. Igas testis määratakse iga andmepunkt
kaks korda.
30
Selleks, et näidata piperidiiniühendite seondumist mGluR5-ga, võib alternatiivselt
kasutada järgmist testi.
EE-EP 1 648 878 B1
258
96 süvendiga plaadile (Costar 3409, mustad läbipaistva põhjaga, 96 süvendit,
koekultuuriga töödeldud) külvatakse 40 000 roti GluR5 ekspresseerivat CHO
rakku süvendi kohta ja inkubeeritakse üleöö Dulbecco modifitseeritud Eagle
söötmes
5
(DMEM,
pH
7,4),
millele
on
lisatud
glutamiini,
10%
FBS-i,
1% penitsilliini/streptomütsiini lahust ja 500 µg/ml genetitsiini. Enne rakkude
laadimist pestakse ja töödeldakse roti mGluR5 ekspresseerivaid CHO rakke
Optimem
söötmega
ning
inkubeeritakse
1-4
tundi.
Seejärel
pestakse
rakukultuuriplaate laadimispuhvriga (127 mM NaCl, 5 mM KCI, 2 mM MgCl2,
700 µM NaH2PO4, 2 mM CaCl2, 5 mM NaHCO3, 8 mM HEPES-t ja 10 mM
10
glükoosi, pH 7,4) ja inkubeeritakse 3 µM Fluo-4 värviga (kaubanduslikult saadaval
firmast Molecular probes Inc., Eugene, OR) 0,1 ml laadimispuhvris. 90 minutit
pärast värvi lisamist pestakse rakke kaks korda 0,2 ml laadimispuhvriga ja
resuspendeeritakse 0,1 ml laadimispuhvris.
Roti mGluR5 ekspresseerivaid CHO rakke sisaldavad plaadid viiakse seadmesse
15
FLIPR, et määrata kaltsiumi sissevool glutamaadi manulusel ja testitavate
ühendite manulusel või puudumisel. Pärast fluorestsentsi määramist 15 sekundi
jooksul, et kindlaks teha algtase, lisatakse rakukultuuri plaatidele DMSO lahust,
mis sisaldavad laadimispuhvris mitmesugustes kontsentratsioonides lahjendatud
testitavat ühendit (konkureerivate kõverate puhul 0,05 ml 4-kordseid lahjendusi)
20
ja fluorestsents määratakse 2 minuti jooksul. Seejärel lisatakse igasse
süvendisse 0,05 ml 4-kordset glutamaadilahust (agonist), et saada glutamaadi
lõppkontsentratsiooniks igas süvendis 10 µM. Pärast agonisti lisamist määratakse
fluorestsentsi plaatidel veel 60 sekundi jooksul. DMSO lõppkontsentratsioon testis
on 1,0%. Igas testis määratakse fluorestsents aja funktsioonina ning andmeid
25
analüüsitakse
programmidega
Microsoft
Excel
ja
GraphPad
Prism.
IC50 määramiseks joonistatakse annuse-vastuse kõverad, kasutades mittelineaarset regressiooni. Igas testis määratakse iga andmepunkt kaks korda.
EE-EP 1 648 878 B1
259
5.5 NÄIDE 5. VALU VÄLTIMISE VÕI RAVIMISE TESTIMINE IN VIVO
Testitavad loomad. Igas katses kasutatakse rotte kehamassiga katse alguses
vahemikus 200-260 g. Rotid pannakse gruppidena puuridesse ja neil on kogu aeg
vaba juurdepääs toidule ning veele, välja arvatud enne piperidiiniühendi
5
suukaudset manustamist, siis võetakse toit ära 16 tundi enne manustamist.
A.
Kontrollrühma
kasutatakse
võrdluseks
piperidiiniühendiga
ravitavatele
rottidele. Kontrollrühmale manustatakse piperidiiniühendi kandjat. Kontrollrühmale
manustatava kandja kogus on samasugune kui testitavale rühmale manustatav
piperidiiniühendi kogus.
10
Äge valu. Selleks, et hinnata piperidiiniühendite toimet ägeda valu vältimises ja
ravis, kasutatakse sabavibutustesti. Rotid pannakse puuvillasest riidest kotti ja
5 cm kaugusele saba otsast suunatakse soojusallikast tulev kiir, kasutades
sabavibutuse seadet (Model 7360, kaubanduslikult saadaval firmast Ugo Basile,
Itaalia). Sabavibutuse latentsusajad määratletakse intervallina soojusärrituse
15
alguse ja sabavibutuse alguse vahel. Loomad, kes ei reageeri 20 sekundi jooksul,
kõrvaldatakse sabavibutuse seadmest ja määratakse eemaldamise latentsusajaks 20 sekundit. Sabavibutuse latentsusajad määratakse vahetult enne
(ravieelne) ja 1, 3 ja 5 tundi pärast piperidiiniühendi manustamist. Andmed
väljendatakse
20
sabavibutuse
latentsusajana
(aegadena)
ja
protsent
maksimaalsest võimalikust toimest (% MPE-st, maximal possible effect), s.t
20 sekundit, arvutatakse järgmiselt:
% MPE - st =
[(manustam isjärgne latentsusa eg) - (manustami seelne latentsusa eg)]
x 100
(20 - sekundilin e manustamis eelne latentsusa eg)
Sabavibutustesti on kirjeldanud F. E. D'Amour et al., A Method for Determining
25
Loss of PainSensation, J. Pharmacol. Exp. Ther., 1941, 72, 74-79.
EE-EP 1 648 878 B1
260
Ägedat valu võib hinnata ka looma reaktsiooni määramisega kahjustavale
mehhaanilisele ärritajale, mõõtes käpa äratõmbamise läve (paw withdrawal
threshold, PWT), nagu on kirjeldatud allpool.
Põletikust tingitud valu. Selleks, et hinnata piperidiiniühendite toimeid põletikust
5
tingitud
valu
ravimises
või vältimises, kasutatakse põletikuvalu
Freundi
täisadjuvandi (Freund’s complete adjuvant, FCA) mudelit. FCA põhjustatud
põletiku
toimel
tekib
roti
käpas
püsiv
põletikust
tingitud
mehhaaniline
hüperalgeesia ja see on kliiniliselt kasulike analgeetiliste ravimite hüperalgeesiavastase toime usaldusväärne ennustaja (L. Bartho et al., Involvement of
10
Capsaicin-sensitive
Antinociception
Pharmacology,
Neurones
in
in
Inflammation,
1990,
342,
Hyperalgesia
and
Enhanced
Naunyn-Schmiedeberg's
666-670).
Iga
looma
Opioid
Archives
vasakusse
of
tagakäppa
manustatakse intraplantaarse süstimise teel 50 µl 50% FCA-d. 24 tundi pärast
süstimist hinnatakse loomade vastust kahjustavale mehhaanilisele ärritajale,
15
määrates PWT, nagu allpool on kirjeldatud. Rottidele süstitakse üks kord 1, 3, 10
või 30 mg/kg kas piperidiiniühendit, 30 mg/kg kontrollühendit, mis valitakse
tselebreksi, indometatsiini või naprokseeni hulgast, või kandjat. Seejärel
määratakse 1, 3, 5 ja 24 tundi pärast manustamist vastused kahjulikule
mehhaanilisele ärritajale. Hüperalgeesia kõrvaldamist protsentides igal loomal
20
määratletakse järgmiselt:
Kõrvaldami ne (%) =
[(manustam isjärgne PWT) - (manustami seelne PWT)]
x 100
[(algtasem e PWT) - (manustami seelne PWT)]
Neuropaatiline valu. Selleks, et hinnata piperidiiniühendite toimet neuropaatilise
valu ravimises või vältimises, võib kasutada kas Seltzeri mudelit või Chungi
mudelit.
25
Seltzeri mudelis kasutatakse neuropaatilise hüperalgeesia tekitamiseks rottidel
neuropaatilise valu mudelina istmikunärvi osalise ligeerimise mudelit (Z. Seltzer et
al., A Novel Behavioral Model of Neuropathic Pain Disorders Produced in Rats by
Partial Sciatic Nerve Injury, Pain, 1990, 43, 205-218). Vasaku istmikunärvi osaline
EE-EP 1 648 878 B1
261
ligeerimine toimub isofluraani/O2 inhalatsioonianesteesia all. Pärast anesteesia
esilekutsumist puhastatakse roti vasak reis karvadest, väikese sisselõike abil reie
ülaosas tuuakse nähtavale istmikunärv ja puhastatakse hoolikalt ümbritsevast
sidekoest pöörli lähedal distaalselt kohaga, kus tagumise kakspealihase ja
5
poolkõõluslihase närvid saavad alguse ühisest istmikunärvist. Siidniit 7-0
sisestatakse närvi kõvera (3/8 ringi) välisservaga lõikava (reversed-cutting)
mininõelaga ja ligeeritakse tugevalt nii, et dorsaalselt jääb ligatuuri sisse 1/3 kuni
1/2 närvi paksusest. Haav suletakse ühe lihaseõmblusega (4-0 nailon (Vicryl)) ja
Vetbond
10
koeliimiga.
antibiootikumipulbriga.
Pärast
kirurgiat
Simuleeritud
puuderdatakse
operatsiooni
puhul
haava
teevad
ümbrust
rotid
läbi
samasuguse kirurgilise protseduuri, välja arvatud see, et istmikunärviga ei
manipuleerita. Pärast kirurgiat loomad kaalutakse ja pannakse kuni anesteesiast
taastumiseni soojenduspadjale. Seejärel pannakse loomad kuni käitumiskatsete
tegemiseni
15
tagasi
puuridesse.
Loomadel
hinnatakse
vastust
kahjulikule
mehhaanilisele ärritajale PWT määramisega, nagu on kirjeldatud allpool, enne
kirurgiat (algtase), seejärel vahetult enne ning 1, 3 ja 5 tundi pärast
piperidiiniühendi manustamist looma vasakusse tagakäppa. Neuropaatilise
hüperalgeesia kõrvaldamine protsentides määratletakse järgmiselt:
Kõrvaldami ne (%) =
20
[(manustam isjärgne PWT) - (manustami seelne PWT)]
x 100
[(algtasem e PWT) - (manustami seelne PWT)]
Chungi mudelis kasutatakse mehhaanilise hüperalgeesia, termilise hüperalgeesia
ja taktiilse allodüünia tekitamiseks rottidel neuropaatilise valu mudelina
spinaalnärvi ligeerimise mudelit. Kirurgiline protseduur viiakse läbi isofluraani/O2
inhalatsioonianesteesia all. Pärast anesteesia esilekutsumist tehakse 3 cm
sisselõige ja vasakpoolsed paraspinaalsed lihased eraldatakse ogajätke küljest
25
L4-S2 spinaalnärvide tasemel. L6 nimmelüli ristjätke eemaldatakse ettevaatlikult
väikeste tangidega, et visuaalselt kindlaks teha L4-L6 spinaalnärvid. Vasak L5
(või L5 ja L6) spinaalnärv isoleeritakse ja ligeeritakse tugevalt siidniidiga.
Veendutakse verejooksu täielikus lakkamises ja haav õmmeldakse kinni,
kasutades mitteimenduvat õmblusmaterjali, nagu nailonniit, või roostevabast
30
terasest klambreid. Simuleeritud operatsiooni puhul teevad rotid läbi samasuguse
262
EE-EP 1 648 878 B1
kirurgilise protseduuri, välja arvatud see, et spinaalnärvi(de)ga ei manipuleerita.
Pärast kirurgiat loomad kaalutakse, neile manustatakse subkutaanse (s.c.)
süstimise teel soolalahust või Ringeri laktaadilahust, haavapiirkonda puuderdatakse antibiootikumipulbriga ja loomi hoitakse anesteesiast taastumiseni soojen5
duspadjal. Seejärel pannakse loomad kuni käitumiskatsete tegemiseni tagasi
puuridesse. Loomadel hinnatakse vastust kahjulikule mehhaanilisele ärritajale
PWT määramisega, nagu on kirjeldatud allpool, vahetult enne ja 1, 3 ja 5 tundi
pärast piperidiiniühendi manustamist looma vasakusse tagakäppa. Samuti hinnatakse loomadel vastust kahjulikule termilisele ärritajale või taktiilse allodüünia
10
suhtes, nagu allpool on kirjeldatud. Neuropaatilise valu Chungi mudelit kirjeldab
S. H. Kim artiklis An Experimental Model for Peripheral Neuropathy Produced by
Segmental Spinal Nerve Ligation in the Rat (Pain, 1992, 50 (3), 355-363).
Vastus mehhaanilisele ärritajale mehhaanilise hüperalgeesia hindamisega.
Mehhaanilise hüperalgeesia hindamiseks võib kasutada käpale surve avaldamise
15
testi. Selles testis määratakse kahjulike mehhaaniliste ärritajate toimel tagakäpa
äratõmbamise lävi (paw withdrawal threshold, PWT) analgesimeetriga (Model
7200, kaubanduslikult saadaval firmast Ugo Basile, Itaalia), nagu on kirjeldanud
C. Stein artiklis Unilateral Inflammation of the Hindpaw in Rats as a Model of
Prolonged Noxious Stimulation: Alterations in Behavior and Nociceptive
20
Thresholds (Pharmacology, Biochemistry and Behavior, 1988, 31, 451-455).
Maksimaalne
koormus,
mida
võib
tagakäpale
rakendada,
seadistatakse
250 grammile ja lõpp-punktiks võetakse käpa täielik äratõmbamine. PWT määratakse igal rotil igal ajamomendil üks kord ja testitakse ainult ärritajaga mõjutatud
(samapoolset) käppa.
25
Vastus termilisele ärritajale termilise hüperalgeesia hindamisega. Termilise
hüperalgeesia hindamiseks võib kasutada plantaartesti. Selles testis määratakse
kahjuliku termilise ärritaja tõttu käpa äratõmbamise latentsusaeg meetodiga, mida
on kirjeldanud K. Hargreaves et al. artiklis A New and Sensitive Method for
Measuring Thermal Nociception in Cutaneous Hyperalgesia (Pain, 1988, 32 (1),
30
77-88), kasutades plantaartesti seadet (kaubanduslikult saadaval firmast Ugo
Basile, Itaalia). Maksimaalne ekspositsiooniaeg seadistatakse koekahjustuse
263
EE-EP 1 648 878 B1
vältimiseks 32 sekundile ja lõpp-punktiks loetakse käpa mis tahes suunas
äratõmbamine soojusallikalt. Igal ajamomendil määratakse kolm latentsusaega ja
võetakse nende keskmine. Testitakse vaid ärritajaga mõjutatud (samapoolset)
käppa.
5
Taktiilse allodüünia hindamine. Taktiilse allodüünia testimiseks pannakse rotid
läbipaistvasse traatvõrgust põrandaga pleksiklaasist puuridesse ja lastakse
kohaneda vähemalt 15 minutit. Pärast kohanemist puudutatakse rea von Frey
jõhvidega iga roti vasaku käpa (opereeritud) talda. Von Frey jõhvide rida koosneb
kuuest suureneva diameetriga jõhvist, millest kõigepealt kasutatakse kõige
10
väiksema diameetriga jõhvi. Iga jõhviga tehakse igas uuringus viis 2-minutilise
vahega testi. Iga test kestab 4-8 sekundit või kuni täheldatakse notsitseptiivset
äratõmbamiskäitumist. Võpatamist, käpa äratõmbamist või käpa lakkumist
loetakse notsitseptiivseks käitumisreaktsiooniks.
5.6 NÄIDE 6. ÄREVUSE VÄLTIMISE VÕI RAVIMISE TESTIMINE IN VIVO
15
Piperidiiniühendite anksiolüütilise toime hindamiseks rottidel või hiirtel võib
kasutada tõstetud pluss-puuri testi või šokianduri peitmise testi.
Tõstetud pluss-puuri test. Tõstetud pluss-puur koosneb 4-haaraga platvormist,
kaks haara on avatud ja kaks suletud (50 x 10 x 50 cm, lisaks avatud katus).
Rotid (hiired) pannakse platvormi keskele 4 haara ristumiskohale näoga ühe
20
suletud haara poole. Testimisperioodi jooksul registreeritakse avatud haarades ja
suletud haarades veedetud aeg ning avatud haaradesse sisenemiste arv. See
test viiakse läbi enne ravimi manustamist ja seejärel pärast ravimi manustamist.
Testi tulemused väljendatakse avatud haarades veedetud keskmise ajana ja
avatud haaradesse sisenemiste keskmise arvuna. Tuntud anksiolüütilised ravimid
25
suurendavad nii avatud haarades veedetud aega kui ka avatud haaradesse
sisenemiste arvu. Tõstetud pluss-puuri testi kirjeldab D. Treit artiklis Animal
Models for the Study of Anti-anxiety Agents: A Review (Neuroscience &
Biobehavioral Reviews, 1985, 9 (2), 203-222).
264
EE-EP 1 648 878 B1
Šokianduri peitmise test. Šokianduri peitmise testi testimisseade koosneb
pleksiklaasist puurist mõõtmetega 40 x 30 x 40 cm, mis on ühtlaselt kaetud
umbes 5 cm allapanumaterjaliga (lõhna imav kassiallapanu), ja mille ühes otsas
on väike auk šokianduri sisestamiseks (pikkus 6,5 cm ja diameeter 0,5 cm).
5
Pleksiklaasist šokianduri ümber keeratakse spiraalselt kaks vasktraati, mille
kaudu lastakse sisse elektrivool. Voolutugevus seadistatakse väärtusele 2 mA.
Rottidel lastakse 4 järjestikusel päeval testimisseadmes kohaneda 30 minutit ilma
šokiandurit puuri viimata. Testimise päeval pannakse rotid testimiskambri ühte
nurka, seejärel manustatakse ravimit. Andurisse ei lasta elektrivoolu seni, kuni
10
rott seda oma koonu või esikäpaga puudutab, sel momendil saab rott lühikese
2 mA elektrišoki. Viieteistminutiline testimisperiood algab siis, kui rott saab oma
esimese elektrišoki ja andur jääb voolu alla kogu ülejäänud testimisperioodiks.
Elektrišokk kutsub rotil esile peitmiskäitumise. Pärast esimest elektrišokki
määratakse aeg, mille jooksul rott lükkab oma koonu või esikäppadega laiali-
15
puistatud allapanumaterjali anduri suunas või selle peale (peitmiskäitumine),
samuti kontaktist anduriga saadud elektrišokkide arv. Tuntud anksiolüütikumid
vähendavad peitmiskäitumise määra. Peale selle määratakse 4-punktilisel skaalal
roti reaktiivsuse indeks iga elektrišoki puhul. Üldise aktiivsuse indeksina
kasutatakse kogu aega, mis veedeti 15-minutilise testimisperioodi jooksul
20
liikumatult. Šokianduri peitmise testi kirjeldab D. Treit, 1985 (ülalpool).
5.7 NÄIDE 7. SÕLTUVUSHÄIRE VÄLTIMISE VÕI RAVIMISE TESTIMINE IN
VIVO
Selleks, et määrata piperidiiniühendite võimet vähendada tuntud narkootikumide
hüvituskäitumist tingivaid omadusi, võib kasutada tingitud kohaeelistuse või
25
ravimi isemanustamise testi.
Tingitud kohaeelistuse test. Tingitud kohaeelistuse testi seade koosneb kahest
suurest kastist (45 x 45 x 30 cm), mis on tehtud puust ja mille esisein on
pleksiklaasist. Need kaks suurt kasti on suuresti erinevad. Uksed mõlema suure
kasti tagapoolel viivad väiksemasse kasti (36 x 18 x 20 cm), mis on tehtud puust,
30
värvitud halliks ja mille lagi on traatvõrgust. Kaks suurt kasti erinevad üksteisest
EE-EP 1 648 878 B1
265
tooni (hele ja tume), valgustustaseme (heleda kasti pleksiklaasist uks kaetakse
alumiiniumfooliumiga, välja arvatud 7 x 7 cm suurune aken), struktuuri (heledal
kastil on 3 cm paksusega põrandaplaat (40 x 40 cm), milles on 9 võrdselt
paigutatud 5 cm diameetriga auku ja tumedal kastil on traatvõrgust põrand) ja
5
haistmisärritaja poolest (heledas kastis on soolalahus ja tumedas kastis 1 ml 10%
äädikhapet). Kohanemise ja testimise päevadel jäävad uksed väikesesse kasti
avatuks, võimaldades rotil vaba pääsu mõlemasse suurde kasti.
Esimene seanss, kui rott pannakse seadmesse, on kohanemisseanss ja
sissepääsud väiksemasse halli kasti jäävad avatuks, võimaldades rotil vabalt
10
pääseda mõlemasse suurde kasti. Kohanemise ajal ei näita rotid üldiselt eelistust
kummagi kasti suhtes. Pärast kohanemist viiakse rotiga läbi 6 kohaeelistuse
tingimise seanssi. Rotid jagatakse 4 gruppi:
kandja eelnev manustamine +
kandja (kontrollgrupp), piperidiiniühendi eelnev manustamine + kandja, kandja
eelnev manustamine + morfiin, piperidiiniühendi eelnev manustamine + morfiin.
15
Iga kohaeelistuse tingimise seansi ajal süstitakse rotile ühte ravimikombinatsiooni
ta suletakse 30 minutiks ühte suurde kasti. Järgmisel päeval toimub rotile kandja
eelnev manustamine + kandja manustamine ja ta suletakse teise suurde kasti.
Iga rotiga viiakse läbi kolm kohaeelistuse tingimise seanssi, mis koosnevad kolme
ravimikombinatsiooni manustamisest-kastipaarist ja 3 kandja manustamisest-
20
kastipaarist. Süstimisjärjekord ja ravimi/kastipaarid on gruppide vahel tasakaalus.
Testimise päeval süstitakse rottidele enne testi (30 minutit kuni 1 tund) kas
morfiini või kandjat ja rotid pannakse seadmesse, uksed halli kasti jäävad avatuks
ja rotil võimaldatakse tutvuda kogu seadmega 20 minutit. Registreeritakse igas
kastis veedetud aeg. Tuntud narkootikumid pikendavad testimisseansil aega, mis
25
veedetakse narkootikumi manustamisega seotud kastis. Kui piperidiiniühendid
blokeerivad morfiinist tingitud kohaeelistuse (käitumist tingivat) omandamist, siis
eelnevalt piperidiiniühendit saanud rottidel ei olnud erinevusi ajas, mis veedeti
kummaski kastis ja grupp ei ole erinev sellest rottide grupist, mis sai kandjat +
kandjat mõlemas kastis. Andmeid analüüsitakse igas kastis veedetud ajana
30
(ravimikombinatsiooniga seotud kast versus kandjaga seotud kast). Üldiselt
korratakse testi vähemalt 3 piperidiiniühendi annusega.
EE-EP 1 648 878 B1
266
Ravimi isemanustamise test. Ravimi isemanustamise seade on standardne
kaubanduslikult saadaval operantse tingitud käitumise kast. Enne ravimi testimise
algust õpetatakse rotte vajutama toidu saamiseks kangile. Pärast seda, kui
stabiilne
5
kangile
narkootikumi
vajutamise
saamiseks
käitumine
kangile
on
vajutamise
kätteõpitud,
õppimise
testitakse
suhtes.
rotte
Rottidele
implanteeritakse kägiveeni püsikateeter ühendite i.v. manustamiseks ja neil
lastakse taastuda enne õppimise algust 7 päeva Testimisseansid viiakse läbi iga
päev 5 päeva jooksul 3-tunniste seanssidena. Rotte õpetatakse ise manustama
tuntud narkootikume, nagu morfiin. Seejärel näidatakse rottidele kahte kangi
10
“aktiivset” kangi ja “mitteaktiivset” kangi. Aktiivsele kangile vajutamisel saab rott
narkootikumi infusiooni fikseeritud vahekorras 1 (fixed ratio, FR1) skeemi järgi
(s.t üks vajutus annab infusiooni), järgneb 20-sekundiline ooteaeg (seda näitab
valguse ilmumine kangide kohal). Mitteaktiivsele kangile vajutamisel saab rott
abiaine infusiooni. Õpetamine jätkub, kuni morfiini infusioonide koguarv jääb
15
püsima vahemikku ± 10% seansi kohta. Seejärel kasutatakse treenitud rotte
selleks, et hinnata piperidiiniühendite eelneva manustamise toimet ravimi
isemanustamisele. Testimispäeval manustatakse rottidele eelnevalt piperidiiniühendit või abiainet ja seejärel lastakse isemanustada narkootikumi, nagu
tavaliselt. Kui piperidiiniühend blokeerib morfiinist tingitud käitumuslikke toimeid,
20
siis piperidiiniühendit eelnevalt saanud rottidel oli vastuste määr madalam
võrreldes nende esialgsete vastuste määraga ja võrreldes eelnevalt abiainet
saanud rottidega. Andmeid analüüsitakse narkootikumi infusioonide arvu
muutusena
testimisseansi
kohta
(infusioonide
arv
testimisseansi
ajal
–
infusioonide arv õpetamisseansi ajal).
25
5.8 NÄIDE 8. FUNKTSIONAALNE TEST mGluR1 ANTAGONISEERIVATE
OMADUSTE ISELOOMUSTAMISEKS
Funktsionaalne test mGluR1 antagoniseerivate omaduste iseloomustamiseks on
tehnika tasemest tuntud. Võib kasutada näiteks järgmist meetodit.
Roti mGluR1 ekspresseeriv CHO rakuliin luuakse, kasutades roti mGluR1
30
retseptorit kodeerivat cDNA-d (M. Masu, S. Nakanishi, Nature, 1991, 349,
EE-EP 1 648 878 B1
267
760-765). Roti mGluR1 retseptorit kodeeriva cDNA võib saada näiteks
professorilt S. Nakanishi (Kyoto, Jaapan).
Koekultuuriga töödeldud mustadele läbipaistva põhjaga 96 süvendiga plaadile
Costar 3409 (kaubanduslikult saadaval firmast Fisher Scientific of Chicago, IL)
5
külvatakse 40 000 roti GluR1 ekspresseerivat CHO rakku süvendi kohta ja
inkubeeritakse umbes 12 tundi Dulbecco modifitseeritud Eagle söötmes
(DMEM,
pH
7,4),
millele
on
lisatud
glutamiini,
10%
FBS-i,
1%
penitsilliini/streptomütsiini lahust ja 500 µg/ml genetitsiini. Enne rakkude laadimist
Fluo-4 värviga (kaubanduslikult saadaval firmast Molecular Probes Inc.,
10
Eugene OR) pestakse ja töödeldakse roti mGluR1 ekspresseerivaid CHO rakke
Optimem söötmega (kaubanduslikult saadaval firmast Invitrogen, Carlsbad, CA)
ja seejärel inkubeeritakse 1-4 tundi. Pärast inkubeerimist pestakse rakukultuuri
plaate laadimispuhvriga (127 mM NaCl, 5 mM KCl, 2 mM MgCl2, 700 µM
NaH2PO4, 2 mM CaCl2, 5 mM NaHCO3, 8 mM HEPES-t ja 10 mM glükoosi,
15
pH 7,4) ja inkubeeritakse 90 minutit 3 µM Fluo-4 värviga 0,1 ml laadimispuhvris.
Seejärel pestakse rakke kaks korda 0,2 ml laadimispuhvriga, resuspendeeritakse
0,1 ml laadimispuhvris ja viiakse seadmesse FLIPR, et määrata kaltsiumi
sissevoolu glutamaadi manulusel ja piperidiiniühendite manulusel või puudumisel.
Kaltsiumi sissevoolu määramiseks jälgitakse fluorestsentsi umbes 15 sekundi
20
jooksul, et kindlaks teha algtase ja rakukultuuri plaatidele lisatakse DMSO
lahused, mis sisaldavad mitmesugustes kontsentratsioonides vahemikus umbes
50 µM kuni umbes 0,8 nM laadimispuhvris lahjendatud piperidiiniühendit (0,05 ml
4-kordset lahjendust) ning fluorestsentsi jälgitakse 2 minuti jooksul. Seejärel
lisatakse igasse süvendisse 0,05 ml 4-kordset glutamaadilahust (agonist), saades
25
glutamaadi lõppkontsentratsiooniks igas süvendis 10 µM ning fluorestsentsi
plaatidel jälgitakse pärast agonisti lisamist veel 1 minut. DMSO lõppkontsentratsioon
testis
on
1%.
Igas
testis
jälgitakse
fluorestsentsi
aja
funktsioonina ja andmeid analüüsitakse IC50 väärtuse määramiseks mittelineaarse regressiooniga. Igas testis määratakse iga andmepunkt kaks korda.
30
EE-EP 1 648 878 B1
268
5.9 NÄIDE 9. PIPERIDIINIÜHENDITE SEONDUMINE VR1-ga
VR1-retseptorit inhibeerima võimeliste ühendite testimismeetodid on vastava ala
asjatundjatele tuntud, neid meetodeid on kirjeldatud näiteks US patendis
6,239,267 (Duckworth et al.), US patendis 6,406,908 (McIntyre et al.) või
5
US patendis 6,335,180 (Julius et al.). Selle testi tulemused näitavad, et
piperidiiniühendid seonduvad VR1-ga ja moduleerivad selle aktiivsust.
Inimese VR1 kloonimine. Kasutatakse inimese seljaaju RNA-d (kaubanduslikult
saadaval firmast Clontech, Palo Alto, CA). Pöördtranskriptsioon teostatakse
1,0
10
µg
kogu
RNA-ga,
kasutades
Thermoscripti
pöördtranskriptaasi
(kaubanduslikult saadaval firmast Invitrogen, Carlsbad, CA) ja oligo-dT
praimereid, nagu üksikasjalikult on kirjeldatud selle toote kirjelduses. Pöördtranskriptsiooni
reaktsioonisegusid
inkubeeritakse
temperatuuril
55
°C
1 tund, inaktiveeritakse kuumusega temperatuuril 85 °C 5 minutit ja töödeldakse
RNaas H-ga temperatuuril 37 °C 20 minutit.
15
Inimese
VR1
cDNA
järjestus
saadakse
inimese
genoomse
järjestuse
võrdlemisega, enne annoteerimist, kirjanduses avaldatud roti järjestusega.
Selleks, et saada inimese hüpoteetilist cDNA-d eemaldatakse introni järjestused
ja liidetakse külgnevate eksonite järjestused. Inimese VR1 kodeeriva piirkonnaga
külgnevad
20
praimerid
disainitakse
järgmiselt:
GAAGATCTTCGCTGGTTGCACACTGGGCCACA
ja
päripidine
praimer
äraspidine
praimer
GAAGATCTTCGGGGACAGTGACGGTTGGATGT.
VR1 PCR teostatakse ühe kümnendiku pöördtranskriptaasi reaktsiooniseguga,
kasutades Expand Long Template polümeraasi ja Expand puhvrit 2 lõppmahus
50 µl vastavalt tootja juhistele (Roche Applied Sciences, Indianapolis, IN). Pärast
25
denatureerimist temperatuuril 94 °C 2 minutit teost atakse PCR-iga amplifikatsioon
25 tsükli jooksul: temperatuuril 94 °C 15 sekundit, temperatuuril 58 °C 30 sekundit
ja temperatuuril 68 °C 3 minutit, sellele järgneb l õplik inkubatsioon temperatuuril
72 °C 7 minutit kuni amplifikatsiooni lõppemiseni. PCR-i ~ 2,8 kb produkt
eraldatakse geelil, kasutades 1,0% agaroos-trisatsetaatgeeli, mis sisaldab
EE-EP 1 648 878 B1
269
1,6 µg/ml kristallvioletti, ja puhastatakse komplektiga S.N.A.P. UV-Free
Purifucation Kit (kaubanduslikult saadaval firmast Invitrogen). VR1 PCR-i produkt
kloonitakse pIND/V5-His-TOPO vektorisse (kaubanduslikult saadaval firmast
Invitrogen)
5
vastavalt
tootja
juhistele.
DNA
valmistamised,
lõikamised
restriktsiooniensüümidega ja esialgne DNA järjestamine teostatakse vastavalt
standardeeskirjadele. Täispikk järjestamine kinnitab inimese VR1 identsust.
Indutseeritavate rakuliinide loomine. Kui ei ole teisiti näidatud, ostetakse
rakukultuuri reagendid firmast Life Technologies of Rockville, MD. Ekdüsooniretseptorit ekspresseerivaid HEK293-EcR rakke (kaubanduslikult saadaval
10
firmast Invitrogen) kultiveeritakse kasvusöötmes (Dulbecco modifitseeritud Eagle
sööde, mis sisaldab 10% veiseloote seerumit (kaubanduslikult saadaval firmast
HyClone, Logan, UT), 1-kordset penitsilliini/streptomütsiini lahust, 1-kordset
glutamiinilahust, 1 mM naatriumpüruvaati ning 400 µg/ml Zeocini (kaubanduslikult
saadaval firmast Invitrogen)). VR1-pIND konstruktid transfekteeritakse HEK293-
15
EcR
rakuliini,
kasutades
Fugene
transfektsioonireagenti
(kaubanduslikult
saadaval firmast Roche Applied Sciences, Basel, Šveits). 48 tunni pärast
kantakse rakud selektsioonisöötmesse (kasvusööde, mis sisaldab 300 µg/ml
G418 (kaubanduslikult saadaval firmast Invitrogen)). Umbes 3 nädalat hiljem
eraldatakse individuaalsed Zeocin/G418 resistentsed kloonid ja paljundatakse.
20
Funktsioneerivate kloonide kindlakstegemiseks külvatakse hulk kloone 96
süvendiga plaatidele ja ekspressiooni indutseeritakse 48 tundi, kasutades
selektsioonisöödet, mis sisaldab 5 µM ponasteroon A-d ("PonA") (kaubanduslikult
saadaval firmast Invitrogen). Testimise päeval lisatakse rakkudele värvi Fluo-4
(kaltsiumitundlik värv, mis on kaubanduslikult saadaval firmast Molecular Probes,
25
Eugene, OR) ja CAP-vahendatud kaltsiumi sissevool rakkudesse määratakse
seadmega FLIPR, nagu kirjeldatud allpool. Funktsionaalseid kloone testitakse
uuesti, paljundatakse ja säilitatakse külmutatult.
pH-l põhinev test. Kaks päeva enne selle testi tegemist külvatakse rakud polü-Dlüsiiniga kaetud 96 süvendiga läbipaistva põhjaga mustadele plaatidele
30
(kaubanduslikult
saadaval
firmast
Becton-Dickinson)
tihedusega
75
000
rakku/süvendis kasvusöötmesse, mis sisaldab 5 µM PonA (kaubanduslikult
270
EE-EP 1 648 878 B1
saadaval firmast Invitrogen), et indutseerida ekspressiooni. Testimise päeval
pestakse
plaate
0,2
ml
1-kordse
Hanki
tasakaalustatud
soolalahusega
(kaubanduslikult saadaval firmast Life Technologies), mis sisaldab 1,6 mM CaCl2
ja 20 mM HEPES-t (pH 7,4) (pesemispuhver), ja rakkudele kantakse 0,1 ml
5
pesemispuhvrit,
mis
sisaldab
värvi
Fluo-4
(lõppkontsentratsioon
3
µM,
kaubanduslikult saadaval firmast Molecular Probes). Ühe tunni pärast pestakse
rakke kaks korda 0,2 ml pesemispuhvriga ja resuspendeeritakse 0,05 ml
1-kordses Hanki tasakaalustatud soolalahuses (kaubanduslikult saadaval firmast
Life Technologies), mis sisaldab 3,5 mM CaCl2 ja 10 mM tsitraati (pH 7,4)
10
(määramispuhver). Seejärel viiakse plaadid testimiseks seadmesse FLIPR.
Piperidiiniühend lahjendatakse proovipuhvriga, 50 ml saadud lahust lisatakse
rakkudele plaatidel ja lahust jälgitakse kaks minutit. Piperidiiniühendi lõppkontsentratsioon on vahemikus umbes 50 pM kuni umbes 3 µM. Seejärel lisatakse igasse süvendisse agonisti puhver (pesemispuhver, mida on tiitritud 1 N
15
HCl-ga, et saada lahus pH-ga 5,5, kui seda segada vahekorras 1 : 1 proovipuhvriga) (0,1 ml) ja plaate inkubeeritakse veel 1 minut. Andmed kogutakse kogu
testimisaja jooksul ning analüüsitakse programmidega Excel ja GraphPad Prism.
Kapsaitsiinil põhinev test. Kaks päeva enne selle testi tegemist külvatakse rakud
polü-D-lüsiiniga kaetud 96 süvendiga läbipaistva põhjaga mustadele plaatidele
20
(tihedusega 50 000 rakku/süvendis) kasvusöötmesse, mis sisaldab 5 µM PonA
(kaubanduslikult saadaval firmast Invitrogen), et indutseerida ekspressiooni.
Testimise päeval pestakse plaate 0,2 ml 1-kordse Hanki tasakaalustatud soolalahusega (kaubanduslikult saadaval firmast Life Technologies), mis sisaldab 1
mM CaCl2 ja 20 mM HEPES-t (pH 7,4) ning rakkudele kantakse 0,1 ml
25
pesemispuhvrit, mis sisaldab värvi Fluo-4 (lõppkontsentratsioon 3 µM). Ühe tunni
pärast pestakse rakke kaks korda 0,2 ml pesemispuhvriga ja resuspendeeritakse
0,1 ml pesemispuhvris. Seejärel viiakse plaadid testimiseks seadmesse FLIPR.
Rakkudele plaatidel lisatakse 50 µl määramispuhvriga lahjendatud piperidiiniühendit ja inkubeeritakse 2 minutit. Piperidiiniühendi lõppkontsentratsioon on
30
vahemikus umbes 50 pM kuni umbes 3 µM. Inimese VR1 aktiveeritakse 50 µl
kapsaitsiini (400 nM) lisamisega ja plaate inkubeeritakse veel 3 minutit. Andmed
271
EE-EP 1 648 878 B1
kogutakse kogu testimisaja jooksul ning analüüsitakse programmidega Excel ja
GraphPad Prism.
EE-EP 1 648 878 B1
272
PATENDINÕUDLUS
1. Ühend valemiga (I)
Ar1
R4
(R3)m
N
X
NH
Ar2
5
(I)
või selle farmatseutiliselt vastuvõetav sool, milles
Ar1 on
Ar2 on
10
EE-EP 1 648 878 B1
273
X on O, S, N-CN, N-OH või N-OR10,
R1 on -H, halogenorühm, -CH3, -NO2, -CN, -OH, -OCH3, -NH2, -C(halogeno)3-,
-CH(halogeno)2- või -CH2(halogeno)rühm,
iga R2 on sõltumatult:
5
(a) halogenorühm, -OH, -CN, -NO2 või -NH2,
(b) -(C1-C10)alküül-, -(C2-C10)alkenüül-, -(C2-C10)alkünüül-, -(C3-C10)tsükloalküül-,
-(C8-C14)bitsükloalküül-,
-(C8-C14)tritsükloalküül-,
-(C5-C10)tsükloalkenüül-,
-(C8-C14)bitsükloalkenüül-, -(C8-C14)tritsükloalkenüül-, -(3-7-lüliline)heterotsükliline
või -(7-10-lüliline)bitsükloheterotsükliline rühm, millest igaüks on asendamata või
10
asendatud ühe või enama rühmaga R5, või
(c) fenüül-, naftüül-, -(C14)arüül- või -(5-10-lüliline)heteroarüülrühm, millest igaüks
on asendamata või asendatud ühe või enama rühmaga R6,
iga R3 on sõltumatult:
(a) halogenorühm, -CN, -OH, -NO2 või -NH2,
15
(b) -(C1-C10)alküül-, -(C2-C10)alkenüül-, -(C2-C10)alkünüül-, -(C3-C10)tsükloalküül-,
-(C8-C14)bitsükloalküül-,
-(C8-C14)tritsükloalküül-,
-(C5-C10)tsükloalkenüül-,
-(C8-C14)bitsükloalkenüül-, -(C8-C14)tritsükloalkenüül-, -(3-7-lüliline)heterotsükliline
või -(7-10-lüliline)bitsükloheterotsükliline rühm, millest igaüks on asendamata või
asendatud ühe või enama rühmaga R5, või
20
(c) fenüül-, naftüül-, -(C14)arüül- või -(5-10-lüliline)heteroarüülrühm, millest igaüks
on asendamata või asendatud ühe või enama rühmaga R6,
EE-EP 1 648 878 B1
274
R4 on -OH, -OCF3, halogenorühm, -(C1-C6)alküül-, -CH2OH, -CH2Cl, -CH2Br,
-CH2I, -CH2F, -CH(halogeno)2-, -CF3, -OR10, -SR13, -COOH, -COOR10, -C(O)R10,
-C(O)H, -OC(O)R10, -OC(O)NHR10, -NHC(O)R13, -CON(R13)2, -SO2R10 või NO2,
iga R5 on sõltumatult -CN, -OH, -(C1-C6)alküül-, -(C2-C6)alkenüül-, halogenorühm,
5
-N3, -NO2, -N(R7)2, -CH=NR7, -NR7OH, -OR7, -COR7, -C(O)OR7, -OC(O)R7 või
-OC(O)OR7,
iga R6 on sõltumatult -(C1-C6)alküül-, -(C2-C6)alkenüül-, -(C2-C6)alkünüül-,
-(C3-C8)tsükloalküül-, -(C5-C8)tsükloalkenüül-, fenüül-, -(3-5-lüliline)heterotsükliline
rühm,
10
-C(halogeno)3-,
-CH(halogeno)2-,
-CH2(halogeno)rühm,
-CN,
-OH,
halogenorühm, -N3, -NO2, -CH=NR7, -NR7OH, -OR7, -COR7, -C(O)OR7,
-OC(O)R7, -OC(O)OR7, -SR7, -S(O)R7 või -S(O)2R7,
iga R7 on sõltumatult -H, -(C1-C6)alküül-, -(C2-C6)alkenüül-, -(C2-C6)alkünüül-,
-(C3-C8)tsükloalküül-, -(C5-C8)tsükloalkenüül-, fenüül-, -(3-5-lüliline)heterotsükliline
rühm, -C(halogeno)3-, -CH(halogeno)2- või -CH2(halogeno)rühm,
15
iga
R8
ja
R9
on
-(C2-C6)alkünüül-,
sõltumatult
-H,
-(C3-C8)tsükloalküül-,
-(3-5-lüliline)heterotsükliline
rühm,
-(C1-C6)alküül-,
-(C2-C6)alkenüül-,
-(C5-C8)tsükloalkenüül-,
-CH2C(halogeno)3-,
fenüül-,
-C(halogeno)3-,
-CH(halogeno)2-, -CH2(halogeno)rühm, -CN, -OH, halogenorühm, -N3, -NO2,
-CH=NR7, -NR7OH, -OR7, -COR7, -C(O)OR7, -OC(O)R7, -OC(O)OR7, -SR7,
20
-S(O)R7 või -S(O)2R7,
R10 on -(C1-C4)alküülrühm,
iga R13 on sõltumatult:
(a) -H või -(C1-C4)alküülrühm või
275
EE-EP 1 648 878 B1
(b) fenüül- või -(3-5-lüliline)heteroarüülrühm, millest igaüks on asendamata või
asendatud ühe või enama rühmaga R6,
iga R14 on sõltumatult -(C1-C6)alküül-, -(C2-C6)alkenüül-, -(C2-C6)alkünüül-,
-(C3-C8)tsükloalküül-, -(C5-C8)tsükloalkenüül-, fenüül-, -(3-5-lüliline)heterotsükliline
5
rühm, -CH2C(halogeno)3-, -C(halogeno)3-, -CH(halogeno)2-, -CH2(halogeno)rühm,
-CN, -OH, halogenorühm, -N3, -NO2, -CH=NR7, -NR7OH, -OR7, -COR7,
-C(O)OR7, -OC(O)R7, -OC(O)OR7, -SR7, -S(O)R7 või -S(O)2R7,
iga halogenorühm on sõltumatult -F, -Cl, -Br või -I,
n on täisarv vahemikus 0 kuni 3,
10
p on täisarv vahemikus 0 kuni 2,
q on täisarv vahemikus 0 kuni 4 ja
m on 0 või 1.
2. Ühend vastavalt nõudluspunktile 1, milles X on O ja R4 on halogenorühm või
-OH.
15
3. Ühend vastavalt nõudluspunktile 2, milles m on 0, n või p on 0 ja Ar1 on
püridüülrühm või püridasinüülrühm.
4. Ühend vastavalt nõudluspunktile 3, milles R1 on -Cl või -CH3.
5. Ühend vastavalt nõudluspunktile 4, milles Ar2 on
EE-EP 1 648 878 B1
276
N
R8
S
R9 .
6. Ühend vastavalt nõudluspunktile 5, milles R8 ja R9 on -H või R8 on -H ja R9 on
-(C1-C6)alküülrühm või halogenorühm.
7. Ühend vastavalt nõudluspunktile 6, milles R9 on isopropüülrühm või tert5
butüülrühm.
8. Ühend vastavalt nõudluspunktile 6 või 7, milles R9 on halogenorühm, mis on
valitud -F, -Cl, -Br ja -I hõlmavast rühmast.
9. Ühend vastavalt nõudluspunktile 2, milles Ar1 on püridüülrühm.
10. Ühend vastavalt nõudluspunktile 9, milles R1 on -Cl või -CH3.
10
11. Ühend vastavalt nõudluspunktile 10, milles R8 ja R9 on -H või R8 on -H ja R9
on -(C1-C6)alküülrühm või halogenorühm.
12. Ühend vastavalt nõudluspunktile 11, milles R9 on isopropüülrühm või tertbutüülrühm.
13. Ühend vastavalt nõudluspunktile 11, milles R9 on halogenorühm, mis on
15
valitud -F, -Cl, -Br ja -I hõlmavast rühmast.
14. Ühend valemiga (II)
EE-EP 1 648 878 B1
277
N
(R2)n
R4
R1
(R3)m
N
x
NH
Ar3
(II)
(II)
või selle farmatseutiliselt vastuvõetav sool, milles
Ar3 on
5
X on O, S, N-CN, N-OH või N-OR10,
R1 on halogenorühm, -CH3, -NO2, -CN, -OH, -OCH3, -NH2, -C(halogeno)3,
-CH(halogeno)2 või -CH2(halogeno),
iga R2 on sõltumatult:
(a) halogenorühm, -OH või -NH2,
10
(b) -(C1-C10)alküül-, -(C2-C10)alkenüül-, -(C2-C10)alkünüül-, -(C3-C10)tsükloalküül-,
-(C8-C14)bitsükloalküül-,
-(C8-C14)tritsükloalküül-,
-(C5-C10)tsükloalkenüül-,
-(C8-C14)bitsükloalkenüül-, -(C8-C14)tritsükloalkenüül-, -(3-7-lüliline)heterotsükliline
või -(7-10-lüliline)bitsükloheterotsükliline rühm, millest igaüks on asendamata või
asendatud ühe või enama rühmaga R5, või
EE-EP 1 648 878 B1
278
(c) fenüül-, naftüül-, -(C14)arüül- või -(5-10-lüliline)heteroarüülrühm, millest igaüks
on asendamata või asendatud ühe või enama rühmaga R6,
iga R3 on sõltumatult:
(a) halogenorühm, -CN, -OH, -NO2 või -NH2,
5
(b) -(C1-C10)alküül-, -(C2-C10)alkenüül-, -(C2-C10)alkünüül-, -(C3-C10)tsükloalküül-,
-(C8-C14)bitsükloalküül-,
-(C8-C14)tritsükloalküül-,
-(C5-C10)tsükloalkenüül-,
-(C8-C14)bitsükloalkenüül-, -(C8-C14)tritsükloalkenüül-, -(3-7-lüliline)heterotsükliline
või -(7-10-lüliline)bitsükloheterotsükliline rühm, millest igaüks on asendamata või
asendatud ühe või enama rühmaga R5, või
10
(c) fenüül-, naftüül-, -(C14)arüül- või -(5-10-lüliline)heteroarüülrühm, millest igaüks
on asendamata või asendatud ühe või enama rühmaga R6,
R4 on -OH, -OCF3, halogenorühm, -(C1-C6)alküül-, -CH2OH, -CH2Cl, -CH2Br,
-CH2I, -CH2F, -CH(halogeno)2-, -CF3, -OR10, -SR13, -COOH, -COOR10, -C(O)R10,
-C(O)H, -OC(O)R10, -OC(O)NHR10, -NHC(O)R13, -SO2R10 või -NO2,
15
iga R5 on sõltumatult -CN, -OH, -(C1-C6)alküül-, -(C2-C6)alkenüül-, halogenorühm,
-N3, -NO2, -N(R7)2, -CH=NR7, -NR7OH, -OR7, -COR7, -C(O)OR7, -OC(O)R7 või
-OC(O)OR7,
iga R6 on sõltumatult -(C1-C6)alküül-, -(C2-C6)alkenüül-, -(C2-C6)alkünüül-,
-(C3-C8)tsükloalküül-,
20
-(C5-C8)tsükloalkenüül-,
fenüül-,
-C(halogeno)3-,
-CH(halogeno)2-, -CH2(halogeno)rühm, -CN, -OH, halogenorühm, -N3, -NO2,
-CH=NR7, -NR7OH, -OR7, -COR7, -C(O)OR7, -OC(O)R7, -OC(O)OR7, -SR7,
-S(O)R7 või -S(O)2R7,
EE-EP 1 648 878 B1
279
iga R7 on sõltumatult -H, -(C1-C6)alküül-, -(C2-C6)alkenüül-, -(C2-C6)alkünüül-,
-(C3-C8)tsükloalküül-, -(C5-C8)tsükloalkenüül-, fenüül-, -(3-5-lüliline)heterotsükliline
rühm, -C(halogeno)3-, -CH(halogeno)2- või -CH2(halogeno)rühm,
iga R9 on sõltumatult -(C1-C6)alküül-, -(C2-C6)alkenüül-, -(C2-C6)alkünüül-,
5
-(C3-C8)tsükloalküül-, -(C5-C8)tsükloalkenüül-, fenüül-, -(3-5-lüliline)heterotsükliline
rühm, -CH2C(halogeno)3-, -C(halogeno)3-, -CH(halogeno)2-, -CH2(halogeno)rühm,
-CN, -OH, halogenorühm, -N3, -NO2, -CH=NR7, -NR7OH, -OR7, -COR7,
-C(O)OR7, -OC(O)R7, -OC(O)OR7, -SR7, -S(O)R7 või -S(O)2R7,
R10 on -(C1-C4)alküülrühm,
10
iga
R11
on
sõltumatult
-CN,
-OH,
-(C1-C6)alküül-,
-(C2-C6)alkenüül-,
halogenorühm, -N3, -NO2, -N(R7)2, -CH=NR7, -NR7OH, -OR7, -COR7, -C(O)OR7,
-OC(O)R7 või -OC(O)OR7,
iga R13 on sõltumatult:
(a) -H või -(C1-C4)alküülrühm või
15
(b) fenüül- või -(3-5-lüliline)heteroarüülrühm, millest igaüks on asendamata või
asendatud ühe või enama rühmaga R6,
iga halogenorühm on sõltumatult -F, -Cl, -Br või -I,
n on täisarv vahemikus 0 kuni 3,
p on täisarv vahemikus 0 kuni 2,
20
r on täisarv vahemikus 0 kuni 6,
EE-EP 1 648 878 B1
280
s on täisarv vahemikus 0 kuni 5, ja
m on 0 või 1.
15. Ühend vastavalt nõudluspunktile 14, milles X on O ja R4 on halogenorühm või
-OH.
5
16. Ühend vastavalt nõudluspunktile 15, milles R1 on -CH3 või halogenorühm.
17. Ühend vastavalt nõudluspunktile 16, milles Ar3 on
(R9)s
.
18. Ühend vastavalt nõudluspunktile 17, milles s on 1 ja R9 on fenüültsükli 4.
asendis.
10
19. Ühend vastavalt nõudluspunktile 17, milles R9 on -(C1-C6)alküülrühm või
halogenorühm.
20. Ühend vastavalt nõudluspunktile 19, milles R9 on isopropüülrühm või tertbutüülrühm.
21. Ühend vastavalt nõudluspunktile 19, milles R9 on halogenorühm, mis on
15
valitud -F, -Cl, -Br ja -I hõlmavast rühmast.
22. Ühend vastavalt nõudluspunktile 14 valemiga (IIc), milles
n on 0,
EE-EP 1 648 878 B1
281
m on 0,
R1 on valitud rühmast, kuhu kuuluvad halogenorühm, -CH3, -CF3, -CHF2, -OH,
-NO2 ja -CN,
R4 on -F,
5
Ar3 on
(R9)s
,
s on 0 või 1,
R9 on para-asendis ja on valitud rühmast, kuhu kuuluvad tert-butüül-, isobutüül-,
sec-butüül-, -tsükloheksüül-, tert-butoksü-, isopropoksü-, -CF3, -CH2CF3, -OCF3,
10
C1, -Br, -I, n-butüül-, -n-propüülrühm, ja
X on 0.
23. Ühend vastavalt nõudluspunktile 22, milles R1 on -F ja R9 on -CF3.
24. Ühend vastavalt nõudluspunktile 22, milles R1 on -F ja R9 on -OCF3.
25. Ühend valemiga (III)
EE-EP 1 648 878 B1
282
Ar1
R4
(R3)m
N
x
NH
Ar3
(III)
(III)
või selle farmatseutiliselt vastuvõetav sool, milles
Ar1 on
5
Ar3 on
X on O, S, N-CN, N-OH või N-OR10,
R1 on -H, halogenorühm, -CH3, -NO2, -CN, -OH, -OCH3, -NH2, -C(halogeno)3-,
-CH(halogeno)2- või -CH2(halogeno)rühm,
10
iga R2 on sõltumatult:
(a) halogenorühm, -OH, -CN, -NO2 või -NH2,
EE-EP 1 648 878 B1
283
(b) -(C1-C10)alküül-, -(C2-C10)alkenüül-, -(C2-C10)alkünüül-, -(C3-C10)tsükloalküül-,
-(C8-C14)bitsükloalküül-,
-(C8-C14)tritsükloalküül-,
-(C5-C10)tsükloalkenüül-,
-(C8-C14)bitsükloalkenüül-, -(C8-C14)tritsükloalkenüül-, -(3-7-lüliline)heterotsükliline
või -(7-10-lüliline)bitsükloheterotsükliline rühm, millest igaüks on asendamata või
5
asendatud ühe või enama rühmaga R5, või
(c) fenüül-, naftüül-, -(C14)arüül- või -(5-10-lüliline)heteroarüülrühm, millest igaüks
on asendamata või asendatud ühe või enama rühmaga R6,
iga R3 on sõltumatult:
(a) halogenorühm, -CN, -OH, -NO2 või -NH2,
10
(b) -(C1-C10)alküül-, -(C2-C10)alkenüül-, -(C2-C10)alkünüül-, -(C3-C10)tsükloalküül-,
-(C8-C14)bitsükloalküül-,
-(C8-C14)tritsükloalküül-,
-(C5-C10)tsükloalkenüül-,
-(C8-C14)bitsükloalkenüül-, -(C8-C14)tritsükloalkenüül-, -(3-7-lüliline)heterotsükliline
või -(7-10-lüliline)bitsükloheterotsükliline rühm, millest igaüks on asendamata või
asendatud ühe või enama rühmaga R5, või
15
(c) fenüül-, naftüül-, -(C14)arüül- või -(5-10-lüliline)heteroarüülrühm, millest igaüks
on asendamata või asendatud ühe või enama rühmaga R6,
R4 on -OH, -OCF3, halogenorühm, -(C1-C6)alküül-, -CH2OH, -CH2Cl, -CH2Br,
-CH2I, -CH2F, -CH(halogeno)2-, -CF3, -OR10, -SR13, -COOH, -COOR10, -C(O)R10,
-C(O)H, -OC(O)R10, -OC(O)NHR10, -NHC(O)R13, -SO2R10 või -NO2,
20
iga R5 on sõltumatult -CN, -OH, -(C1-C6)alküül-, -(C2-C6)alkenüül-, halogenorühm,
-N3, -NO2, -N(R7)2, -CH=NR7, -NR7OH, -OR7, -COR7, -C(O)OR7, -OC(O)R7 või
-OC(O)OR7,
iga R6 on sõltumatult -(C1-C6)alküül-, -(C2-C6)alkenüül-, -(C2-C6)alkünüül-,
-(C3-C8)tsükloalküül-,
-(C5-C8)tsükloalkenüül-,
fenüül-,
-C(halogeno)3-,
EE-EP 1 648 878 B1
284
-CH(halogeno)2-, -CH2(halogeno)rühm, -CN, -OH, halogenorühm, -N3, -NO2,
-CH=NR7, -NR7OH, -OR7, -COR7, -C(O)OR7, -OC(O)R7, -OC(O)OR7, -SR7,
-S(O)R7 või -S(O)2R7,
iga R7 on sõltumatult -H, -(C1-C6)alküül-, -(C2-C6)alkenüül-, -(C2-C6)alkünüül-,
5
-(C3-C8)tsükloalküül-, -(C5-C8)tsükloalkenüül-, fenüül-, -(3-5-lüliline)heterotsükliline
rühm, -C(halogeno)3-, -CH(halogeno)2- või -CH2(halogeno)rühm,
iga R9 on sõltumatult -(C1-C6)alküül-, -(C2-C6)alkenüül-, -(C2-C6)alkünüül-,
-(C3-C8)tsükloalküül-, -(C5-C8)tsükloalkenüül-, fenüül-, -(3-5-lüliline)heterotsükliline
rühm, -CH2C(halogeno)3-, -C(halogeno)3-, -CH(halogeno)2-, -CH2(halogeno)rühm,
10
-CN, -OH, halogenorühm, -N3, -NO2, -CH=NR7, -NR7OH, -OR7, -COR7,
-C(O)OR7, -OC(O)R7, -OC(O)OR7, -SR7, -S(O)R7 või -S(O)2R7,
R10 on -(C1-C4)alküülrühm,
iga
R11
on
sõltumatult
-CN,
-OH,
-(C1-C6)alküül-,
-(C2-C6)alkenüül-,
halogenorühm, -N3, -NO2, -N(R7)2, -CH=NR7, -NR7OH, -OR7, -COR7, -C(O)OR7,
15
-OC(O)R7 või -OC(O)OR7,
iga R13 on sõltumatult:
(a) -H või -(C1-C4)alküülrühm või
(c) fenüül- või -(3-5-lüliline)heteroarüülrühm, millest igaüks on asendamata või
asendatud ühe või enama rühmaga R6,
20
iga halogenorühm on sõltumatult -F, -Cl, -Br või -I,
p on täisarv vahemikus 0 kuni 2,
r on täisarv vahemikus 0 kuni 6,
EE-EP 1 648 878 B1
285
s on täisarv vahemikus 0 kuni 5 ja
m on 0 või 1.
26. Ühend vastavalt nõudluspunktile 25, milles X on O ja R4 on halogenorühm või
-OH.
5
27. Ühend vastavalt nõudluspunktile 26, milles m on 0, p on 0 ja Ar1 on
püridasinüülrühm.
28. Ühend vastavalt nõudluspunktile 27, milles R1 on -Cl või -CH3.
29. Ühend vastavalt nõudluspunktile 28, milles Ar3 on
(R9)s
.
10
30. Ühend vastavalt nõudluspunktile 29, milles s on 1 ja R9 on fenüültsükli 4.
asendis.
31. Ühend vastavalt nõudluspunktile 29, milles R9 on -(C1-C6)alküülrühm või
halogenorühm.
32. Ühend vastavalt nõudluspunktile 31, milles R9 on isopropüülrühm või tert15
butüülrühm.
33. Ühend vastavalt nõudluspunktile 31, milles R9 on halogenorühm, mis on
valitud -F, -Cl, -Br ja -I hõlmavast rühmast.
286
EE-EP 1 648 878 B1
34. Koostis, mis sisaldab mis tahes nõudluspunktile 1-33 vastavat ühendit või
selle farmatseutiliselt vastuvõetavat soola ja farmatseutiliselt vastuvõetavat
kandjat või abiainet.
35. Mis tahes nõudluspunktile 1-33 vastava ühendi või selle farmatseutiliselt
5
vastuvõetava soola efektiivse koguse ja valikuliselt teise raviaine efektiivse
koguse kasutamine ravimi valmistamiseks, mis on ette nähtud valu ravimiseks või
vältimiseks loomal.
36. Mis tahes nõudluspunktile 1-33 vastava ühendi või selle farmatseutiliselt
vastuvõetava soola efektiivse koguse ja valikuliselt teise raviaine efektiivse
10
koguse kasutamine ravimi valmistamiseks, mis on ette nähtud kusepidamatuse
ravimiseks või vältimiseks loomal.
37. Mis tahes nõudluspunktile 1-33 vastava ühendi või selle farmatseutiliselt
vastuvõetava soola efektiivse koguse ja valikuliselt teise raviaine efektiivse
koguse kasutamine ravimi valmistamiseks, mis on ette nähtud haavandi
15
ravimiseks või vältimiseks loomal.
38. Mis tahes nõudluspunktile 1-33 vastava ühendi või selle farmatseutiliselt
vastuvõetava soola efektiivse koguse ja valikuliselt teise raviaine efektiivse
koguse kasutamine ravimi valmistamiseks, mis on ette nähtud ärritunud soole
sündroomi ravimiseks või vältimiseks loomal.
20
39. Mis tahes nõudluspunktile 1-33 vastava ühendi või selle farmatseutiliselt
vastuvõetava soola efektiivse koguse ja valikuliselt teise raviaine efektiivse
koguse kasutamine ravimi valmistamiseks, mis on ette nähtud põletikulise
soolehaiguse ravimiseks või vältimiseks loomal.
40. In vitro meetod VR1 funktsiooni inhibeerimiseks rakus, mis hõlmab VR1
25
ekspresseerima võimelise raku kokkuviimist mis tahes nõudluspunktile 1-33
vastava ühendi või selle farmatseutiliselt vastvõetava soola efektiivse kogusega.
287
EE-EP 1 648 878 B1
41. Mis tahes nõudluspunktile 1-33 vastava ühendi või selle farmatseutiliselt
vastuvõetava soola efektiivse koguse kasutamine ravimi valmistamiseks, mis on
ette nähtud VR1 funktsiooni inhibeerimiseks rakus valu, kusepidamatuse,
haavandi, ärritunud soole sündroomi või põletikulise soolehaiguse ravimiseks või
5
vältimiseks.
42. Komplekt, mis sisaldab anumat, mis sisaldab mis tahes nõudluspunktile 1-33
vastavat ühendi või selle farmatseutiliselt vastvõetava soola efektiivset kogust.
43. Meetod koostise valmistamiseks, mis sisaldab mis tahes nõudluspunktile 1-33
vastava ühendi või selle farmatseutiliselt vastuvõetava soola ja farmatseutiliselt
10
vastuvõetava kandja või abiaine segamise etappi.
`