Aktuality súčasného biomedicínskeho výskumu I.

Ústav lekárskej biológie a genetiky LF UK v Bratislave
a
PROBIOLMED
Daniel Böhmer a Ľuboš Danišovič
Aktuality súčasného biomedicínskeho výskumu
I.
Asklepios
Bratislava 2007
Aktuality súčasného biomedicínskeho výskumu I.
Editori: doc. MUDr. Daniel Böhmer, PhD., RNDr. Ľuboš Danišovič
Recenzent: prof. MUDr. Gustáv Čatár, DrSc.
Vydal: Asklepios, Bratislava, December 2007
ISBN: 978–80–7167–120–6
Obsah
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
Predslov ............................................................................................................................
Jozef Adámať, Robert Petrovič, Katarína Kolejáková, Danka Maceková, Mária
Fischerová, Ľubica Strháková, Pavol Ipóth, Ján Chandoga: Canavanova choroba –
biochemický a molekulovo–genetický algoritmus v diagnostike ochorenia ………..
Ľuboš Danisšovič, Juraj Krajčovič, Ján Vojtaššák: Testovanie toxicity chemických
látok v podmienkach in vitro …………………………………………………………..
Mária Fischerová, Robert Petrovič, Lívia Lukáčková, Katarína Kolejáková, Jozef
Adámať, Ján Futas, Danka Maceková, Ľubica Strháková, Pavol Ipóth, Darina
Ďurovčíková, Ján Chandoga: Genómový imprinting, molekulárno-genetická
diagnostika Prader-Williho/ Angelmanovho syndrómu ……………………………..
Paulína Gálfiová, Katarína Bevízová: Morfológia mikrocirkulácie ľudskej sleziny –
súčasný stav poznania .....................................................................................................
Alena Hercegová, Eliška Gálová, Andrea Ševčovičová: Štúdium regulácie
bunkového cyklu u fotoautotrofných mikroorganizmov .............................................
Lívia Hlavačková, Pavol Janega, Silvia Líšková, Pavel Babál: Changes in endothelial
and inducible NO synthase in aortic media after administration of red wine
polyphenols ......................................................................................................................
Ivana Hojsíková, Gabriela Pavlíková, Dalibor Hojsík, Peter Križan: Chronická
myeloická leukémia z pohľadu genetiky a molekulovej biológie ...............................
Dušan Hollý, Jozef Mračna: Využitie augmentačných techník v chirurgickej terapii
parodontopatií .................................................................................................................
Roman Hudec, Lýdia Božeková, Milan Kriška: Možnosti monitoringu liekového
rizika .................................................................................................................................
Lucia Kalinovská, Silvia Bubeníková, Dušan Bakoš: Enzymatic degradation of
chitosan-based microspheres .........................................................................................
Katarína Kolejáková, Robert Petrovič, Mária Fischerová, Danka Maceková, Jozef
Adámať, Ľubica Strháková, Pavol Ipóth, Darina Ďurovčíková, Ján Chandoga:
Biochemická a molekulárno–genetická diagnostika Smith–Lemli–Opitzovho
syndrómu .........................................................................................................................
Georgína Kolníková, Vanda Repiská, Peter Kolník, Ľudovít Danihel: Význam HPV v
etiopatogenéze prekanceróz a karcinómu krčka maternice .......................................
Martin Kopáni, Michal Behuliak, Peter Celec, Ivan Varga, Miriam Petrová, Štefan
Polák: Ultraštruktúrne zmeny indukované alkoholom v mozočku potkana po
génovej terapii .................................................................................................................
Martin Kopáni, Ľuboš Danišovič, Dimitris Hatzibougias, Martin Wawruch, Dalibor
Hojsík, Michal Korman, Bohuslav Uher, Roman Moravčík, Juraj Bugala, Marek
Bučko, Lívia Hlavačková, Alexandra Krištúfková: Identifikácia proteínu PCNA v
karcinóme endometria ....................................................................................................
Marcela Kopásková, Eva Miadoková, Slavomíra Naďová, Viera Vlčková, Viola
Dúhová, Peter Rauko, Pavel Mučaji, Daniel Grančai: Biologicky aktívne látky
prírodného charakteru s potenciálnym využitím pri prevencii a terapii
nádorových ochorení ......................................................................................................
Miroslav Kubeš, Zohdy Hamid, Ján Vojtaššák: Perspektívy využitia kmeňových
buniek z pupočníkovej krvi ............................................................................................
Monika Laššánová, Milada Laššánová, Ján Murín: Znižovanie rizika liečby a
adherencia k sekundárnej terapii po infarkte myokardu ...........................................
Petr Lesný, Pavla Jendelová, Oldřich Jirsák, Lenka Martinová, Jiří Michálek, Martin
Přádný, Eva Syková: Two- and three-dimensional tissue constructs based on
nanofiber layers ...............................................................................................................
Silvia Letašiová, Soňa Jantová, Ľuboš Čipák: Mitochondrial/caspase-9 dependent
cell death of cancer cells growing in suspension induced by plant isoquinoline –
berberine ..........................................................................................................................
Tomáš Málek, Martin Kopáni, Martin Weis, Ľuboš Danišovič: Účinok vitamínu C na
etanolom indukované zmeny fosfolipidovej monovrstvy ............................................
Peter Michalka: EGFR a onkológia? ..............................................................................
3
5
6
9
16
20
23
27
31
34
39
42
46
50
52
55
59
62
68
72
75
80
83
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
Zuzana Párnická, Eva Košková, Ivana Shawkatová: Polymorfizmus HLA-DQB1 pri
oligoartritickej forma juvenilnej idiopatickej artritídy (JIA) ....................................
Robert Petrovič, Ján Futas, Mária Fischerová, Katarína Kolejáková, Jozef Adámať,
Danka Maceková, Ľubica Strháková, Pavol Ipóth, Ján Chandoga: Molekulárna a
biochemická podstata peroxizómových dedičných ochorení ......................................
Andrej Repický, Soňa Jantová, Silvia Letašiová: Detection of 4-amino-3acetylquinoline induced DNA damage in murine L1210 and NIH-3T3 cells using
Comet assay .....................................................................................................................
Ivana Shawkatová, Vanda Repiská: Polymorfizmus génu PSMB9 v slovenskej
populácii ...........................................................................................................................
Michal Šimera, Viktor Foltin, Ivana Lettrichová, Zuzana Grolmusová, Marcela
Morvová, Eva Neu, Janka Foltinová: Výsledky interdisciplinárneho výskumu olova
v placente indikujú hyperkinetický syndróm u detí ....................................................
Vladimír Šišovský, Ľudovít Danihel, Michal Palkovič, Beata Bučeková, Vanda
Repiská, Ľuboš Danišovič, Andrea Ševčovičová, Svetoslav Štvrtina, Dimitris
Hatzibougias, Roman Moravčík, Marek Bučko, Michal Korman, Lívia Hlavačková:
Identifikácia proteínu PCNA v normálnom endometriu ............................................
Vladimír Šišovský, Ľudovít Danihel, Michal Palkovič, Pavel Babál, Beata Bučeková,
Dimitris Hatzibougias, Martin Wawruch, Dalibor Hojsík, Michal Korman, Zuzana
Kováčiková, Bohuslav Uher, Roman Moravčík: Ki-67 je vynikajúcim znakom
malígnej premeny buniek endometria po menopauze .................................................
Vladimír Šišovský, Beata Bučeková, Miroslav Budaj, Ľudovít Danihel, Vanda
Repiská: Identification of protein p53 in correlation with TP53 gene mutation in
endometrial carcinoma ...................................................................................................
Ľubica Strháková, Regína Behulová, Robert Petrovič, Katarína Kolejáková, Danka
Maceková, Mária Fischerová, Jozef Adámať, Pavol Ipóth, Ján Chandoga: Detekcia
mikrodelécií Y chromozómu u mužov s poruchami plodnosti ...................................
Marica Theiszová, Soňa Jantová, Jana Dragúňová, Lucia Kalinovská: Štúdium
biokompatibility biomateriálov na báze prírodných polymérov : mikrokapsule na
báze chitozánu a ľudská amniová membrána ..............................................................
Marcela Uličná, Ján Vojtaššák: Biologická charakteristika a potenciál kmeňových
buniek ...............................................................................................................................
Horst Urban, Martin Kopáni, Martin Weis, Július Dekan: Analýza železa v ľudskej
slezine ...............................................................................................................................
Ivan Varga, Viera Pospíšilová, Kristína Hudecová, Paulína Gálfiová, Katarína
Bevízová, Štefan Polák: Faryngová oblasť a neurálna lišta v ontogenéze človeka –
ako spolu súvisia vrodené vývinové chyby týmusu, srdca a prištítnych teliesok? ....
Patrik Vitazka, M. Lu, MA. Armstrong, Arti Pandya, Andrea Ferreira-Gonzalez:
Simultaneous detection of multiple genetic variants associated with hereditary
pancreatitis (Molecular diagnostic assay development and validation) ....................
Martin Wawruch, Martina Žikavská, Kamil Stratený, Ladislava Wsólová, Magdaléna
Kuželová, Jana Tisoňová, Dalibor Hojsík, Vladimír Šišovsky, Štefan Laššán, Viera
Kristová: Hodnotenie farmakologickej liečby starších pacientov pomocou
vybraných indikátorov ...................................................................................................
Tong T. Zhao, Stephen M. Lewis, Martin Holčík: Posttranscriptional regulation of
the Inhibitor of Apoptosis protein cIAP1 during cellular stress ................................
4
86
88
93
97
101
106
109
115
121
124
127
132
135
140
144
148
Predslov
Systematické publikovanie získaných výsledkov je integrálnou súčasťou výchovy
mladých vedeckých pracovníkov. Občianske združenie PROBIOLMED má v svojej náplni aj
podporu takýchto aktivít v biológii a v medicíne. Recenzovaný zborník vedeckých prác, ktorý
držíte v ruke, je priesečníkom uvedených realít.
Veríme, že bude prvým z dlhého radu a že poskytne priestor na odbornú komunikáciu
nielen mladším kolegom a kolegyniam, ale aj skúsenejším odborníkom v celom spektre
biomedicínskych disciplín.
Editori
5
Canavanova choroba – biochemický a molekulovo–genetický algoritmus v diagnostike
ochorenia
Jozef Adámať, Robert Petrovič, Katarína Kolejáková, Danka Maceková, Mária Fischerová,
Ľubica Strháková, Pavol Ipóth, Ján Chandoga
Centrum lekárskej genetiky FNsP Bratislava
Abstrakt
Canavanova choroba je závažné autozómovo recesívne ochorenie, postihujúce najmä
centrálny nervový systém. Klinické príznaky (makrocefália, psychosomatická retardácia,
hypertónia, leukodystrofické zmeny, špongiózna degenerácia CNS a i.) zvyčajne nastupujú už
v prvých mesiacoch života a väčšina pacientov zomiera do 3 rokov života. Ochorenie je
spôsobené deficienciou aspartoacylázy (EC3.5.1.15), enzýmu, normálne prítomnéhov
gliových bunkách bielej hmoty, ktorého úlohou je hydrolýza N-acetyl-aspartátu na aspartát a
acetát. Gén pre ľudskú aspartoacylázu je lokalizovaný na 17. chromozóme (17p13ter),
pozostáva zo 6-tich exónov a kóduje proteín s dĺžkou 313 aminokyselín. Deficiencia
aspartoacylázy vedie hlavne k akumulácii N-acetyl-aspartátu v mozgu, sprievodná je tiež
masívna exkrécia N-acetyl-aspartátu močom.
Postnatálna diagnostika je prioritne založená na dôkaze zvýšeného vylučovania Nacetyl-aspartátu močom pomocou GC/MS. V moči spravidla pozorujeme mnohonásobné
zvýšenie odpadu metabolitu pri vyšetrení organických kyselín. Molekulárno-genetická
diagnostika je prednostne postavená na RFLP analýze 6. exónu, nakoľko výskyt mutácie
C914A, lokalizovanej v tomto exóne bol zistený až u 40% pacientov s ochorením
(nežidovského pôvodu). V prípade negatívneho nálezu alebo prítomnosti mutácie iba na
jednej alele, pristupuje sa k sekvenčnej analýze jednotlivých exónov génu ASPA.
Cieľom nášho príspevku je prezentovanie algoritmov diagnostiky Canavanovej
choroby.
Úvod
Canavanova choroba (van Bogaert-Bertrand syndróm, OMIM 271900) je závažné autozómovo
recesívne ochorenie, postihujúce najmä centrálny nervový systém. Podstatným nálezom na CNS,
zobrazujúcom sa pri MRI, sú výrazné leukodystrofické zmeny, preto je Canavanova choroba
zaraďovaná do skupiny vrodených leukodystrofií.
Klinické príznaky. Počas prvých mesiacov života sa u detí nemusia pozorovať žiadne závažné
zmeny s výnimkou mierneho oneskorovania vývinu a hypotónie. V priebehu ďalšieho vývinu
dochádza k zvýrazňovaniu hypotonického syndrómu, je už zreteľná makrocefália a psychosomatická
retardácia. U niektorých detí sa, v dôsledku atrofie optického nervu, môžu dostaviť aj poruchy zraku,
napr. nystagmus, slabá vizuálna fixácia. Uvedené príznaky vedú lekára k vysloveniu podozrenia na
závažnú neurologickú poruchu a indikované MRI vyšetrenie odhalí výrazné difúzne leukodystrofické
zmeny. Ochorenie progreduje, zvýrazňujú sa neurologické symptómy a väčšina pacientov do 3 rokov
života zomiera.
Incidencia sa odhaduje na 1:50 000; u Židov vetvy Aškenazi až na 1:6400.
Mutácia
Proteín ASPA
Etnicita
854A>C
E285A
Aškenazi
696C>A
Y231X
Aškenazi
914C>A
A305E
Európska
Tab. 1. Prehľad najčastejších mutácií.
6
Biochemická a molekulárno-genetická podstata ochorenia. Príčinou ochorenia je deficiencia
aspartoacylázy (ASPA) (EC3.5.1.15), enzýmu, fyziologicky exprimovaného v gliových bunkách bielej
hmoty. Úlohou ASPA je hydrolýza N-acetyl-aspartátu (NAA) na aspartát a acetát. Absencia ASPA
vedie k akumulácii NAA v mozgu; sprievodná je tiež masívna exkrécia NAA močom NAA je
molekula, nájdená fyziologicky výlučne v nervovom systéme, doposiaľ s nie celkom objasnenou
funkciou. Jej množstvá varírujú v závislosti od lokalizácie v mozgu, druhových rozdielov, či
pôsobenia exogénnych faktorov. NAA je syntetizovaná z acetyl-CoA a L-aspartátovej kyseliny
ezýmom acetyl-CoA-L-aspartát N-acetyltransferáza (EC 2.3.1.2), ktorého distribúcia je podobná ako
distribúcia N-acetyl-aspartyl-glutamát (NAAG).
Gén pre ľudskú ASPA sa nachádza v oblasti krátkeho ramienka 17. chromozómu (17p13ter).
Skladá sa zo šiestich exónov a kóduje proteín s dĺžkou 313 AMK (36kDa).
Materiál a metódy
Stanovenie
organických
kyselín
v
moči.
Pozostáva
z
oximácie
moču
etoxyamínhydrochloridom. Ako vnútorná štandarda sa k moču pridáva kyselina fenylmaslová.
Organické kyseliny sú extrahované do etylacetátu (procedúra sa opakuje dvakrát). Po odparení
organického rozpúšťadla sa robí derivatizácia vzorky v zmesi acetonitril, pyridín, BSTFA,
dimetylchlorosilán. Samotná GC/MS analýza prebieha na GC/MS analyzátori (GCQ Finnigan MAT)
na kapilárnej kolóne DB-XLB s teplotným gradientom (1min. 100°C, 7°C/min. do 150 °C, 12 °C/min.
do 280 °C). Registrované sú ióny 50-500 m/z.
Molekulárno-genetická detekcia mutácií génu ASPA: Z izolovanej genomickej DNA
leukocytov, resp. amniocytov PCR metódou prednostne amplifikujeme 6. exón; následne sa amplifikát
štiepi restriktázou HpyCH4V za účelom analýzy dĺžky restrikčných fragmentov (RFLP) tohto exónu,
keďže až u 40% pacientov s ochorením bola detekovaná mutácia 914C>A. V prípade negatívneho
nálezu – ale biochemických indikácií - amplifikujeme aj ostatné exóny a sekvenujeme ich.
Stanovenie ochorenia GC/MS vyšetrením u pacientov, ktorí spravidla vylučujú vysoké
množstvá metabolitu (NAA > 700mmol/mol kreatinínu; ref < 35), nepredstavuje diagnostický problém.
Vážnejšia situácia môže nastať pri prenatálnej diagnostike, kedy biochemická diagnostika, vzhľadom
na nízke hodnoty NAA v plodovej vode (častokrát nedekovateľné), by mohla byť nespoľahlivá. Preto
zavedenie molekulárno-genetickej diagnostiky v SR určovali prinajmenšom dva dôvody.
Želateľné bolo zistiť, aký typ mutácie je prítomný u pacientov v SR, druhým dôvodom bolo
vytvorenie podmienok pre možnú prenatálnu diagnostiku, ktorá by bola postavená na potvrdení, resp.
vylúčení mutácií v bunkách plodovej vody. K tomuto účelu boli na našom pracovisku zavedené a
optimalizované metodiky PCR amplifikácie 6-tich. exónov génu ASPA. Pre účely prenátálnej
diagnostiky sme modifikovali metódu izolácie DNA z amniocytov, súčasne sme preverili
optimalizované metódy amplifikácie DNA aj v bunkách plodovej vody. Pre vylúčenie maternálnej
bunkovej kontaminácie plodovej vody, sme analyzovali DNA plodu a DNA matky pomocou systému
STR polymorfizmov.
Výsledky a diskusia
Rodina 1: U vyšetreného jednoročného dieťaťa hodnota odpadu NAA bola 9031mmol/mol
kreatinínu. Klinický a biochemický nález zodpovedá dg. Canavanova choroba. V rodine boli ďalší
traja súrodenci, podľa údajov matky zdraví. Rodičia odmietli akékoľvek ďalšie vyšetrenia (vrátene
molekulárno-genetickej analýzy) u postihnutého dieťaťa ako aj u jeho súrodencov.
Rodina 2: U štvormesačného chlapca hodnota odpadu NAA predstavovala 1740 mmol/mol
kreatinínu. V rodine bolo aj ďalšie dieťa (dcéra) bez klinickej symptomatológie. Molekulárnou
analýzou sa odhalilo, že vyšetrovaný pacient je nositeľom mutácie 914C>A v 6. exóne. Matka i otec
boli pre túto mutáciu heterozygotmi.
Rodina 3: Pacientom bolo dvanásťročné dievča s hodnotami NAA v moči 1102mmol/mol
kreatinínu. Hodnota NAA v moči u otca bola 3,85mmol/mol kreatinínu, u matky zistená nebola.
Sekvenčnou analýzou sme odhalili homozygotnu mutáciu 914C>A v 6. exóne. U matky pacientky sa
vykonala aj prenatálna diagnostika plodu. Metabolit NAA v plodovej vode prítomný nebol,
molekulárno-genetickým vyšetrením sa zistilo, že plod je nositeľom mutácie 914C>A v
heterozygotnom stave.
Canavanova choroba, spolu s Krabbeho chorobou a ochoreniami peroxizómového
kompartmentu sú tromi najčastejšími príčinami leukodystrofických zmien mozgu. Biochemické
vyšetrenia – hlavne GC/MS VLCFA séra a organických kyselín moču – môžu efektívne napomôcť v
7
diferenciálnej diagnostike Canavanovej choroby, u ktorej je výrazne zvýšený odpad NAA. Pre
peroxizómové ochorenia je charakteristickým nálezom zvýšenie hodnôt VLCFA v sére. Potvrdenie
diagnózy Krabbeho choroby vyžaduje vyšetrenie enzýmových aktivít v suspenzii leukocytov. V našich
troch prípadoch nález odpadu NAA v moči (9031, 1740, 1102 mmol/mol kreatinínu) umožňoval
jednoznačné určenie diagnózy Canavanovej choroby. Vyšetrenie tohto parametra v plodovej vode pri
prenatálnej diagnostike, aj podľa literárnych prameňov, nemusí byť vždy celkom spoľahlivé.
Závery
Molekulárno-gentickým vyšetrením bola u oboch pacientov zistená prítomnosť
najfrekventovanejšej mutácie (914C>A ), rovnako sme ju detekovali aj u jedného vyšetrovaného z ČR.
Preto sa domnievame, že v diagnostickom algoritme je najvhodnejšia (po metabolickom vyšetrení, ako
aj pri prenatálnej diagnostike) sekvenčná analýza 6. exónu.
CLGFNsP ponúka komplexnú diagnostiku Canavanovej choroby pre pacientov
stredoeurópskeho regiónu.
Použitá literatúra
1. Beaudet, A.L.: Aspartoacylase deficiency (Canavan disease). In: Scriver, Beaudet, Sly, Valle, Childs, Kinzler,
Vogelstein (eds): The meatbolic & molecular bases of inherited disease, vol. IV. 5799–5805, 2001.
2. Gordon, N.: Canavan disease: a review of recent developments. Eur J Paediatr Neurol. 5(2): 65–9, 2001.
3. Kumar, S., Mattan. NS., de Vellis, J.: Canavan disease: a white matter disorder. Ment Retard Dev Disabil Res
Rev. 12(2): 157–65, 2006.
4. Matalon, R., Michals-Matalon, K.: Molecular basis of Canavan disease. Eur J Paediatr Neurol. 2(2): 69–76,
1998.
5. Surendran, S., Matalon T.M., Tyring, S.K., Matalon, R.: Molecular basis of Canavan's disease: from human to
mouse. J Child Neurol. 18(9): 604–10, 2003.
6. Surendran, S., Michals-Matalon, K., Quast, MJ., Tyring, SK., Wei, J., Ezell, EL., Matalon, R.: Canavan
disease: a monogenic trait with complex genomic interaction. Mol Genet Metab. 80(1-2): 74–80, 2003.
8
Testovanie toxicity chemických látok v podmienkach in vitro
Ľuboš Danisšovič1, Juraj Krajčovič2, Ján Vojtaššák1
Univerzita Komenského v Bratislave, Lekárska fakulta, 1Ústav lekárskej biológie a genetiky; 2Prírodovedecká
fakulta, Ústav bunkovej biológie, Bratislava, Slovenská Republika, [email protected]
Abstrakt
V dnešnej dobe sa pripraví veľké množstvo chemických látok a materiálov, ktoré sú
určené na humánne použitie. Súčasťou ich charakterizácie je aj ich testovanie na potenciálny
toxický účinok. V predkladanom článku autori prehľadne opisujú využitie in vitro systémov
pri testovaní očnej a kožnej dráždivosti, hepatotoxicity, nefrotoxicity, hematotoxicity,
neurotoxicity a embryotoxicity.
Úvod
V súčasnosti sa vyprodukuje veľké množstvo chemických látok alebo materiálov, ktoré
prichádzajú do úzkeho kontaktu s ľudským organizmom. Z tohto dôvodu je potrebné ich testovanie na
potencionálny toxický účinok. Klasické toxikologické testy sa vykonávajú na zvieracích modeloch, čo
predstavuje enormnú časovú, personálnu a najmä ekonomickú záťaž. Mnoho organizácií poukazuje aj
na ich neetickú stránku súvisiacu najmä s neprimerane krutým zaobchádzaním s pokusnými zvieratami.
Od druhej polovice osemdesiatych rokov minulého storočia sa stále častejšie in vivo modely
nahrádzajú in vitro systémami. Ich využitím dochádza k redukcii pokusných zvierat
a k nezanedbateľnému ekonomickému efektu. V mnohých prípadoch na základe ich prediktívnych
výsledkov k testovaniu in vivo vôbec nedochádza. Výhodou in vitro systému je aj to, že je možné
presné zadefinovanie experimentálnych podmienok s elimináciou externých vplyvov. Okrem
testovania toxicity prináša použitie in vitro systému aj poznatky o mechanizmoch pôsobenia
testovaných látok, ktoré sa nedajú získať pri pokusoch na zvieratách.
Aby však bolo možné získané výsledky plnohodnotne využiť, je potrebná validácia in vitro
experimentov. Výsledky procesu validácie sú publikované vo forme špeciálnych odporúčaní
a laboratórnych manuálov. Ďalším dôležitým výstupom je vytváranie databáz, ku ktorým majú prístup
toxikologické laboratóriá po celom svete. Takto sa získané výsledky z in vitro systému stávajú
reprodukovateľné a je možná ich presná interpretácia aj vo vzťahu k živým organizmom. Okrem toho
sa získané výsledky používajú aj pre plánovanie ďalších špecifických testov, nevynímajúc
experimenty na zvieracích modeloch, pokiaľ je nevyhnutné ich vykonanie.
V nasledujúcom texte sú opísané základné informácie o využití in vitro testov pri testovaní
očnej a kožnej dráždivosti, hepatotoxicity, nefrotoxicity, hematotoxicity, neurotoxicity a
embryotoxicity.
In vitro systém a jeho využitie v toxikologických experimentoch
Možnosť využitia bunkových a tkanivových kultúr v genotoxikológii a farmakotoxikológii
ako prví opísali Pomerat a Leake (1954). V šesťdesiatych rokoch sa problematike využitia in vitro
systémov v toxikológii venovali ďalšie tímy, ktoré porovnávali výsledky testovania cytotoxicity na
zvieracích modeloch a na in vitro systémoch (Smith et al., 1963). V tomto období boli opísané
súvislosti medzi cytotoxicitou in vitro a toxicitou študovanou na zvieracích modeloch. Aj napriek
uvedenému sa začali in vitro systémy rutinne používať v toxikologických experimentoch až v druhej
polovici osemdesiatych rokov minulého storočia.
Ako biologické modely sa najčastejšie používajú primárne izolované bunky alebo definované
bunkové línie. V mnohých prípadoch sú geneticky modifikované s cieľom zvýšiť expresiu niektorých
špecifických enzýmov alebo dosiahnutia ich imortalizácie (Yeager et Reddel, 1999). Pri testovaní
teratogénov je možné použiť embryonálne a dospelé kmeňové bunky. Taktiež sa používajú
trojdimenzionálne modely s definovanou geometriou, čo umožňuje sledovanie vzťahov na úrovni
štruktúra – funkcia a zachovanie bunkových interakcií. Tieto modely dovoľujú zachovať hlavné
bunkové funkcie počas definovaného času a vykazujú nízky stupeň diferenciácie (Zucco et al., 2004).
Aj napriek tomu, že je in vitro systém schopný na bunkovej úrovni imitovať niektoré základné
fyziologické charakteristiky, mnohé procesy sú izolované od komplexných bunkových, tkanivových a
orgánových interakcií in vivo. Z toho dôvodu sa vyvíjajú in vitro modely orgánovej toxicity pre mnoho
9
tkanív a orgánových sústav. Najčastejšie sú používané in vitro modely pre kožnú a očnú dráždivosť.
Taktiež je možné testovať v in vitro podmienkach nefrotoxicitu, neurotoxicitu, hepatotoxicitu a
hematotoxicitu. Vo všetkých uvedených prípadoch je potrebné použiť in vitro systém na rozdielnom
stupni zložitosti – napr. izolované premývané orgány, tkanivové štruktúry, primárne kultúry, bunkové
línie alebo subcelulárne frakcie (Spiemann et al., 1998).
Výstupy z in vitro testov sú založené na hodnotení porušenia membránovej permeability,
poškodenia mitochondrií, zmien morfológie a proliferačnej aktivity buniek. Poškodenie
cytoplazmatickej membrány sa najčastejšie zisťuje použitím trypánovej modrej (trypan blue exclusion
test) alebo detekciou obsahu intracelulárnych enzýmov alebo niektorých signálnych látok
v mimobunkovom priestore (Corsini et Galli, 1998; Faller et Bracher, 2002). Veľmi často je
používaný MTT test (Fentem et al., 2001). Používajú sa aj testy zachytávajúce vylúčenie označeného
izotopu chrómu (51Cr) alebo test absorpcie uridínu (Holden et al., 1977; Valentin et al., 2001).
Poškodenie membrán je možné zistiť aj sledovaním ich konformačných zmien niektorými
biofyzikálnymi metódami (Weis et al., 2005). V súčasnosti sú vyvinuté rôzne metódy umožňujúce
detekciu apoptózy a nekrózy (Lin et al., 2004). Veľmi často sa využívajú molekulárno-biologické
metódy, ktoré umožňujú určiť poškodenie bunky na úrovni nukleových kyselín (Nuwaysir et al., 1999).
Taktiež existujú testy na detekciu tvorby toxických voľných radikálov, ktoré zapríčiňujú poškodenie
buniek oxidáciou nukleových kyselín, proteínov a membránových lipidov (Kopáni et al., 2006).
Výsledky získané z in vitro testov (najmä kvantitatívne parametre) sú používané aj pri testoch
na rôznych fyziologických modeloch s cieľom predpovedať vplyv na metabolizmus, transport
a farmakodynamiku testovaných látok v in vivo podmienkach (MacGregor et al., 2001). Niektoré
možnosti in vitro systémov v uvedenej súvislosti ilustruje obrázok 1.
Obr. 1. Predpoklad reakcie človeka na testovanú látku. Využitie dát získaných z in vitro a in vivo
experimentov.
In vitro testovanie kožnej a očnej dráždivosti
Jedným z najznámejších testov, ktoré sa používajú v toxikologických štúdiách je test očnej a
kožnej dráždivosti – Draizeho test (Draize et al, 1944). Ako modelový organizmus sa používa králik,
do ktorého očí sa pridáva testovaná látka. V definovaných časových intervaloch sa vyhodnocujú
morfologické zmeny na rohovke, spojivkách a dúhovke. Tento test a jeho modifikácie má mnoho
nedostatkov, medzi ktoré patria napr. neschopnosť poskytnúť informácie o mechanizmoch toxicity,
neadekvátna objektivita skórovania, časová a ekonomická náročnosť. V posledných rokoch sa vyvíjajú
a využívajú nové in vitro testy, ktoré doplňujú alebo nahrádzajú Draizeho test.
Pri in vitro testovaní očnej dráždivosti sa využívajú keratinocyty kultivované v monovrstve
a stratifikované 3D modely (Harbell et al., 1997; Curren et al.,1997). Na keratinocytoch kultivovaných
v monovrstve je možné testovať kvapalné chemické látky a ich vplyv na poškodenie vonkajšej vrstvy
rohovky. Determinuje sa viabilita buniek po krátkodobej alebo dlhodobej expozícii testovanou látkou.
Testovanie vo vode nerozpustných materiálov je možné vykonať na 3D modeloch. Ich využitím je
možné dosiahnuť experimentálne podmienky podobné in vivo systému. Tieto modely sú pripravené
kultiváciou keratinocytov na permeabilných membránach. Povrch takto pripravených tkanív môže byť
10
priamo vystavený testovaným materiálom a ich použitím je možné získať informácie o časovo závislej
cytotoxicite a strate bariérovej funkcie (Kruszewski et al., 1997).
V súčasnosti sa pri testovaní očnej dráždivosti využívajú aj artificiálne rohovky, ktoré sú
pripravované metódami tkanivového inžinierstva z ľudských epitelových a endotelových buniek
(Suuronen et al., 2005). Tieto tkanivá sú transparentné a toxický účinok testovaných látok sa prejaví
ich eróziou alebo zakalením. Vývojom tohto modelu bude možné získať relevantné údaje o miere
poškodenia spojenej so stupňom a trvaním toxického pôsobenia.
Pre testovanie kožnej dráždivosti boli vyvinuté viaceré normálne (netransformované)
keratinocytové a fibroblastové kultúry, vrátane viacerých trojdimenzionálnych modelov (Botham et al.,
1998). Na monovrstvových kultúrach sa testuje vplyv jednotlivých zložiek testovaných látok alebo
materiálov na proliferačnú aktivitu, diferenciáciu a expresiu cytokínov. Pri testovaní finálnych
výrobkov sa používajú dva rozdielne modely kože. Sú to epidermálne ekvivalenty zložené
z keratinocytov kultivovaných vo viacerých vrstvách na syntetických náhradách ECM
alebo ekvivalenty kompletnej kože pripravené kultiváciou keratinocytov a fibroblastov na
kolagénových matriciach (Ponec et al., 2002). V obidvoch prípadoch dochádza k vytvoreniu
organizovaného stratum corneum, ktorý predstavuje funkčnú bariéru. V súčasnosti sú komerčne
dostupné mnohé ekvivalenty kože, napr. EpiDerm (MatTek, USA), Episkin (Episkin, Francúzko),
Apligraf (Organogenesis Inc., USA) a Skinethic (Skinethic, Francúzko). Uvedené ekvivalenty kože sú
v porovnaní s kožou in vivo charakterizované vysokou mierou permeability. Ich využitím je možné
zistiť aj veľmi miernu kožnú dráždivosť (Perkins et al., 1999).
Pri in vitro testovaní kožnej dráždivosti je potrebné dodržať niekoľko podmienok. Expozícia
keratinocytov, fibroblastov alebo ich ko-kultúry testovanou látkou musí zohľadňovať prekutánnu
absorpciu in vivo. Vznikajúce metabolity in vitro musia byť analogické tým, ktoré vzniknú in vivo.
V prípade, že je použitý iba model pozostávajúci z keratinocytov, je interpretácia výsledkov
limitovaná neprítomnosťou ostatných typov buniek, ktoré sa vyskytujú in vivo. Testovanie práškov,
gélov, pien a krémov je vhodné vykonať na 3D modeloch. Pri in vitro testovaní toxicity špecifických
chemických látok, vrátane liečiv, je dodržanie vymenovaných predpokladov dôležité, ale výsledky je
potrebné interpretovať vo vzťahu k výsledkom získaným z in vivo modelov (Davila et al., 1998).
In vitro testovanie hepatotoxicity
Pečeň je hlavným orgánom metabolizmu. Hepatocyty prejavujú najvyššiu expresiu
a katalytickú aktivitu enzýmov, ktoré sú zahrnuté do metabolického procesu. Toto je dôvodom prečo
sú in vitro modely pečene najčastejšie používané pri štúdiu metabolizmu rôznych látok, vrátane liečiv
(Zucco et al., 2004). Za posledných desať rokov sa ich využitie v toxikologických experimentoch
veľmi rozšírilo. Vyvinuli sa in vitro systémy na viacerých úrovniach zložitosti – od perfúznych
modelov pečene, cez pečeňové rezy a kultúry hepatocytov až po izolované organely (Silber et al.,
1994). Tieto systémy umožňujú determináciu mechanizmov hepatotoxicity, ktoré zahŕňajú napr.
zmeny cytoskeletu, narušenie homeostázy katiónov Ca2+ a K+, inhibíciu transportu látok a zlyhanie
mechanizmov autoreparácie tkanív (Davila et al., 1998). Toxický vplyv látok na hepatocyty je
sprevádzaný rapídnymi zmenami ich biochemizmu, ktoré sa dajú presne zmerať. Dochádza k zníženiu
syntézy a sekrécie albumínu, obsahu ATP, k zmenám produkcie žlčových kyselín a bilirubínu. Taktiež
je ovplyvnená hladina a aktivita cytochrómu P450, hladiny glutatiónu, alkalickej fosfatázy, asparát
a alanín transferáz a glukoneogenéza (Silber et al., 1994).
Hepatocytové systémy sa tradične používali ako in vitro modely pri štúdiu funkcie pečene a
v toxikologických experimentoch k predikcii toxického účinku rôznych látok. Dôvody pre ich využitie
vychádzajú z etických a ekonomických súvislosti a z rozšírenia vedomostí o technických aspektoch
izolácie a kultivácie hepatocytov. Významná je aj ich vysoká metabolická kapacita a relatívna
jednoduchosť ich získania z čerstvých pečení, ktoré nespĺňajú podmienky pre transplantácie. Okrem
vymenovaného majú hepatocyty biotransformačnú schopnosť, pri ktorej vznikajú reaktívne formy
chemických látok schopné poškodiť DNA (Blaauboer, 2003).
V súčasnosti sa najčastejšie používajú primárne kultúry zvieracích alebo ľudských
hepatocytov. Na ich úrovni sa počas definovanej doby prejavujú špecifické funkcie pečene in vivo. Ich
dlhodobou kultiváciou (pasážovaním alebo imortalizáciou) niektoré z týchto funkcií postupne zanikajú,
napríklad prestávajú syntetizovať izoformy cytochrómu P450 (O'Brien et al., 2004). Tento problém sa
podarilo vyriešiť zvládnutím techník kryoprezervácie primárnych hepatocytov (Hengstler et al., 2000).
Zmrazené hepatocyty si zachovávajú takmer nezmenenú enzymatickú a syntetickú aktivitu. Okrem
toho bola opísaná možnosť kvantitatívnej a špecifickej inhibície izoforiem cytochrómov známymi
11
inhibítormi na rozmrazených ľudských hepatocytoch. Aj z tohto dôvodu sú kultúry hepatocytov
vhodným in vitro systémom pre identifikáciu metabolitov a pre vyhodnotenie metabolickej stability
(Bayliss et al., 1999).
Jednou z možností stanovenia interakčného potenciálu chemickej látky je hodnotenie jej
vplyvu na izoformy cytochrómu P450 v podmienkach in vitro na ľudských hepatocytoch. Model
intaktných hepatocytov navyše umožňuje sledovať rozdelenie chemických látok medzi plazmou
a pečeňou. Výsledky z tohto in vitro systému sú porovnateľné s výsledkami získanými z in vivo
modelov. Ďalší dôležitý mechanizmus interakcie chemických látok je indukcia syntézy enzýmov. Aj
v tejto súvislosti bolo opísané využitie ľudských hepatocytov (Silva et al., 1998).
Okrem kultúr hepatocytov sa pri testovaní hepatotoxicity in vitro používajú pečeňové rezy,
ktoré obsahujú aj iné typy buniek a zachovávajú si normálnu architektúru a funkciu pečene (Catania et
al., 2003). Validácia ich metabolickej schopnosti sa vykonáva podľa štandardov, ktoré presne definujú
biotransformáciu in vitro a in vivo. Na základe uvedeného dochádza k optimalizácii kultivačných
podmienok, čím sa zvyšuje ich výpovedná hodnota v predikcii vplyvu rôznych testovaných látok.
Mnoho autorov opísalo využitie pečeňových rezov zvieracieho a ľudského pôvodu ako in vitro
modelov pri testovaní vplyvu látok na metabolizmus (Price et al., 2004; Vickers et Fisher, 2005).
In vitro systémy testovania hepatotoxicity zahŕňajú aj použitie mikrozómov a enzýmov
získaných z homogentátov a subcelulárnych frakcií. Ich výhodou, oproti bunkám a tkanivovým rezom,
je fakt, že ich môžeme získať aj z dlhodobo zmrazených tkanív (Guengerich, 1996).
In vitro testovanie nefrotoxicity
Ďalším cieľovým orgánom pre toxický účinok mnohých látok je oblička. Nefrotoxické látky
môžu nevratne poškodiť niektoré segmenty nefrónov, najčastejšie proximálny kanálik alebo
glomerulus. Tradičné testovanie nefrotoxicity na zvieracích modeloch umožňuje determinovať tieto
látky, ale vzhľadom na štruktúrnu a funkčnú heterogenitu tkaniva obličiek nie je v mnohých prípadoch
možné určiť presný mechanizmus ich pôsobenia. Použitie in vitro systémov umožňuje presne stanoviť
toxický vplyv a mechanizmus na rôznych stupňoch organizácie (Rodriguez-Barbero et al., 2000).
Medzi často používané in vitro modely testovania nefrotoxicity patria primárne a imortalizované
kultúry tubulárnych buniek, obličkové rezy, perfúzne juxtamedulárne nefróny, izolované obličkové
cievy a obličkové kanáliky (Pfaller et Gstraunthaler, 1998).
Mnoho autorov opísalo využitie primárnych kultúr tubulárnych buniek (Zager et al., 2004;
Martínez-Salgado et al., 2007). Grundemann et al. (1997) dokázali, že tubulárne bunky si v in vitro
podmienkach zachovávajú mnoho vlastnosti, ktoré sa vyskytujú in vivo. Na týchto bunkách je možné
testovať priamy účinok chemických látok, ich transport a metabolizmus. Zásadný vplyv na aplikáciu v
toxikológii má zvýšená proliferačná aktivita týchto buniek, ako aj možnosť ich dlhodobého
skladovania. Primárne izolované kultúry sú vhodné modely testovania akútnej nefrotoxicity. V tejto
súvislosti bolo opísané testovanie látok na primárnych kultúrach adherovaných tubulárnych buniek,
ako aj na bunkách v suspenzii (Boogaard et al., 1990).
Okrem tubulárnych buniek sa používajú mesangiálne bunky, ktoré majú niekoľko funkcií,
napr. syntéza medzibunkovej hmoty, endocytóza, kontrola glomerulárnej hemodynamiky,
glomerulárna kontrakcie, atď. Na mesangiálnych bunkách sa testoval nefrotoxický účinok
cyklosporínu A, cisplatiny, kadmia, atď. (Rodriguez-Barbero et al., 2000).
Využitie bunkových kultúr je limitované, nakoľko kultivované bunky si zachovávajú pôvodné
morfologické a biochemické vlastnosti len počas presne definovaného času. Tieto vlastnosti sa
strácajú ich dlhodobou kultiváciou a pasážovaním (Pfaller et Gstraunthaler, 1998). Pri testovaní
dlhodobého nefrotoxického efektu sa používajú perfundované obličky, ktoré si zachovávajú
morfológiu aj biochemické vlastnosti. Obličkové rezy umožňujú štúdium vplyvu látok na bunkový
transport a metabolizmus v štruktúre s relatívne zachovanou architektúrou a bunkovou heterogenitou
bez vplyvu obehových zmien (Vickers et al., 2004). Dobre dokumentované je aj využitie izolovaných
glomerulov, ktoré sa používajú ako in vitro modely štúdia priameho vazoaktívneho efektu chemických
látok a pri testovaní vplyvu na hemodynamiku (Rodriguez-Barbero et al., 2000).
In vitro testovanie hematotoxicity
Pri testovaní toxického účinku chemických látok sa vykonáva aj testovanie na hematotoxicitu.
Toto testovanie na in vivo modeloch vyžaduje vykonať štúdie na minimálne dvoch živočíšnych
druhoch, čo je časovo ako aj ekonomicky veľmi náročné. Preto sa väčšina preliminárnych testov čoraz
častejšie vykonáva na in vitro modeloch. Tieto modely sú založené najmä na identifikácii cieľových
12
subpopulácií buniek v hematopoetickom tkanive a umožňujú skúmanie mechanizmov, ktorými
testovaná látka pôsobí na tieto bunky (Holt et al., 1998).
V predikcii hematoxického účinku niektorých chemikálií v podmienkach in vitro sa často
používa „colony forming assay“ – CFU, ktorý je dopĺňaný histopatolgickou analýzou kvôli
charakterizácii myelotoxicity (Pessina et al., 2005). Prvé štúdie boli vykonané pred vyše tridsiatimi
rokmi. Viacerí autori takto testovali vplyv jednotlivých a opakovaných dávok rôznych chemických
látok na myelopoézu (Dunn, 1972). V súčasnosti sa vďaka dostupnosti purifikovaných
a rekombinantných cytokínov, nevyhnutných pre stimuláciu proliferácie progenitorových buniek in
vitro, používa pre každú bunkovú líniu izolovanú z kostnej drene. Výhodou tohto testu je jeho
reprodukovateľnosť dosiahnuteľná optimalizáciou kultivačných podmienok, napr. odber, metóda
izolácie buniek, atď. (Gribaldo et al., 1996).
In vitro testovanie neurotoxicity
Nervový systém je jeden z najzložitejších a najkomplexnejších v ľudskom organizme
s ohľadom na štruktúru a funkciu. Mnoho chemických látok môže ovplyvniť jeho embryonálny vývin
a fungovanie počas dospelosti, preto je nevyhnutné testovanie chemických látok na neurotoxicitu.
Klasické in vivo testy sú postupne dopĺňané o alternatívne testovanie na modeloch in vitro. Získané
výsledky vychádzajú zo zjednodušených prístupov, ktoré nevyžadujú podstatné ekonomické a časové
zaťaženie. Na druhej strane sú vyňaté z kontextu živého organizmu a preto sa považujú za
preliminárne testy, ktoré je potrebné doplniť o informácie získané testovaním na zvieracích modeloch
(Harry et Tiffany-Castiglioni, 1998).
Z modelov in vitro neurotoxicity sa najčastejšie používajú primárne izolované bunky (napr.
neuróny, astrocyty, oligodendrocyty) alebo bunkové línie (napr. neuroblastómové a gliómové línie).
Schwannove bunky sú využívané pri sledovaní testovaných na myelinizáciu (Costa, 1998). Vyvinuté
boli aj modely „bariéry krv – mozog“, ktoré pozostávajú z kokultúry gliových a endotelových buniek
(Stanness et al., 1997). Ďalej sa požívajú organotopické a explantové kultúry ako aj tenké rezy
rôznych častí mozgu, predĺženej miechy a miechy (Luo et al., 1999; Noraberg et al., 2005).
In vitro testovanie embryotoxicity
Mnoho chemických látok negatívne ovplyvňuje embryonálny vývin jedinca, čo môže viesť ku
vzniku rôznych vývojových chýb. Z tohto dôvodu je potrebné testovanie chemických látok na
embryotoxicitu. Klasické testy vyžadujú veľké množstvo embryí a plodov laboratórnych zvierat.
Alternatívne in vitro testy sa vykonávajú na bunkových alebo organotopických kultúrach a na
kultivovaných embryách. Primárne kultúry a bunkové línie prinášajú základné informácie o vplyve
látok na proliferáciu, metabolizmus a diferenciáciu buniek, teda o procesoch, ktoré sú dôležitou
súčasťou vývinu (Scholz et al., 1999). Významným in vitro modelom pri testovaní embryototoxicity
sú embryonálne kmeňové bunky (Rohwedel et al., 2001). Ich využitie je však v mnohých prípadoch
limitované, najmä z etických dôvodov. Uvedené testy sa vykonávajú aj na kompletných embryách
kultivovaných in vitro (Piersma et al., 1995).
Závery
S rastúcou produkciou nových chemických látok pre použitie v medicíne, kozmetickom alebo
potravinárskom priemysle bude nevyhnutné ich testovanie na potencionálny toxický účinok. S tým
bude súvisieť nielen používanie zaužívaných in vitro testov, ale aj ich modifikácia. Okrem toho bude
aj naďalej vyvíjaný tlak na vývoj a zavedenie do praxe úplne nových testov využívajúcich in vitro
modelov z dôvodu potrebnej redukcie testov in vivo.
Poďakovanie
Táto práca bola podporená grantom APVT 20-003104.
Použitá literatúra
1. Blaauboer, B.J., Boobis, A.R., Castell, J.V., et al.: The practical applicability of hepatocyte cultures in routine
testing. Altern Test Lab Anim. 22: 231–41, 1994.
2. Boogaard, P.J., Nagelkerke, J.F., Mulder, G.J.: Renal proximal tubular cells in suspension or in primary
culture as in vitro models to study nephrotoxicity. Chem Biol Interact. 76(3): 251–91, 1990.
3. Botham, P.A., Earl, L.K., Fentem, J.H., et al.: Alternative methods for skin-irritation testing. The current
status. ATLA. 26: 195–211, 1998.
13
4. Catania, J.M., Parrish, A.R., Kirkpatrick, D.S., et al.: Precision-cut tissue slices from transgenic mice as an in
vitro toxicology system. Toxicol In Vitro. 17(2): 201–5, 2003.
5. Corsini, E., Galli, C.L.: Cytokines and irritant contact dermatitis. Toxicol Lett. 102-103: 277–82, 1998.
6. Costa, L.G.: Biochemical and molecular neurotoxicology: relevance to biomarker development, neurotoxicity
testing and risk assessment. Toxicol Lett. 102-103: 417–21 1998.
7. Curren, R.D., Sina, J.F., Feder, P., et al.: IRAG working group 5. Other assays. Interagency Regulatory
Alternatives Group. Food Chem Toxicol. 35(1): 127–58, 1997.
8. Davila, J.C., Rodriguez, R.J., Melchert, R.B., et al.: Predictive value of in vitro model systems in toxicology.
Annu Rev Pharmacol Toxicol. 38: 63–96, 1998.
9. Draize, J.H., Woodward, G., Calver, H.O.: Methods for the stody of irritation and toxicity of substances
applied topically to the skin and mucous mambranes. J Pharmacol Exp Ther. 82: 377–90, 1944.
10. Dunn, C.D.: Cell proliferation and drug resistance in the response of colony-forming units of rat bone
marrow to repeated doses of cytotoxic agents. J Natl Cancer Inst. 48(3): 639–49, 1972.
11. Faller, C., Bracher, M.: Reconstructed skin kits: reproducibility of cutaneous irritancy testing. Skin
Pharmacol Appl Skin Physiol. 15(Suppl 1): 74–91, 2002.
12. Fentem, J.H., Briggs, D., Chesne, C., et al.: A prevalidation study on in vitro tests for acute skin irritation.
results and evaluation by the Management Team. Toxicol In vitro. 15(1): 57–93, 2001.
13. Gribaldo, L., Bueren, J., Deldar, A. The use of in vitro systems for evaluating haematotoxicity. ECVAM
Workshop Report 14. ATLA. 24: 211–31, 1996.
14. Grundemann, D., Babin-Ebell, J., Martel, F., et al.: Primary structure and functional expression of the apical
organic cation transporter from kidney epithelial LLC-PK1 cells. J Biol Chem. 272(16): 10408–13, 1997.
15. Guengerich, F.P.: In vitro techniques for studying drug metabolism. J Pharmacokinet Biopharm. 24(5): 521–
33, 1996.
16. Harbell, J.W., Koontz, S.W., Lewis, R.W., et al.: IRAG working group 4. Cell cytotoxicity assays.
Interagency Regulatory Alternatives Group. Food Chem Toxicol. 35(1): 79–126, 1997.
17. Harry, G.J., Tiffany-Castiglioni, E.: Evaluation of neurotoxic potential by use of in vitro systems. Expert
Opin Drug Metab Toxicol. 1(4): 701–13, 2005.
18. Hengstler, J.G., Ringel, M., Biefang, K., et al.: Cultures with cryopreserved hepatocytes: applicability for
studies of enzyme induction. Chem Biol Interact. 125(1): 51–73, 2000.
19. Holden, H.T., Oldham, R.K., Ortaldo, J.R., et al.: Standardization of the chromium-51 release, cell-mediated
cytotoxicity assay: cryopreservation of mouse effector and target cells. J Natl Cancer Inst. 58(3): 611–22, 1977.
20. Holt, D.E., Andrews, C.M., Payne, J.P., et al.: The myelotoxicity of chloramphenicol: in vitro and in vivo
studies: II: In vivo myelotoxicity in the B6C3F1 mouse. Hum Exp Toxicol. 17(1): 8–17, 1998.
21. Kopáni, M., Celec, P., Danišovič, Ľ., et al.: Oxidative stress and electron spin resonance. Clin Chim Acta.
364(1-2): 61–6, 2006.
22. Kruszewski, F.H., Walker, T.L., DiPasquale, L.C.: Evaluation of a human corneal epithelial cell line as an in
vitro model for assessing ocular irritation. Fundam Appl Toxicol. 36(2): 130–40, 1997.
23. Lin, W., Kemper, A., McCarthy, K.D., et al.: Interferon-gamma induced medulloblastoma in the developing
cerebellum. J Neurosci. 24(45): 10074–83, 2004.
24. Luo, F.R., Wyrick, S.D., Chaney, S.G.: Comparative neurotoxicity of oxaliplatin, ormaplatin, and their
biotransformation products utilizing a rat dorsal root ganglia in vitro explant culture model. Cancer Chemother
Pharmacol. 44(1): 29-38, 1999.
25. MacGregor, J.T., Collins, J.M., Sugiyama, Y., et al.: In vitro human tissue models in risk assessment: report
of a consensus-building workshop. Toxicol Sci. 59(1): 17–36, 2001.
26. Martínez-Salgado, C., López-Hernández, F.J., López-Novoa, J.M.: Glomerular nephrotoxicity of
aminoglycosides. Toxicol Appl Pharmacol. 223(1): 86–98, 2007.
27. Noraberg, J., Poulen, F.R., Blaabjerg, M., et al.:Organotypic hippocampal slice cultures for studies of brain
damage, neuroprotection and neurorepair. Curr Drug Targets CNS Neurol Disord. 4(4): 435–52, 2005.
28. Nuwaysir, E.F., Bittner, M., Trent, J., Barrett, J.C., Afshari, C.A.: Microarrays and toxicology: the advent of
toxicogenomics. Mol Carcinog. 24(3): 153–9, 1999.
29. O'Brien, P.J., Chan, K., Silber, P.M.: Human and animal hepatocytes in vitro with extrapolation in vivo.
Chem Biol Interact. 150(1): 97–114, 2004.
30. Perkins, M.A., Osborne, R., Rana, F.R., et al.: Comparison of in vitro and in vivo human skin responses to
consumer products and ingredients with a range of irritancy potential. Toxicol Sci. 48(2): 218–29, 1999.
31. Pessina, A., Malerba, I., Gribaldo, L.: Hematotoxicity testing by cell clonogenic assay in drug development
and preclinical trials. Curr Pharm Des. 11(8): 1055–65, 2005.
32. Pfaller, W., Gstraunthaler, G.: Nephrotoxicity testing in vitro--what we know and what we need to know.
Environ Health Perspect. 106(Suppl 2): 559–69, 1998.
33. Piersma, A.H.: Validation of alternative methods for developmental toxicity testing. Toxicol Lett. 149(1-3):
147–53, 2004.
34. Pomerat, C.M., Lezme, C.D.: Short term cultures for drug assays: general considerations. Ann N Y Acad Sci.
58(7): 1110–28, 1954.
14
35. Ponec, M., Boelsma, E., Gibbs, S., Mommaas, M.: Characterization of reconstructed skin models. Skin
Pharmacol Appl Skin Physiol. 15(Suppl 1): 4–17, 2002.
36. Price, R.J., Renwick, A.B., Walters, D.G., et al.: Metabolism of nicotine and induction of CYP1A forms in
precision-cut rat liver and lung slices. Toxicol In Vitro. 18(2): 179–85, 2004.
37. Rodriguez-Barbero, A., L'Azou, B., Cambar, J., et al.: Potential use of isolated glomeruli and cultured
mesangial cells as in vitro models to assess nephrotoxicity. Cell Biol Toxicol. 16(3): 145–53, 2000.
38. Rohwedel, J., Guan, K., Hegert, C., et al.: Embryonic stem cells as an in vitro model for mutagenicity,
cytotoxicity and embryotoxicity studies: present state and future prospects. Toxicol In Vitro. 15(6): 741–53,
2001.
39. Schulz, G., Pohl, I., Genschow, E., et al.: Embryotoxicity screening using embryonic stem cells in vitro:
correlation to in vivo teratogenicity. Cells Tissues Organs. 165(3-4): 203–11, 1999.
40. Silber, P.M., Ruegg, C.E., Myslinski, N.: In vitro methods for predicting human toxicity. Lab Animal. 23:
33–37, 1994.
41. Silva, J.M., Morin, P.E., Day, S.H., et al.: Refinement of an in vitro cell model for cytochrome P450
induction. Drug Metab Dispos. 26(5): 490–6, 1998.
42. Smith, C.G., Grady, J.E., Northam, J.I.: Relationship between cytotoxicity in vitro and whole animal toxicity.
Cancer Chemother Rep. 30: 9–12, 1963.
43. Spielmann, H., Liebsch, M., Reinhardt, C.: ERGATT/ECVAM Workshop on Acceptance of Validated
Alternative Methods: Amden III. ALTEX. 15(1): 18–22, 1998.
44. Stanness, K.A., Westrum, L.E., Fornaciari, E., et al.: Morphological and functional characterization of an in
vitro blood-brain barrier model. Brain Res. 771(2): 329–42, 1997.
45. Suuronen, E.J., Sheardown, H., Newman, K.D., et al.: Building in vitro models of organs. Int Rev Cytol. 244:
137–73, 2005.
46. Valentin, I., Philippe, M., Lhuguenot, J., et al.: Uridine uptake inhibition as a cytotoxicity test for a human
hepatoma cell line (HepG2 cells): comparison with the neutral red assay. Toxicology. 158(3): 127–39, 2001.
47. Vickers, A.E., Fischer, R.L.: Precision-cut organ slices to investigate target organ injury. Expert Opin Drug
Metab Toxicol. 1(4): 687–99, 2005.
48. Vickers, A.E., Rose, K., Fisher, R., et al.: Kidney slices of human and rat to characterize cisplatin-induced
injury on cellular pathways and morphology. Toxicol Pathol. 32(5): 577–90, 2004.
49. Weis, M., Kopáni, M., Michalka, P., et al.: Conformation study of the membrane models by the Maxwell
displacement current technique and oxidative stress. J Biochem Biophys Methods. 65(2-3): 81–7, 2005.
50. Yeager, T.R., Reddel, R.R.: Constructing immortalized human cell lines. Curr Opin Biotechnol. 10(5): 465–9,
1999.
51. Zager, R.A., Johnson, A.C., Hanson, S.Y.: Parenteral iron nephrotoxicity: potential mechanisms and
consequences. Kidney Int. 66(1): 144–56, 2004.
52. Zucco, F., De Angelis, I., Testai, E., Stammati, A.: Toxicology investigations with cell culture systems: 20
years after. Toxicol In vitro. 18(2): 153–63, 2004.
15
Genómový imprinting, molekulárno-genetická diagnostika Prader-Williho/
Angelmanovho syndrómu
Mária Fischerová, Robert Petrovič, Lívia Lukáčková, Katarína Kolejáková, Jozef Adámať,
Ján Futas, Danka Maceková, Ľubica Strháková, Pavol Ipóth, Darina Ďurovčíková, Ján
Chandoga
Centrum lekárskej genetiky FNsP Bratislava, Slovenska Republika, [email protected]
Abstrakt
Expresia patologického fenotypu u niektorých genetických ochorení závisí na tom, či
mutovaná alela bola zdedená od otca, alebo od matky. Rozdiely v génovej expresii medzi
alelou zdedenou od matky alebo alelou zdedenou od otca zapríčiňuje genomový imprinting.
Imprinting spôsobuje zmenu v chromatíne (špecifická metylácia u rodičov), ktorá ovplyvňuje
expresiu génu, ale nie jeho DNA sekvenciu. Imprintovaný gén je definovaný skutočnosťou,
že je transkribovaný iba z 1 rodičovskej alely. Prader-Willi (PWS) a Angelmanov syndróm
(AS) sú zapríčinené alternatívnou stratou funkcie rozdielnych génov, nachádzajúcich sa na
dlhom ramene chromozómu 15(15q11-q13). PWS/AS región obsahuje 6 imprintovaných
génov. Za fyziologických okolností sa gény (SNRPN, NDN, MAGEL2, MKRN3) exprimujú
len pôvodom z paternálneho chromozómu a gény (UBE3A, ATP10A) sa exprimujú len
pôvodom z maternálneho chromozómu. Nefunkčnosť génov na paternálnom chromozóme
zapríčiňuje PWS, strata funkcie maternálnych génov je zodpovedná za AS. Tieto syndrómy sa
vyskytujú u oboch pohlaví a postihujú všetky rasy. Prevalencia PWS sa odhaduje na 1:10 000
– 15 000 a u AS na 1: 15 000 – 45 000. Molekulárno-genetická diagnostika je založená na
metylačne senzitívnej polymerázovej reťazovej reakcii, ktorá odlíši materskú alelu od
otcovskej.
Úvod
Expresia patologického fenotypu u niektorých genetických ochorení závisí na tom, či
mutovaná alela bola zdedená od otca, alebo od matky. Rozdiely v génovej expresii medzi alelou
zdedenou od matky alebo alelou zdedenou od otca zapríčiňuje genomový imprinting. Imprinting je
spôsobený chemickou modifikáciou – metyláciou cytozínov jednej z rodičovských aliel, ktorá sa
následne neexprimuje. Imprintovaný gén je definovaný skutočnosťou, že je transkribovaný iba z 1
rodičovskej alely. Alelovo špecifická metylácia postihuje CpG ostrovčeky v DNA (metylácia cytozínu
na 5-metylcytozín – obr. 1).
NH2
NH2
O
CH3
N
N
O
N
H
cytozín
N
H
5-metylcytozín
Obr. 1. Metylácia cytozínu
Prader-Willi (PWS) a Angelmanov syndróm (AS) sú zapríčinené alternatívnou stratou funkcie
rozdielnych génov, nachádzajúcich sa na dlhom ramene chromozómu 15(15q11-q13). PWS/AS región
obsahuje 6 imprintovaných génov. Za fyziologických okolností sa gény (SNRPN, NDN, MAGEL2,
MKRN3) exprimujú len pôvodom z paternálneho chromozómu a gény (UBE3A, ATP10A) sa
exprimujú len pôvodom z maternálneho chromozómu (obr. 2.).
Nefunkčnosť génov na paternálnom chromozóme zapríčiňuje PWS, strata funkcie
maternálnych génov je zodpovedná za AS.
16
SNRPN, NDN, MAGEL2 a MKRN3 sa exprimujú na paternálnom chromozóme. Stratou
aktivity alel týchto génov vzniká Prader- Willi syndróm. UBE3A a ATP10A vykazujú orgánovo
špecifickú maternálnu expresiu. Stratou aktivity alel týchto génov vzniká Angelmanov syndróm.
Tel
ATP10A
Obr. 2. Schéma imprintovaných génov, PWS/AS regiónu.
Materiál a metódy
DNA bola izolovaná z leukocytov periférnej krvi pomocou QIAamp DNA Mini Kit
(QIAGEN). Molekulárno-genetická diagnostika génu SNRPN je založená na metylačne senzitívnej
polymerázovej reťazovej reakcii (mPCR), ktorá dokáže odlíšiť maternálnu alelu od paternálnej alely.
Jej princípom je chemická premena nukleotidov. Cytozíny sú hydrogénsiričitanovou reakciou
pozmenené na uracily, pričom metylované cytozíny ostávajú nezmenené (obr. 3). V následnej mPCR
sa uracil páruje s adenínom a metylovaný cytozín s guanínom.
Obr. 3. Schematické znázornenie hydrogénsiričitanovej reakcie. Krok 1. sulfonácia, krok 2.
hydrolytická deaminácia, ireverzibilná reakcia, krok 3. alkalická desulfonácia
Pri alelovo-špecifickej metylačnej PCR sme použili dve sady primerov, ktoré odlíšia
metylovanú a nemetylovanú DNA. Použité primery boli publikované v práci Kubota a kol (1997).
20 µl reakčná zmes obsahovala 2x Dynamo SYBR Green premix, 0,3 mmol/l primerov, 50 ng
chemicky modifikovanej gDNA a sterilnú vodu doplnenú do výsledného objemu. Časovo-teplotný
profil amplifikácie špecifických fragmentov SNRPN génu metódou PCR: iniciálna denaturácia 95°C –
15 min., (denaturácia 95°C – 30 s, hybridizácia primerov 62°C – 30 s, syntéza DNA 72°C - 30s) 35
cyklov, dosyntetizovanie PCR produktov 72°C – 10 min.
Získané PCR produkty sme separovali v agarózovom géli. Fragmenty DNA sme vizualizovali
ožiarením na UV transluminátore pri 260 nm. Elektroforéza prebehala pri 100 V 30 minút.
Alternatívne analýza prebiehala na Real-time PCR termálnom cyklery, pričom sa monitoroval nárast
flourescencie SYBR Greenu. Následne prebehla analýza topenia PCR produktov (melting analýza).
Metylačne-špecifická PCR a RFLP – v chemicky premenenej DNA sme najprv amplifikovali
DNA sekvenciu obsahujúcu CpG dinukleotidy (fragment s dĺžkou 408 bp z 5´regoinu SNRPN génu),
1 µl PCR produktu sme následne pridali do nested PCR a amplifikovaný fragment sa štiepil
restrikčnou endonukleázou HhaI (podľa Velinov 2000). Restrikčné štiepenie prebehlo v termostate pri
37°C po dobu 16 hodín. Restrikčné fragmenty boli separované v 2,5% agarózovom géli, vizualizované
etídium bromidom, elektroforéza prebehala pri 100 V 40 minút.
17
Výsledky a diskusia
1
2
3
4
170 bp maternálna alela
100 bp paternálna alela
Obr. 4. Alelovo – špecifická metylačná PCR , odlíšenie materskej a otcovskej alely pomocou dvoch
sád primerov. Dráha 1. marker molekulovej hmotnosti, dráha 2, kontrola– materská alela -fragment
170 bp a otcovská alela - fragment 100 bp, dráha 3. pacient s Prader-Willi syndrómom- chýba
otcovská alela, prítomný len fragment 170 bp, dráha 4. pacient s Angelmanovým syndrómom- chýba
materská alela, prítomný len fragment 100 bp zodpovedajúci paternálnej alela
340 bp paternálna alela
224 bp maternálna alela
Obr. 5. Odlíšenie materskej a otcovskej alely restrikčnou analýzou génu SNRPN pomocou HhaI.
Neštiepený fragment 340 bp zodpovedá otcovskej alele, štiepený fragment s dĺžkou 224 bp pripadá
materskej alele. Dráha 1. marker molekulovej hmotnosti, dráha 2. kontrola - obsahuje obidva
fragmenty, dráha 3. pacient s PWS, dráha 4. pacient s AS
kontrola
paternálna alela
PWS pacient
maternálna alela
maternálna alela
paternálna alela
neprítomná
Obr. 6. Analýza pomocou alelovo-špecifickej Real-Time PCR. Pri alelovo-špecifickej Real-Time
PCR boli použité dve sady primerov. Odlíšenie materskej a otcovskej alely na základe rozdielneho
bodu topenia - melting analýzy PCR produktov - (otcovská alela 77,3°C; materská alela 83,7°C).
PWS pacienti majú maternálny epigenotyp vyplývajúci z absencie alel pochádzajúcich
z oblasti paternálneho chromozómu 15 (15q11-q13) alebo mutácii z imprintingového centra
vznikajúcich na otcovských chromozómoch. 70% prípadov vykazuje mikrodelécie úseku chromozómu
15q11-q13 (4 Mb), ktoré vznikajú počas meiotického delenia u muža. Maternálna uniparentálna
dizómia predstavuje 28% prípadov, kedy potomkovia zdedia dva chrómozomy 15 od matky a žiadny
od otca. Najčastejšie vzniká sekundárne po oprave trizómie, stratou otcovského chromozómu 15
18
v zygote. Menej ako 2% prípadov zapríčiňujú metylačné zmeny imprintingového centra (Rogan,
1998).
65-70% prípadov Angelmanovho syndrómu je spôsobených malými de novo deléciami (menej
ako 100kb) v oblasti 15q11-q13 na maternálnom chromozóme. Okolo 5% pacientov vykazuje
paternálnu uniparentálnu dizómiu chromozómu 15. Ostatné prípady sú výsledkom bodových mutácii
UBE3A génu (Rougeulle 1998).
Závery
Metylačne senzitívna PCR je vhodnou metódou pri diagnostike ochorení s poruchou
imprintingu. Dané molekulárno-genetické vyšetrenie rýchlo a spoľahlivo odhalí PWS/AS aj v tom
prípade, ak fluorescenčná in situ hybridizácia (FISH) nedetekovala deléciu tohto regiónu. Táto
metodika odhalí takmer všetky prípady PWS (nedetekuje iba veľmi zriedkavú mozaikovú formu tohto
ochorenia) a prípady AS spôsobené deléciami a uniparentálnou dizómiou. Bodové mutácie UBE3A
génu vyžadujú sekvenčnú analýzu tohto génu.
Použitá literatúra
1.Holm, V.A., Cassidy, S.B., Hitler, M.G., et al.: Prader-Willi syndrome: consensus diagnostic criteria.
Pediatrics. 91(2): 398-402, 1993.
2. Kubota, T., Das, S., Christian, S.L., et al.: Methylation-specific PCR simplifies imprinting analysis. Nat Genet.
16(1): 16–7, 1997.
3. Rogan, P.K., Seip, J.R., White, L.M., et al.: Relaxation of imprinting in Prader-Willi syndrome. Hum
Genet.103(6): 694–701, 1998.
4. Rougeulle, C., Lalande, M.: Angelman syndrome: how many genes to remain silent? Neurogenetics. 1(4):
229–37, 1998.
5. Velinov, M., Gu, H., Genovese, M., et al.: The feasibility of PCR-based diagnosis of Prader-Willi and
Angelman syndromes using restriction analysis after bisulfite modification of genomic DNA. Mol Genet
Metab. 69(1): 81–3, 2000.
19
Morfológia mikrocirkulácie ľudskej sleziny – súčasný stav poznania
Paulína Gálfiová, Katarína Bevízová
Univerzita Komenského v Bratislave, Lekárska fakulta, Ústav histológie a embryológie, Bratislava, Slovenská
Republika, [email protected]
Abstrakt
Mikrocirkulácia v slezine je komplikovaná. Týmto problémom sa zaoberali mnohí
autori, ich názory sa rôznia. V súčasnosti rozlišujú tri typy mikrocirkulácie – otvorený typ,
uzavretý typ a cirkuláciu v perifolikulárnej zóne. Väčšina autorov tvrdí, že v ľudskej slezine
dominuje otvorený typ cirkulácie. Nedá sa však jednoznačne a presne určiť, ktorý typ
mikrocirkulácie zastáva aký percentuálny podiel.
Úvod
Základnou úlohou sleziny ľudí je čistenie krvi (Brozman a Jakubovský, 1988). Jej význam
spočíva v odstránení všetkého, čo do krvi nepatrí a ponechanie v krvi toho, čo môže byť organizmu
užitočné. K procesu čistenia krvi patrí tiež ochrana organizmu, najmä proti patogénnym
mikroorganizmom. Proces čistenia zaisťuje usporiadanie cievneho systému tohto orgánu v súčinnosti s
faktormi nešpecifickej rezistencie organizmu, aj s imunitným systémom. V práci sa venujeme
funkčnej morfológii mikrocirkulácie sleziny.
Súčasný stav poznania a diskusia
Zásobenie sleziny arériovou krvou pochádza z arteria splenica. A. splenica odstupuje
samostatne z tripus Halleri, málokedy spolu s arteria hepatica, vzácne rovno z aorty. Chirurgicky je
najvýznačnejší predhilusový úsek arteria splenica (Belko et al., 1992; Bíró et al., 2008). Po vstupe do
sleziny sa vetví a v spojivových trabekulách prechádzajú vetvy a. splenica ako trabekulové artérie. Po
ich výstupe z trabekúl do pulpy okolo nich postupne pribúdajú periartériové lymfatické pošvy (PALP).
Označujú ich arteria centralis. Z a. centralis zavše odstupujú v pravom uhle folikulové artérie. Okolo
ich odstupu, v smere krvného prúdu, sa akumuluje lymfoidné tkanivo – lymfatické folikuly. A.
centralis sa v istých miestach rozpadá na viacero cievnych priesvitov a tvorí arteriokapilárový zväzok.
Ten má spoločnú retikulovu pošvu. Periartériová lymfatická pošva a lymfatické folikuly tvoria bielu
pulpu sleziny. Pokračujúce vetvy a. centralis prechádzajú cez zona marginalis do červenej pulpy, kde
sa delia na peniciliové arterioly. Peniciliové arterioly sa môžu končiť ako artériové kapiláry v červenej
pulpe, alebo sa oblúkovo vrátia cez zona marginalis do folikulov. Končia ako kapiláry v folikuloch, či
v zona marginalis. Pred koncom artériových kapilár sú kapiláry v určitom úseku obalené
perikapilárovou pošvou. (Brozman a Jakubovský, 1988, Jakubovský et al. 2001; Polák, 2005). Podľa
Brozmana a Jakubovského (1988) ju tvoria jemné tenké, aj hrubšie retikulové vlákna. Tvorí ho husté
špongiové retikulum. v ňom sú rôzne bunky. Retikulum sa nachádza v červenej pulpe a v zona
marginalis. Bunky perikapilárových pošiev majú bledšiu cytoplazmu, oválne jadrá a jemný roztrúsený
chromatín bez jadierok. Cytoplazma má veľa hladkého endoplazmového retikula, mitochondrie,
lyzozómy. Tvorí tenké interdigitujúce výbežky. Spomínané bunky nereagujú s protilátkami proti
lyzozýmu, poskytujú však silne pozitívnu reakciu pri dôkaze nešpecifickej esterázy v periférii pošvy,
reduktázy NADH-tetrazólia a ATP-ázy. Tým pripomínajú makrofágy. Blue a Weiss (1981) ich za
makrofágy považujú. Podľa Fujitu (1985) možno rozlíšiť lievikový, ampulový, aj komplexný typ
ukončenia artérií. Otvormi v zakončeniach artériových kapilár sa krv dostáva extravaskulárne, mimo
lúmenu kapilár, do priestorov zona marginalis a červenej pulpy. Takéto usporiadanie cievneho
systému označujú ako „otvorený typ mikrocirkulácie“. Ak krv prechádza kontinuálne z artériovovej
časti do vénovej časti, hovoríme o „uzavretom type mikrocirkulácie“. Brozman et al. (1983)
znázorňujú imunohistochemicky štruktúry, patriace do mikrocirkulácie. Artériový a vénový systém je
typický súvislou membrana basalis. Menej nápadná je prerušovaná stena vénových sínusov.
Imunohistochemicky opisujú vláknové a lamelové štruktúry vôkol a. centralis v periartériových
lymfalických pošvách. V červenej pulpe opisujú špongiové artériové terminály. Môže ísť o
morfologické štruktúry. Nimi sa krv vylieva do povrazcov medzi systémom artérií a vén. Občas
naliehajú na stenu sínusov, reagujú s protilátkami proti membrana basalis, a majú veľkú aktivitu
alkalickej fosfatázy.
20
Viacerí považujú krvný obeh v slezine za otvorený (Brozman et al., 1983; Brozman
a Jakubovský, 1988; Goresky a Groom, 1984) Podľa teórie „otvorenej cirkulácie“ sa teda krv dostáva
voľne do Billrothových povrazcov červenej pulpy tvorených retikulovou strómou. V nej je veľa
makrofágov. Odtiaľ sa musí cez špeciálne štruktúry stien sínusov dostať do lúmenu sínusov a z nich
pokračovať uzavretým systémom vén. Povrazce červenej pulpy tvorí trojrozmerná sieť
fibroblastových retikulových buniek (FbRB). Ležia medzi rozvetvenými sínusmi. Polák et al. (2007)
ich opisujú ako bunky s dlhými výbežkami cytoplazmy, pripomínajúcimi „krídla“. Nimi vzájomne
anastomozujú. Za žiadnych okolností sa nemenia na fixné makrofágy. Nezapájajú sa do fagocytózy.
Polák (2005) o FbRB píše, že ich cytoplazma obkolesuje retikulové vlákna temer vždy zo všetkých
strán, čo však vo svetelnom mikroskope nemožno vždy postrehnúť. Trojrozmerná sieť rozdeľuje
povrazce na menšie, navzájom spojené dutiny. Ich výbežky lipnú tiež na vonkajšiu stenu sínusov, kde
ležia na membrana basalis, resp. na prstencových vláknach. Možno ich považovať v tomto prípade za
adventíciové bunky.
Okrem FbRB sú v povrazcoch červenej pulpy aj makrofágy a rôzne krvné bunky. Tieto
vlastnia viaceré antigénové determinanty. Podľa Wilkinsa a Wrighta (2000) bunky povrazcov červenej
pulpy exprimujú nasledujúce antigény: vretenové bunky (fibroblastové retikulové bunky) - α-SMA,
makrofágy - CD 68, erytrocyty –glykoforíny A a C, granulocyty a monocyty - CD 15, kalprotektín,
megakaryocyty a krvné doštičky –CD 42b, CD 61 a plazmatické bunky - CD 138, p63, reťazce
imunoglobínov. Bunky vystieľajúce sínusy (BVS) majú na povrchu tieto antigény: von Willebrandov
antigén asociovaný s hemokoagulačným faktorom VIII, CD 31, VCAM-1, CD 106, CD 8. Antigén CD
8 je v BVS nezvyčajný tým, že ho zvyčajne exprimujú hT lymfocyty
Jakubovský et al. (1986) považujú krvný obeh ľudskej sleziny za otvorený a venujú pozornosť
začiatočným úsekom systému vén. Sínusy opisujú elektrónovým mikroskopom aj histochemicky. BVS
opisujú ako bunky tyčinkové, paralelne orientované s pozdĺžnou osou sínusu. Bunky medzi sebou
navzájom spájajú krátke široké bočné výbežky. Medzi nimi sú nepravidelné, vretenovité otvory.
Povrch buniek, nasadajúcich na membrana basalis kopíruje jej povrch. Pri membrana basalis
obsahujú zahustenia jemných vlákienok priemeru 3-5 nm. Membrana basalis tvorí prstence.
V histologickom reze ich vidno ako prerušované hrubé homogénne trámce strednej až malej denzity,
medzi ktorými sú rôzne veľké otvory.
Weiss (1995) patrí k zástancom teórie otvorenej cirkulácie. Podľa jeho názoru, vénové sínusy
vychádzajú z filtrujúcich miest červenej pulpy a zona marginalis ako anastomozujúce, slepo sa
začínajúce cievy, bez kontinuity artériového a vénového systému. Krv priteká do sínusov cez štrbiny
medzi bunkami vystieľajúcimi sínusy a prstencovými vláknami. Uvažuje aj o existencii kanálov
„spájajúcich“ artériové terminály s otvormi vo vénových sínusoch. Predpokladá, že by mohli priblížiť
artériový a vénový koniec riečiska.
Belko et al. (1992) opisujú uzavretý systém v minoritnom podiele. Zisťujú to dôkazom
aktivity dipeptidylpeptidázy IV v BVS.
Kashimura a Shibata (1989) opisujú aj tretí typ cirkulácie - mikrocirkuláciu v bielej pulpe a v
zona marginalis. Tá má napomáhať pri fagocytovaní cudzorodých častíc z krvi a styku lymfocytov
bielej pulpy s antigénmi.
O ďalšej možnej cirkulácii hovorí van Krieken (2007). Predpokladá, že 10% krvi prechádza
cez priestory perifolikulovej zóny. Definuje ju ako špecializovaný kompartment s vlastnou retikulovou
strómou v okolí zona marginalis. Svojím zložením sa odlišuje od zbytku červenej pulpy.
Perifolikulová zóna zaberá 8% sleziny a obsahuje erytrocyty, rôzne granulocyty aj agranulocyty
v zložení podobnom periférnej krvi. Perifolikulovú zónu Wilkins a Wright (2000) definujú ako
priestor medzi bielou a červenou pulpou. Tu sa zdržiavajú lymfocyty pred vstupom do bielej pulpy.
Obsahuje aj retikulovú sieť obsahujúcu α-SMA a neutrofilné granulocyty.
Mikrocirkulácii sleziny sa z funkčného hľadiska venujú Goresky a Groom (1984). Ľudskú
slezinu zaraďujú medzi tzv. sínusový typ sleziny (podobne je to v psovi, potkanpvi, zajacovi, či v
morčati). Goresky a Groom (1984) a Groom et al. (1991) sa tiež zaoberajú hypotézou o poškodzovaní
erytrocytov v nehostinnom prostredí červenej pulpy (nízke pH, nízky parciálny tlak kyslíka, nízka
hladina glukózy). Túto hypotézu nepotvrdili. Podľa nich sa za fyziologických podmienok v normálnej
slezine erytrocyty nepoškodzujú, slezina nie je nehostinné prostredie, iba ak za patologických
podmienok.
Morfológiu mikrocirkulácie ľudskej sleziny opisuje Holibková a Machálek (2000) v
korozívnych metakrylátových preparátoch v rastrovacom elektrónovom mikroskope. Okrem iného
opisujú anastomózy medzi artériovým a vénovým systémom (arterio-arteriové, arterio-vénové a véno-
21
vénové). K lymfovému systému sa vyjadruje aj Polák (2005). Nachádza tiež podobné jemné priestory
už v oblasti PALP či folikulov ako Holíbková a Machálek (2000), ktoré vytvárajú plexy okolo
trabekulových artérií. Chlopne však objavuje až na vasa efferentia po výstupe lymfových ciev zo
sleziny do hilového spojivového tkaniva.
Závery
Mikrocirkulácia v slezine je komplikovaná. Názory autorov na ňu sa rôznia. Nedá sa
jednoznačne a presne určiť, ktorý typ mikrocirkulácie zastáva aký percentuálny podiel. Možno však
podľa tvrdení spomínaných autorov konštatovať, že v ľudskej slezine dominuje otvorený typ
cirkulácie. Je však predmetom ďalších výskumov potvrdiť dohady o možnom treťom type cirkulácie
a podrobne mofologicky popísať celú mikrocirkuláciu v slezine.
Poďakovanie
Poďakovanie patrí doc. MUDr. Štefanovi Polákovi, PhD. a prof. MUDr. Jánovi Jakubovskému,
DrSc. za ich cenné rady a podporu pri práci.
Použitá literatúra
1. Belko, I., et al: Slezina. Osveta, Martin. 1992, 247.
2. Bíró, Cs., Jakubovský, J., Michalka, P., Polák, Š., Guller, L., Beruška, J., Durdík Š.: Morfológia hilusu
ľudskej sleziny s ohľadom na lymfatické cievy. Bratislava Med J. 2008 (v tlači).
3. Brozman, M., Chorváth, D., Jakubovský, J., Ružičková, M., Sirníková, E: Imunohistologická štúdia krvného
obehu v slezine človeka. Bratisl lek Listy. 79(6): 640–649, 1983.
4. Brozman, M., Jakubovský, J.: Slezina, Štruktúrne základy funkcie. VEDA vydavateľstvo SAV, Bratislava.
242, 1988.
5. Fujita, T., Kashimura, M., Adachi, K.: Scanning electron microscopy and terminal circulation. Experimentia.
41(2): 167–179, 1985.
6. Groom, A.C., Schmidt, E.E., MacDonald, I.C.: Microcirculatory pathways and blood flow in spleen: New
insights from washout kinetics, corrosion casts, and quantitative intravital videomicroscopy. Scanning Microsc.
5(1): 159–174, 1991.
7. Goresky, C.A, Groom, A.C.: Microcirculatory events in the liver and spleen. In: Renkin, E.M., Michel, C.
(eds.): The microcirculation, handbook of physiology, sec 2, Cardiovascular system IV, Chapter 15, Bethesda,
Md, American Physiologycal Society. 741–780, 1984.
8. Holíbková, A., Machálek, L.: Structure and microcirculation in human spleen demonstrated by SEM. Plzeň
lék Sborn Suppl. 74: 77–86, 2000.
9. Jakubovský, J., Polák, Š., Durdík, Š., Biró, Cs.: Krvná cirkulácia v ľudskej slezine. Všeobecná angiológia. 1,
2001.
10. Jakubovský, J., Brozman, M., Polák, Š., Babál, P.: Elektrónovomikroskopický obraz vénových sínusov
červenej pulpy ľudskej sleziny. Bratisl lek listy. 86(5): 477–490, 1986.
11. Kashimura, M., Shibata, A.: Structure and functions of the human spleen: relationship between
microcirculation and splenic functions. Rinsho Ketsueki. 30(8): 1234–8, 1989.
12. Polák, Š., Varga, I.: Funkčná morfológia ľudskej sleziny vo vzťahu k mikrocirkulácii krvi - literárny prehľad
doplnený vlastnými mikrofotografiami. Slov Antropol. 9(2): 59–66, 2006.
13. Polák, Š.: Normálna ľudská slezina, Nový pohľad na starý problém. Habilitačná dizertácia, Lekárska fakulta
Univerzity Komenského, Bratislava. 2005.
14. Polák, Š., Varga, I., Danišovič, Ľ., Kopáni, M., Mištinová, J.: Ultraštruktúra a funkcia sleziny vo vzťahu
k Billrothovým povrazcom červenej pulpy. In: Zborník referátov Morfológia včera, dnes a zajtra. Košice. 157–
161, 2007.
15. van Krieken, J.H.J.M., Orazi, A.: Spleen in Histology for pathologists, Chapter 32. Williams & Wilkins,
Philadelphia, USA., 783–797, 2007.
16. Weiss, L.: The structure of the spleen in Williams Hematology (fifth edition), Part II General Hematology,
Chapter 5, New York. 38–42, 1995.
17. Wilkins, B.S., Wright, D.H.: Normal structure, developement and functions of the spleen in Illustrates
pathology of the spleen, Chapter 2, Cambridge Universtity press, Cambridge. 13–34, 2000.
22
Štúdium regulácie bunkového cyklu u fotoautotrofných mikroorganizmov
Alena Hercegová, Eliška Gálová, Andrea Ševčovičová
Univerzita Komenského v Bratislave, Prírodovedecká fakulta, Katedra genetiky, Bratislava, Slovenská
Republika, [email protected]
Abstrakt
DNA predstavuje dynamickú štruktúru, neustále vystavenú rôznym endogénnym
a exogénnym vplyvom. Poškodenie DNA môže mať mutagénny a/alebo toxický
efekt interferujúci so základnými bunkovými procesmi. Počas evolúcie sa vyvinuli a postupne
zdokonaľovali rôzne obranné stratégie, umožňujúce bunke prežiť a zachovať si plnohodnotnú
genetickú informáciu. Jednotlivé reparačné mechanizmy sa študovali najprv oddelene.
V súčasnosti je známe, že mnohé gény zahrnuté v oprave DNA majú pleiotropný účinok. To
znamená, že nie sú zodpovedné len za procesy vedúce k oprave poškodenej DNA, ale
podieľajú sa tiežna replikácii, transkripcii, metabolických dráhach, aj na aktivácii kontrolných
bodov. Práve v nich dochádza k prepojeniu regulácie bunkového cyklu a reparačných
mechanizmov. Kontrolné body po narušení integrity genómu indukujú dočasné zastavenie
bunkového cyklu a aktiváciu opravného mechanizmu, adekvátneho príslušnému poškodeniu
a fáze bunkového cyklu, v ktorej poškodenie DNA nastalo. Na štúdium bunkového cyklu sa
využívajú mikroorganizmy, najmä kvasinky a v poslednom čase aj riasy. Prvým
identifikovaným mutantom v kontrolnom bode u rias bol mutant uvs11 riasy Chlamydomonas
reinhardtii.
Úvod
Pre život bunky a prežitie organizmov je nevyhnutná presná duplikácia genómu a jeho
následné bezchybné rozdelenie do nasledujúcej generácie. Kvôli zaisteniu týchto esenciálnych
procesov odpovedajú bunky na poškodenie alebo abnormálnu štruktúru DNA komplexnou
odpoveďou, v rámci ktorej dochádza ku koordinácii bunkového cyklu s opravou DNA, remodelingom
chromatínu, transkripciou a inými metabolickými zmenami, prípadne s bunkovou smrťou. Zastavenie
alebo zadržanie bunkového cyklu poskytuje čas pre reparáciu DNA a je sprostredkované sieťou
signálnych dráh označených ako kontrolné body bunkového cyklu („checkpoint control“ alebo
„restriction point“). Ak je DNA poškodenie neopraviteľné, kontrolné body eliminujú takéto
potenciálne nebezpečné bunky trvalým zablokovaním bunkového cyklu alebo smrťou bunky (LindseyBoltz a kol., 2001).
Kontrolné body bunkového cyklu plnia najmenej štyri úlohy: indukujú zablokovanie
bunkového cyklu, pomáhajú aktivovať reparáciu DNA, udržiavajú zastavený bunkový cyklus, pokým
nie je oprava kompletná a potom aktívne reiniciujú priebeh bunkového cyklu (Bartek a Lukas, 2001).
Kontrolné body predstavujú biochemické kaskády zahŕňajúce senzorové proteíny, ktoré monitorujú
genóm a zachytávajú rôzne abnormality. Súčasne pomáhajú tvoriť signál, ktorý je amplifikovaný
a šírený adaptormi/mediátormi a transduktormi signálu k efektorom, ktoré prepájajú kontrolné body
s jadrom aparátu bunkového cyklu.
Na počiatku výskumu regulácie bunkového cyklu stál mutant rad9 kvasinky Saccharomyces
cerevisiae, ktorá predstavuje základný modelový objekt heterotrofných organizmov. Bunky rad9
mutantného kmeňa, na rozdiel od buniek štandardného typu, nezastavujú bunkový cyklus v G2 fáze po
poškodení DNA spôsobenom ionizačným žiarením, ale delia sa ešte jeden alebo viackrát. V dôsledku
opakovanej mitózy vytvárajú mikrokolónie 3 až 8 odumretých buniek (Hartwell a Weinert, 1989).
Prežívanie mutantov po ožiarení sa zvyšuje po umelom zablokovaní bunkového cyklu v G2 fáze. Tieto
experimenty viedli k identifikácii funkcie génu RAD9 ako negatívneho regulátora bunkového cyklu po
poškodení DNA a tiež jeho úlohy v prepojení reparácie DNA, transkripcie, replikácie a kontrolných
bodov bunkového cyklu. O dôležitosti štúdia priebehu bunkového cyklu a jeho regulácie svedčí
udelenie Nobelovej ceny za fyziológiu a medicínu v roku 2001 trom vedcom zaoberajúcim sa touto
problematikou (Timothy Hunt, Leland Hartwell a Paul Nurse).
Podobný fenotypový prejav ako rad9 mal aj mutant uvs11 riasy C. reinhardtii, ktorý bol
izolovaný na Katedre genetiky PriF UK v Bratislave (Vlček a kol., 1987). Výsledky nedávnych štúdií
23
potvrdili úlohu génu UVS11 riasy C. reinhardtii v prepojení medzi poškodením DNA a reguláciou
bunkového cyklu, podobne ako génu RAD9 kvasinky S. cerevisiae. Kmeň uvs11 tak predstavuje
prvého charakterizovaného mutanta kontrolných mechanizmov u rias (Slaninová a kol., 2002; 2003).
U vyšších rastlín bol ako prvý mutant kontrolného bodu identifikovaný kmeň sog1 u Arabidopsis
(Preuss a Britt, 2003). Tieto pozorovania naznačili prítomnosť signálnych transdukčných dráh
u fotoautotrofov, analogických s heterotrofnými organizmami.
Súčasná úroveň vedomostí o regulácii bunkového cyklu a funkcii reparačných procesov
u fotoautotrofných organizmov je veľmi nízka. Výhodným modelovým objektom je v tomto prípade
jednobunková zelená riasa C. reinhardtii. Je to jednobunkový organizmus, ktorý sa dá jednoducho
kultivovať v laboratórnych podmienkach, je vhodný pre klasickú genetickú analýzu (tetrádová analýza
bola prvýkrát demonštrovaná na C. reinhardtii), môže existovať v haploidnej aj v diploidnej forme a je
ľahko prístupný pre jadrovú i chloroplastovú transformáciu. Využíva sa pri štúdiu rôznych
biologických procesov ako je fotosyntéza, biogenéza chloroplastov, asemblácia bičíka a pohyblivosť,
fototaxia, cirkadiánny rytmus, gametogenéza a párovanie, bunkový metabolizmus a regulácia
bunkového cyklu.
Keďže predpokladom štúdia jednotlivých komponentov signálnych dráh je identifikácia
ďalších mutantov, zamerali sme sa na analýzu uvsX1 a uvsX2 kmeňov C. reinhardtii, pripomínajúcich
fenotypovo uvs11. Sledovali sme:
- prežívanie mutantov po pôsobení fyzikálnych a chemických agensov (UV, γ žiarenie a MMS) a
odumieranie buniek pred a po delení;
- vplyv mikrotubulového inhibítora MBC na zmenu kriviek prežívania a tvorbu mikrokolónií po
pôsobení UV, γ žiarenia a MMS u mutantov;
- excíziu pyrimidínových dimérov.
Materiál a metódy
V experimentoch sme pracovali s kmeňmi W1, uvsX1 a uvsX2.
Fenotypovú charakteristiku mutantných kmeňov sme robili hodnotením kriviek prežívania
po ovplyvnení UV, γ žiarením a alkylačným agensom MMS (metylmetánsulfonát). Prežívanie buniek
sme hodnotili mikroskopicky. Osobitne sme hodnotili odumieranie buniek pred a po rozdelení. Pri
každom pokuse a každom variante sme hodnotili aspoň dve Petriho misky, na každej minimálne 250
kolónií.
Zastavenie bunkového cyklu C. reinhardtii pomocou MBC – v experimentoch sme pracovali
s mikrotubulovým inhibítorom metylbenzimidazol-2-ylkarbamátom (MBC, zásobný roztok pre riasy
30 mg v 1 ml DMSO). Mechanizmus jeho účinku spočíva v reverzibilnej destabilizácii tubulínových
štruktúr, ktoré tvoria súčasť mitotického aparátu, čím zabraňuje vstupu do mitózy a deleniu bunky.
MBC sme nechali pôsobiť v polovici kultúry asi 12 až 14 hodín pred samotným ovplyvňovaním
mutagénmi, pričom výsledná koncentrácia MBC v médiu bola 300 mg/ml. MBC zastavuje bunkový
cyklus pred mitózou.
Ovplyvnenie buniek C. reinhardtii mutagénmi – pri sledovaní vplyvu UV žiarenia sme
pripravenú kultúru rozdelili do 4 umelohmotných Petriho misiek po 3 ml a ovplyvňovali UV 254 nm
dávkami 50, 100 a 150 J.m-2. Po ožiarení sme nechali bunky inkubovať 1 hodinu s MBC v tme, aby
sme zabránili fotoreaktivácii.
Pri sledovaní vplyvu MMS sme pripravenú kultúru rozdelili do 4 skúmaviek po 2 ml
a pridávali sme MMS (10% zásobný roztok) do výslednej koncentrácie 0,1; 0,2 a 0,3%. Kultúry sme
ovplyvňovali 1 hodinu v tme na trepačke. Po ukončení ovplyvňovania sme kultúru scentrifugovali
a premytím zbavili zvyškov mutagénu.
Pri sledovaní vplyvu γ žiarenia sme pôsobili na bunky rozsuspendované v 3 ml sterilnej vody
v umelohmotných skúmavkách dávkami 50, 100 a 200 Gy. Po ožiarení sme nechali bunky 1 hodinu
pod vplyvom MBC.
Po ukončení ovplyvňovania sme bunky scentrifugovali, premyli v destilovanej vode, aby sme
odstránili MBC, nariedili na potrebnú hustotu a vysievali na pevné HSA médium. Petriho misky sme
kultivovali na svetelnej polici 5 až 7 dní (stanovenie prežívania), resp. 21 dní (určenie mutability).
Detekcia pyrimidínových dimérov pomocou protilátok – rozrastené bunky C. reinhardtii
v tekutom médiu sme ovplyvnili UV žiarením 254 nm dávkou 100 J.m-2 s výnimkou kontroly. V čase
ožiarenia sme odobrali 5 ml prvej vzorky (0. hodina). Ožiarené kultúry sme nechali v tme, ďalší odber
sme uskutočnili v 24. hodine od ovplyvnenia. Z ožiarených buniek sme extrahovali DNA pomocou
zmesi fenol:chloroform:izoamylalkohol. RNA sme odstránili inkubáciou vzoriek s RNázou.
24
Koncentráciu DNA sme zmerali na spektrofotometri. Príslušné koncentrácie DNA sme potom nanášali
na nylonovú membránu. Po premytí membrány v neutralizačnom roztoku sme ju na
2 hodiny vystavili teplote 80 °C. Membránu s naviazanou DNA sme inkubovali s primárnou
monoklonálnou protilátkou (riedenie 1:2500) ab10347 (Abcam) viažúcou sa špecificky na
pyrimidínové diméry cyklobutánového typu. Sekundárnu protilátku ab6728 (Abcam) konjugovanú
s peroxidázou sme riedili v pomere 1:4000. Na vizualizáciu naviazanej protilátky sme použili
chemiluminiscenciu.
Výsledky a diskusia
Prežívanie mutantných kmeňov závislé od dávky použitého mutagénneho agensu a porovnanie
kriviek prežívania s prežívaním štandardného kmeňa poskytuje základnú charakteristiku testovaných
kmeňov. Prežívanie buniek závisí od miery ich citlivosti k danému agensu a percento prežívania sa
stanovuje mikroskopickým hodnotením na základe počtu vyrastených kolónií z celkového počtu
hodnotených buniek. Výsledky účinku UV, γ žiarenia a MMS sme zostavili z priemerných hodnôt
viacerých pokusov, prepočítaných na 100% kontrolu. Paralelne s prežívaním sme samostatne hodnotili
bunky odumreté pred a po delení. Pri všetkých variantoch sme súčasne sledovali vplyv zastavenia
bunkového cyklu pomocou mikrotubulového jedu MBC na prežívanie buniek a ich odumieranie po
jednom alebo viacerých deleniach. MBC imituje kontrolný bod G2 fázy bunkového cyklu, v ktorom
dochádza k zablokovaniu priebehu bunkového cyklu po poškodení DNA spôsobenom mutagénnymi
agensami. Zastavením bunkového cyklu získava bunka čas na opravu poškodenia DNA. Aplikácia
MBC vedie preto k zvýšeniu prežívania mutantov s poruchou v regulácii bunkového cyklu. V prípade
mutantov s poruchou konkrétnej reparačnej dráhy a štandardného kmeňa zastavenie bunkového cyklu
prostredníctvom MBC nemá výrazný vplyv na zmenu prežívania.
Na základe mikroskopického hodnotenia prežívania sme zaznamenali vysokú citlivosť
mutantov uvsX1, uvsX2 na pôsobenie nielen UV žiarenia, ale aj γ žiarenia a MMS. Zablokovanie
bunkového cyklu pomocou MBC viedlo k zvýšeniu prežívania až pri najvyšších dávkach použitých
mutagénov. Pri sledovaní priamych mutácií vedúcich k rezistencii na streptomycín sme u mutanta
uvsX1 zaznamenali výrazne zvýšenú spontánnu aj indukovanú mutabilitu po pôsobení UV žiarenia aj
MMS. Zastavenie bunkového cyklu pomocou MBC nemalo badateľný vplyv na zmenu počtu
mutantov. Zvýšená indukovaná mutabilita, ale v menšej miere ako pri uvsX1, bola pozorovaná
u mutanta uvs11 (Vlček a kol., 1987). Spontánna aj indukovaná mutabilita je zvýšená pri kmeni uvs14,
ktorý má funkčný mechanizmus vyštiepovania pyrimidínových dimérov a nesie typické znaky
mutantov s narušenou „long patch mismatch“ korekciou (Modrich, 1991; Vlček a kol., 1997).
U mutanta uvsX2 sme zaznamenali zvýšenú spontánnu a indukovanú mutabilitu po pôsobení UV
žiarenia, ale v menšej miere ako pri uvsX1. V prípade MMS bola mutabilita porovnateľná so
štandardným kmeňom.
Mikroskopický obraz hynutia buniek pred (vo forme jednej bunky) a po (vo forme
mikrokolónií) delení vyjadruje schopnosť buniek vysporiadať sa s poškodením DNA po pôsobení
mutagénnej látky. Zároveň umožňuje rozlíšiť príčiny odumierania buniek. Reparačne deficitné kmene
odumierajú vo zvýšenej miere vo forme jednej bunky, v dôsledku neschopnosti opraviť poškodenie
DNA indukované mutagénom. Mutanty v kontrolnom bode bunkového cyklu nie sú schopné zastaviť
priebeh cyklu v G2 fáze po poškodení DNA a delia sa najmenej jedenkrát. V dôsledku opakovanej
mitózy vytvárajú mikrokolónie 3 až 8 odumretých buniek.
Zvýšenú tvorbu mikrokolónií sme pozorovali u obidvoch mutantných kmeňov po použití
všetkých troch mutagénov. Zastúpenie mikrokolónií sa výrazne nezmenilo ani po zablokovaní
bunkového cyklu. To naznačuje, že chemická látka akou je MBC, ktorá len inhibuje tvorbu
mitotického aparátu, nemôže úplne nahradiť funkciu príslušných defektných proteínov.
Vysoká citlivosť kmeňov uvsX1, uvsX2 na UV žiarenie by mohla byť dôsledkom poruchy
excíznej reparačnej dráhy. Na overenie tohto predpokladu sme využili metódu detekcie
pyrimidínových dimérov pomocou protilátok. Vychádzali sme z prác Cenkci a kol. (2003) a Wei a kol.
(2004). Funkčnosť resp. porucha excíznej reparačnej dráhy je detekovaná na základe neprítomnosti
resp. prítomnosti pyrimidínových dimérov po 24 hodinách inkubácie buniek ovplyvnených UV
žiarením v tme, vizualizovaných pomocou väzby primárnej a sekundárnej protilátky. Pri analýze
funkčnosti vyštiepovania pyrimidínových dimérov pomocou protilátok sme u štandardného kmeňa W1
zachytili prítomnosť dimérov indukovaných UV žiarením hneď po ovplyvnení. Po 24 hodinách sme
už ich prítomnosť nedetekovali, čo znamená, že došlo k ich oprave. Pri obidvoch testovaných
mutantných kmeňoch sme po 24 hodinách zachytili signál odpovedajúci prítomnosti pyrimidínových
25
dimérov a naznačujúci neschopnosť odstrániť diméry excíznou reparačnou dráhou pri zabránenej
fotoreaktivácii.
Závery
Z výsledkov našich experimentov usudzujeme, že riasa C. reinhardtii disponuje určitým
typom kontrolného mechanizmu, ktorý umožňuje zablokovanie bunkového cyklu po pôsobení určitého
agensu.
Poďakovanie
Táto práca bola realizovaná s podporou grantov APVT-20-002604, VEGA 1/3243/06, VEGA
1/2337/05 a SK-CZ-06906.
Použitá literatúra
1. Bartek, J., Lukas, J.: Mammalian G1- and S-phase checkpoints in response to DNA damage. Curr Opin Cell
Biol. 13: 738–747, 2001.
2. Cenkci, B., Petersen, J.L., Small, G.D.: REX1, a novel gene required for DNA repair. J Biol Chem. 278(25):
22574–22577, 2003.
3. Hartwell, L.H., Weinert, T.A.: Checkpoint controls that ensure the order of cell cycle events. Science. 246:
629–634, 1989.
4. Lindsey-Boltz, L.A., Bermudes, V.P., Hurwitz, J., Sancar, A.: Purification and characterization of human
DNA damage checkpoint Rad complexes. Proc Natl Acad Sci USA. 98: 11236–11241, 2001.
5. Modrich, P.: Mechanisms and biological effects of mismatch repair. Ann Rev Genet. 25: 229–253, 1991.
6. Preuss, S.B., Britt, A.B.: A DNA-damage-induced cell cycle checkpoint in Arabidopsis. Genetics. 164: 323–
334, 2003.
7. Slaninová, M., Nagyová, B., Gálová, E., Hendrychová, J., Bišová, K., Zachleder, V., Vlček, D.: The alga
Chlamydomonas reinhardtii UVS11 gene is responsible for cell division delay and temporal decrease in
histone H1 kinase aktivity caused by UV irradiation. Mutat Res DNA Repair. 2(6): 737–750, 2003.
8. Slaninová, M., Ševčovičová, A., Nagyová, B., Miadoková, E., Vlčková, V., Vlček, D.: Chlamydomonas
reinhardtii UVS11 gene is required for cell cycle arrest in response to DNA damage. Archiv fur Hydrologie,
Algological Studies. 107: 97–107, 2002.
9. Small, G.D., Greimann, C.S.: Photoreaktivation and dark repair of ultraviolet light-induced pyrimidine dimers
in chloroplast DNA. Nucl Acid Res. 4: 2893–2902, 1997.
10. Vlček, D., Miadoková, E., Podstavková, S., Adams, G.M.W., Small, G. D.: General charakteristics,
molecular and genetic analysis of two new UV-sensitive mutants of Chlamydomonas reinhardtii. Mutat Res.
183: 169–175, 1987.
11. Vlček, D., Slivková, A., Podstavková, S., Miadoková, E.: A Chlamydomonas reinhardtii UV-sensitive
mutant uvs15 is impaired in a gene involved in several repair pathways. Mutat Res. 385: 243–249, 1997.
12. Wei, S.F., Hwang, S.P.L., Chang, J.: Influence of ultraviolet radiation on the expression of proliferating cell
nuclear antigen and DNA polymerase α in Skeletonema costatum (Bacillariophyceae). J Phycol. 40: 655–663,
2004.
26
Changes in endothelial and inducible NO synthase in aortic media after administration
of red wine polyphenols
Lívia Hlavačková1, Pavol Janega1,3, Silvia Líšková2, Pavel Babál1
1
Department of Pathology; 2Department of Pharmacology, Faculty of Medicine, Comenius University in
Bratislava, Slovakia and 3Institute of Normal and Pathological Physiology, Slovak Academy of Sciences,
Bratislava, Slovakia, [email protected]
Abstract
Inducible NO synthase (iNOS) can be influenced by various stimuli in several cell
types including vascular smooth muscle cells, while endothelial NO synthase (eNOS) is
basally expressed in endothelial cells. Red wine polyphenols are known to affect activity of
these enzymes in endothelial and various cancer cells. Aim of this study was to determine the
effect of carbon tetrachloride and the polyphenols on eNOS and iNOS expression in the wall
of the aorta of male Wistar rats. No significant changes were observed in the amount of eNOS
protein immunoreactivity in the aortic media. Chronic administration of CCl4 with or without
parallel administration of polyphenols for 12 weeks resulted in a significant increase of iNOS
expression in the media. 3 weeks of spontaneous recovery lead to further increase of iNOS.
Polyphenols administration during the recovery period partly decreased the iNOS expression
but did not reach the control level. It can be concluded, that CCl4 and red wine polyphenols
have no significant effect on eNOS in the aortic media. CCl4 causes an increase of iNOS
expression in the wall of aorta, which is not prevented by red wine polyphenols. Changes of
iNOS expression may influence functional and morphological changes of the aorta.
Key words: red wine, polyphenols, carbon tetrachloride, endothelial NO synthase, inducible
NO synthase, aortic media
Introduction
Endothelial NOS (eNOS) is basally expressed in endothelial cells, and its resting activity
accounts for the continuous low-level production of NO that participates in the maintenance of the
basal vascular tone (Huang et al. 1995). Various stimuli, like proinflammatory cytokines and
endotoxins, are able to induce expression of inducible NO synthase (iNOS) in several cell types
including vascular smooth muscle cells (Geng et al. 1992).
Red wine polyphenols are able to induce eNOS transcription after short-term administration
and thus to increase endothelial NO synthase protein levels in cultivated endothelial cells (Leikert et
al. 1992). On the other hand, polyphenolic extracts from red wine suppress the expression of inducible
NO synthase and COX-2 in colon tumors induced by azoxymethane (Luceri et al. 2002). Red wine
polyphenols also reduced the activity of inducible NO synthase in three different human prostate
cancer cell lines along with the NO production (Kampa et al. 2000).
Carbon tetrachloride (CCl4) is a toxic substance from which the trichlormethyl radical is
formed by P-450 (International Programme on Chemical Safety 1999). Recently, it has been applied as
a model of oxidative damage to vascular endothelium (Babál et al. 2006).
The aim of this study was to determine the possible effect of carbon tetrachloride and red wine
polyphenols on eNOS and iNOS expression in media of the aorta.
Materials and methods
Male Wistar rats, 3 months old, were divided into six groups, 8 animals in each. The
preventive experiment lasting for 12 weeks consisted of four groups: the control group, the group
receiving CCl4 0.5 ml/kg of body weight twice a week subcutaneously in a 1:1 solution with olive oil,
the group receiving dried red wine extract Provinols™ (30 mg/kg/day) in drinking water and the group
receiving Provinols™ + CCl4. In the recovery experiment, the initial 12 weeks of CCl4 treatment were
followed by 4 weeks of spontaneous recovery in the first, and recovery with Provinols™
administration in the second group of animals. To make sure that each animal received the complete
dose of Provinols™, calculated amount of Provinols™ was given to each rat in the appropriate volume
of water. Provinols™ polyphenols content has already been reported (Diebolt et al. 2001).
27
The thoracic aortas were fixed 24 hours in 10 % formalin, routinely processed in paraffin.
Deparaffinized and rehydrated 5 µm thick slices cut perpendicularly to the vessel axis were
rinsed twice in PBS (pH 7.2). Sections were thereafter incubated with primary monoclonal mouse antieNOS antibodies diluted 1:200 or primary monoclonal mouse anti-iNOS antibodies (Santa Cruz
Laboratories, San Francisco, CA) diluted 1:100 in PBS for 1 hour at room temperature. Binding was
visualized with EnVision detection system (DAKO, Carpinteria, CA) using 3',3'-diaminobenzidine as
chromogen. The slides were briefly counterstained in hematoxylin, air-dried and mounted in plastic
resin.
The findings were documented with a digital photographic camera GC-X3E (JVC, Japan) and
evaluated with ImageJ software (National Institute of Health, Bethesda, USA). Threshold value was
determined (from 20 to 160) for positive reaction of anti-eNOS and anti-iNOS antibodies. The
numbers of pixels of each color were counted and the percentage of the whole area of the media was
calculated. The results were statistically analyzed by unpaired Student’s t-test.
Results and discussion
We observed no significant differences in the proportional area of anti-eNOS antibody
reactivity in the aortic media among the experimental groups. It is generally accepted that the eNOS is
produced predominantly by endothelial cells (Huang et al. 1995). Since the aortic intima was not
included in our evaluation, the observation of no significant changes of eNOS expression in the aortic
media is compliant with the current findings. The average proportional reaction of anti-eNOS
antibodies in the media was about 17%, which may be caused at least in part by nonspecific binding of
the antibodies.
The proportional area with reactivity of the antibody against inducible NO synthase was not
significantly changed after administration of red wine polyphenols.
Administration of CCl4 significantly increased the expression of inducible NO synthase in
aortic media (p>0,05). Simultaneous administration of red wine polyphenols had no significant effect
on the iNOS protein expression when compared to the group with carbon tetrachloride only, remaining
significantly increased above the control (p>0,05).
Interestingly, three weeks of spontaneous recovery caused a further increase of iNOS
expression (fig. 1) when compared to the control (p>0,001) and to the group without recovery as well
(p>0,05). Red wine polyphenols administered during the recovery period caused only an insignificant
difference in this observation, iNOS stayed significantly increased (p>0,01) above control, but the
difference from the group with CCl4 was no longer statistically significant (fig. 2).
Fig. 1. Reactivity of anti-iNOS antibodies in the aortic media after CCl4 administration and three
weeks of spontaneous recovery; enlargement 400x.
28
Fig. 2. Expression of iNOS in the aortic media evaluated as the proportional area of anti-iNOS
antibody reactivity. C – CCl4, CP – CCl4 + polyphenols, CR – CCl4 + recovery, CRP – CCl4 +
recovery with polyphenols, K– control, P –polyphenols. Significance versus K: p> 0,05 *, p> 0,01 **,
p> 0,001 ***; versus C: p>0,05 +.
Inducible NOS can be produced by vascular smooth muscle cells (Geng et al. 1992) and its
production can be induced by various stimuli. It is possible, that damage caused by chronic
administration of carbon tetrachloride provoked the increase in production of iNOS in vascular smooth
muscle cells. This effect leads to an increased load of free radicals produced from higher production of
NO (Sun et al. 2005) and therefore enhances damage of aortic wall. On the other hand, positive effect
of NO on liver cells damaged by carbon tetrachloride was described (Muriel 1998) and should be
taken into account in blood vessels as well.
Conclusion
In conclusion, CCl4 as well as red wine polyphenols have no effect on eNOS expression in the
aortic media. CCl4 administration cause increase of iNOS in media and red wine polyphenols cannot
prevent nor repair this effect.
Acknowledgments
This work was in part supported by APVT grant N° 20-025204, 51-017905 and VEGA
1/4279/07.
References:
1. Babál, P., Kristová, V., Černá, A., Janega, P., Pecháňová, O., Danihel, L., Andriantsitohaina, R.: Red wine
polyphenols prevent endothelial damage induced by CCl4 administration. Physiol Res. 55(3): 245–51, 2006.
2. Carbon tetrachloride In: International Programme on Chemical Safety, Environmental Health Criteria (WHO),
no. 208 / WHO, Geneva (Switzerland); International Programme on Chemical Safety,Geneva
(Switzerland).http://www.inchem.org/documents/ehc/ehc/ehc208.htm#PartNumber:6 177p, 1999.
3. Diebolt, M., Bucher, B., Andriantsitohaina, R.: Wine polyphenols decrease blood pressure, improve NO
vasodilatation, and induce gene expression. Hypertension. 38(2): 159–65, 2001.
4. Geng, Y., Hansson, G.K., Holme, .E: Interferon-gamma and tumor necrosis factor synergize to induce nitric
oxide production and inhibit mitochondrial respiration in vascular smooth muscle cells. Circ Res. 71(5): 1268–
76, 1992.
5. Huang, P.L., Huang, Z., Mashimo, H., Bloch, K.D., Moskowitz, M.A., Bevan, J.A., Fishman, M.C.:
Hypertension in mice lacking the gene for endothelial nitric oxide synthase. Nature. 377(6546): 239–42, 1995.
29
6. Kampa, M., Hatzoglou, A., Notas, G., Damianaki, A., Bakogeorgou, E., Gemetzi, C., Kouroumalis, E.,
Martin, P.M., Castanas, E.: Wine antioxidant polyphenols inhibit the proliferation of human prostate cancer
cell lines. Nutr Cancer. 37(2): 223–33, 2000.
7. Leikert, J.F., Räthel, T.R., Wohlfart, P., Cheynier, V., Vollmar, A.M., Dirsch, V.M.: Red wine polyphenols
enhance endothelial nitric oxide synthase expression and subsequent nitric oxide release from endothelial
cells. Circulation. 106(13): 1614–7, 2002.
8. Luceri, C., Caderni, G., Sanna, A., Dolara, P.: Red wine and black tea polyphenols modulate the expression of
cycloxygenase-2, inducible nitric oxide synthase and glutathione-related enzymes in azoxymethane-induced
f344 rat colon tumors. J Nutr. 132(6): 1376–9, 2002.
9. Muriel, P.: Nitric oxide protection of rat liver from lipid peroxidation, collagen accumulation, and liver
damage induced by carbon tetrachloride. Biochem Pharmacol. 56(6): 773–9, 1998.
10. Sun, Y., Carretero, O.A., Xu, J., Rhaleb, N.E., Wang, F., Lin, C., Yang, J.J., Pagano, P.J., Yang, X.P.: Lack
of inducible NO synthase reduces oxidative stress and enhances cardiac response to isoproterenol in mice with
deoxycorticosterone acetate-salt hypertension. Hypertension. 46(6): 1355–61, 2005.
30
Chronická myeloická leukémia z pohľadu genetiky a molekulovej biológie
Ivana Hojsíková1, Gabriela Pavlíková1, Dalibor Hojsík2, Peter Križan1
1
Medirex, a.s., Oddelenie genetiky, Bratislava; 2Univerzita Komenského v Bratislave, Lekárska fakulta, Ústav
súdneho lekárstva, Bratislava, Slovenská Republika, [email protected]
Abstrakt
Chronická myeloická leukémia je myeloproliferatívne ochorenie. Je jedinečná
prítomnosťou markera Philadelphia, ktorý vzniká recipročnou výmenou častí chromatínu
z dlhého ramena chromozómu 9 a 22. Tým sa do tesnej blízkosti dostávajú gény BCR a ABL.
Ich fúziou vzniká produkt – onkogén BCR/ABL, ktorý dáva vznik onkoproteínu Bcr/Abl
zodpovednému za vznik ochorenia. Novovzniknutý proteín má oproti natívnemu proteínu Abl
zvýšenú tyrozínkinázovú aktivitu. Tá spôsobuje hromadenie leukemických buniek v krvnom
obraze pacienta. Okrem prítomnosti Ph markera je pre toto ochorenie charakteristický
trojfázový priebeh ochorenia (chronická a akcelerovaná fáza a blastový zvrat).
Neoddeliteľnou súčasťou diagnostiky ochorenia a monitorovania jeho liečby je v súčasnosti
molekulová analýza (RT PCR a RQ PCR) a komplexná cytogenetická analýza, ktorá zahŕňa
klasickú cytogenetickú analýzu a FISH (fluorescenčná in situ hybridizácia).
Úvod
Chronická myeloická leukémia je klonálne myeloproliferatívne ochorenie. Vzniká malígnou
transformáciou jedinej pluripotentnej hemopoetickej kmeňovej bunky. Táto klonálna transformácia
vedie ku neregulovanej proliferácii a akumulácii myeloických buniek v kostnej dreni a v krvi.
Predstavuje asi 15 – 25 % všetkých leukémií dospelých (D'Antonio et al., 2006). U detí a adolescentov
sa vyskytuje len zriedkavo. Incidencia ochorenia rastie s vekom, podľa klinických štúdií sa
najčastejšie vyskytuje v 4. až 5. dekáde života. Podľa epidemiologických štúdií však medián
dosahuje až 67 rokov. Až 76 % chorých na CML je starších ako 50 rokov. Diagnostika a liečba CML
prebieha na viacerých úrovniach a vyžaduje si spoluprácu odborníkov z viacerých medicínskych
i nemedicínskych odborov, a to najmä z oblasti hematológie, cytológie, histológie, imunológie a veľmi
dôležité miesto patrí genetike a molekulovej biológii. Hematológovia sa na cytogenetikov obracajú
nielen na začiatku ochorenia, teda pri diagnostike a stanovení prognózy, ale aj pri hodnotení odpovede
na liečbu a monitorovaní priebehu ochorenia.
CML z pohľadu genetiky
Chronická myeloická leukémia je unikátna spomedzi všetkých myeloproliferatívnych
ochorení, pretože jej charakteristickým znakom je prítomnosť chromozómu Philadelphia v populácii
leukemických buniek kostnej drene a periférnej krvi (KD a PK). Jedinečnosť ochorenia spočíva v tom,
že marker Philadelphia je jednak znakom, a zároveň aj príčinou ochorenia. Ph vzniká recipročnou
translokáciou distálnych častí dlhých ramien chromozómu 9 a 22 – t(9;22)(q34;q11). Miesto zlomu na
chromozóme 9 je v oblasti q34 a na chromozóme 22 v oblasti q11. Marker bol nazvaný podľa miesta
objavenia. Medzinárodný systém cytogenetického názvoslovia označuje tento abnormálny chromozóm
22 v tejto konkrétnej translokácii ako Ph (Hughes et al., 2006). Recipročnou fúziou vznikajú dva fúzne
produkty: na derivovanom ch. 9 vzniká gén 5´ABL/3´BCR s neznámou funkciou a na Ph sa vyskytuje
produkt fúzie onkogén 5´BCR/3´ABL, ktorý je príčinou ochorenia. Onkoproteín Bcr/Abl sa oproti
natívnemu proteínu Abl líši veľkosťou, výskytom a funkciou. Má zvýšenú tyrozínkinázovú aktivitu,
ktorá vedie ku zvýšeniu schopnosti proliferácie a zníženiu schopnosti diferenciácie a apoptózy buniek.
Marker Ph sa vyskytuje u 95 % pacientov s CML, pričom cca u 80 – 85 % pacientov je
prítomný vo svojej klasickej podobe a možno ho teda dokázať bežnými cytogenetickými metódami vo
všetkých vyšetrených mitotických (metafázových) figúrach z jadier buniek v KD a PK.
5 % chorých sú nositeľmi fúzneho génu BCR/ABL, no Ph chromozóm u nich nie je možné
dokázať cytogeneticky, ale len metódami FISH a molekulovej biológie. Vtedy hovoríme
o maskovanom variante translokácie (9;22), ktorý obsahuje submikroskopické translokácie klasickou
cytogenetikou neviditeľné. Ide o kryptickú inzerciu 3´ABL do chromozómu 22.
31
Okrem jednoduchej translokácie 9;22 môžu pri tomto ochorení vznikať aj jej varianty, kedy
sú do nej zahrnuté aspoň tri chromozómy, z ktorých dva sú vždy 9 a 22 s rovnakými bodmi zlomu ako
pri jednoduchej translokácii. Bod zlomu v treťom chromozóme môže varírovať. Vtedy hovoríme
o komplexnom variante translokácie. Tento model sa vyskytuje u 5 – 10 % prípadov.
5% prípadov je cytogeneticky aj metódami molekulovej biológie negatívnych a vtedy
hovoríme o tzv. atypickej CML. V týchto prípadoch je prognóza, priebeh ochorenia, ako aj odpoveď
na liečbu odlišná a podľa literatúry horšia (Sandberg, 1990; Mufti et al., 1996, Mayer et al., 2002).
Podľa niektorých autorov v tomto prípade nemožno toto ochorenie považovať za CML, ale za iné
malígne ochorenie krvi (www.infobiogen.com).
U asi 10 – 15 % pacientov, nositeľov Ph markera a asi 30 – 40 % pacientov s variantnou
formou translokácie bola pomocou metódy FISH detegovaná submikroskopická delécia derivovaného
chromozómu 9 – del (9q+). Táto delécia (bežnou mikroskopickou technikou nedetegovateľná) sa
pravdepodobne objaví súčasne s Ph translokáciou a môže zahŕňať stratu sekvencie z chromozómu 9,
22 alebo z oboch. Dĺžka deletovaných sekvencií varíruje (od niekoľko kilobáz po niekoľko megabáz)
a zvyčajne sú lokalizované v regióne obsahujúcom miesta zlomu BCR/ABL na chromozóme 9
(Calabrese et al., 2006). Podľa viacerých zdrojov literatúry je prognóza pacientov s touto abnormalitou
horšia, a to v prípade, že sú liečení chemoterapiou alebo pomocou transplantácie kostnej drene
(Kolomietz et al., Sinclair et al. a Huntly et al. in Quintas-Cardama et al, 2004; Calabrese et al., 2005).
Po zavedení nového spôsobu liečby pomocou kinázového inhibítora STI571 sa zlepšila situácia pre
týchto pacientov, pretože podľa Quintas-Cardamu (2004) je tento liek schopný preklenúť takúto
chromozómovú abnormalitu a prognóza pacientov s del (9q+) je rovnaká ako pri bežnej t(9;22).
V priebehu ochorenia rozlišujeme tri základné štádiá. Chronická fáza, ktorá sa niekedy nazýva
aj benígna fáza a je charakterizovaná výskytom pôvodného leukemického klonu s markerom Ph u 95
% pacientov. Môžeme ho detegovať pomocou aspoň jednej z dostupných genetických vyšetrovacích
metód v 90 % leukemických buniek každého pacienta. Za určitých predpokladov v tejto fáze môže
pacient prežívať celé mesiace. Akcelerovaná fáza je charakteristická postupným prevládaním určitých
klinických a laboratórnych abnormalít a zhoršovaním celkového stavu pacienta. V kostnej dreni sa
začnú postupne vyskytovať nové bunkové populácie s prídavnými genetickými zmenami –
sekundárnymi aberáciami chromozómov. Tieto nové populácie postupne vytláčajú pôvodný
leukemický klon. Fáza blastového zvratu je tiež niekedy označovaná aj ako malígna fáza. Blastový
zvrat je typický postupným pribúdaním nových aberácií chromozómov, ktorých počet a kombinácie
v jednotlivých prípadoch varírujú .
Pri prechode ochorenia z chronickej do akcelerovanej prípadne blastovej fázy sa môžu popri
Ph chromozóme v metafázových jadrách vyskytovať chromozómové abnormality viditeľné pri
klasickom cytogenetickom vyšetrovaní pomocou mikroskopu, ale aj pomocou FISH. Podľa Dewalda
a kol. (1997) 71 % pacientov má okrem t (9;22)(q34;q11) aspoň jednu z týchto chromozómových
abnormalít: trizómia 8 (34 %), +Ph (30 %) izochromozóm 17i - i(17q) (20 %), trizómia 19 (13 %), -Y
(8 % mužov), trizómia 21 (7 %), trizómia 17 (5 %), monozómia 7 (5 %). Ak sa tieto abnormality
vyskytnú v čase diagnózy, znamená to pre pacienta horšiu prognózu ( www.ncbi.nlm.gov/books/bv ).
Podľa typu prevládajúcich buniek v kostnej dreni a periférnej krvi rozoznávame dve formy blastovej
krízy: lymfoidná, ktorá je menej častá a myeloidná. V tomto smere môže cytogenetika napomôcť pri
predpokladaní blastovej krízy. Napríklad chromozómové aberácie týkajúce sa chromozómu 7 sú
zväčša spojené s lymfoidnou blastovou krízou. Iné aberácie ako +19, +21, i(17q) alebo +8
predpokladajú myeloidnú blastovú krízu (Sandberg et al., 1990, Mufti et al., 1996). Predpokladá sa, že
prechod ochorenia z chronickej do blastovej fázy je výsledkom viacerých aditívnych molekulových
zmien (Goldman, 2004).
CML z pohľadu molekulovej biológie
Z pohľadu molekulovej biológie pri t(9;22), teda pri vzniku génu BCR/ABL dochádza k zlomu
v géne ABL (Abelson), pričom presné miesto zlomu sa pohybuje na úseku asi 200 kb medzi dvoma
alternatívnymi exónmi Ia a Ib pred exónom 2. Niekedy je miesto zlomu na 5´konci exónu 1b, alebo
3´konci 1a, ale vždy je zlom na 5´konci exónu 2. Produktom nepoškodeného génu je proteín Abl
s veľkosťou 145kDa. Vyskytuje sa prevážne v jadre.
Nepoškodený gén BCR dáva vznik proteínu Bcr s veľkosťou 160 kDa. Na svojom N –
terminálnom konci obsahuje serín-treonínovú doménu. Jeho súčasťou je taktiež SH2 viažuca a C –
terminálna doména, ktorá funguje ako GTPáza aktivujúca proteín p21rac. (www.infobiogen.com).
32
V géne BCR (breakpoint cluster region) môže dôjsť k zlomu na troch miestach: M-bcr,
zriedkavejšie m-bcr a µ-bcr, avšak najčastejšie sa láme v jednom z intrónov (b2, b3) v oblasti
nazývanej major bcr – M - bcr. Spojením génov BCR a ABL vzniká fúzny gén BCR/ABL väčšinou
spojením exónov b2 (resp. e13) alebo b3 (resp. e14) génu BCR a a2 génu ABL. Vzniknutý transkript
má dĺžku 8,5 kb (dĺžka normálnej mRNA je 6 a 7 kb) (Sawyers, 1999). Celkom ojedinele dochádza
k zlomu génu BCR v ďalšej oblasti nazývanej mikro bcr – µ - bcr, kedy vzniká fúzny gén spojením
génov BCR a ABL medzi exónmi c3 (resp e19) a a2. Takýchto prípadov CML bolo zatiaľ popísaných
12 (Klener et al., 2002). Ďalej pri CML celkom výnimočne nachádzame zlom génu BCR v 1. dlhom
intróne, a toto miesto nazývame minor bcr – m - bcr. Zlom v tomto mieste vedie k spojeniu génov
BCR a ABL e1 – a2. (Mayer et al., 2002). Novovzniknutý fúzny gén BCR/ABL kóduje potom nový
proteín s hmotnosťou závisiacou od miesta zlomu v BCR, a to 210 (pri M-bcr), 190 (pri m – bcr)
alebo 230 kD (pri µ - bcr ). Onkoproteín Bcr/Abl sa oproti natívnemu proteínu Abl líši veľkosťou a
miestom výskytu. Nový gén sa vyskytuje výlučne v cytoplazme na rozdiel od Abl proteínu s výskytom
najmä v jadre. Najmarkantnejší je rozdiel vo funkcii. Má zvýšenú tyrozínkinázovú aktivitu, ktorá
vedie ku zvýšeniu schopnosti proliferácie a zníženiu schopnosti diferenciácie a apoptózy buniek.
Dnes už štandardnou metódou pre potvrdenie diagnózy CML je cytogenetické vyšetrenie, pri
ktorom sa jednak potvrdí výskyt typickej t(9;22), prípadne jej variantná forma a navyše slúži na
vylúčenie ďalších prípadných cytogenetických abnormalít. Zároveň s cytogenetickým vyšetrením sa
vykonáva aj fluorescenčná in situ hybridizácia (FISH) a polymerázová reťazová reakcia s využitím
reverznej transkriptázy (RT-PCR). Okrem kvalitatívnej PCR (pomocou nej sa zisťuje len prítomnosť
fúzneho produktu) sa čoraz častejšie používa aj kvantitatívna PCR, ktorou sa s vysokou citlivosťou
zisťuje aj počet fúznych produktov (RQ-PCR).
Závery
Diagnostika a liečba CML je od svojich počiatkov, teda od objavenia súvislosti Ph a CML
úzko spätá s genetikou a molekulovou biológiou. Sú neoddeliteľnou súčasťou diagnostických
a monitorovacích metód liečby CML. Pochopenie patogenézy ochorenie sa začalo s objavom
Philadelphia (Ph) chromozómu a pokračovalo s objasnením molekulovej podstaty, teda vzniku
BCR/ABL fúzneho génu.
Pre diagnózu CML a pre monitorovanie liečby je potrebná detekcia t(9;22)(q34;q11) alebo
prestavby BCR/ABL. Na tieto účely boli vyvinuté viaceré metódy genetiky a molekulovej biológie.
Klasická cytogenetická prúžkovacia analýza sa stala zlatým štandardom týchto metodík, ale bez FISH
a RT-PCR, či RQ-PCR si diagnostiku a monitorovanie ochorenia dnes už nevieme predstaviť.
Pre správne nastavenie liečby je dôležitá komunikácia medzi hematológmi a genetikmi, či
molekulovými biológmi a ich spoločná spolupráca pri interpretácii výsledkov. Dobrá spolupráca
a vzájomná dôvera pri odovzdávaní výsledkov vyšetrení tvoria podstatnú časť úspešnosti liečby tohto
závažného ochorenia a sú prínosom pre pacientov.
Použitá literatúra
1. Calabrese, G., et al.: Fluorescence In Situ Hybridization Analysis of Minimal Residual Disease and the
Relevance of the der (9) deletion in imatinib – treated patients with chronic myeloid leukemia. Haematologica.
91: 994– 95, 2006.
2. D'Antonio, J.: Chronic Myeloid Leukemia. Clin J Oncol Nurs. 9(5): 535–538, 2005.
3. Goldman, J.M.: Chronic myeloid leukemia – still a few questions.Exp Hematol. 32: 2–10, 2004.
4. Hughes, T.P, Branford, S.: Molecular monitoring of BCR/ABL as a guide to clinical management in chronic
myeloid leukaemia. Blood Rev. 20: 29–41, 2006.
5. Klener, P.: Klinická onkologie. Vyd. Galén a Nakladatelství Karolinum. 11–13; 231–232; 573; 576–577, 2002.
6. Mayer, J., Starý, J.: Leukemie. Vyd. Grada Publishing, spol. s r. o. 91–93; 94–97; 300–311, 2002.
7. Mufti, G.J., et al.: An atlas of malignant haematology, cytology, histology and cytogenetics. Martin Dunitz
Ltd. London. 171–176; 198–199,1996.
8. Quintas-Cardama, A., et al.: Imatinib mesylate therapy may overcome the poor prognostic significance of
deletions of derivative chromosome 9 in patients with chronic myelogenous leukemia. Blood. 105: 2281–86,
2004.
9. Sandberg, A.A.: The Chromosomes in Human Cancer and Leukemia. Elsevier Science Publishing Co., Inc.
427–514, 1990.
10. Sawyers, Ch.L.: Chronic Myeloid Leukemia. New Engl J Med. 340(17): 1330–1340, 1999.
11. www.infobiogen.com
12. www.ncbi.nlm.gov/books/bv
33
Využitie augmentačných techník v chirurgickej terapii parodontopatií
Dušan Hollý, Jozef Mračna
Univerzita Komenského, Lekárska fakulta, Klinika stomatológie a maxilofaciálnej chirurgie a OÚSA, Bratislava,
Slovenská Republika, [email protected]
Abstrakt
Cieľom parodontologického ošetrenia je nielen zvládnutie samotnej choroby, ale tiež
regenerácia poškodeného tkaniva. V priebehu ostatných rokov boli navrhnuté rôzne postupy
na dosiahnutie tohto cieľa. Riadená tkanivová regenerácia je postupom chirurgickej terapie
vyvinutým na základe experimentálnych štúdií. Umožňuje nové vytvorenie závesného aparátu
zubov postihnutých parodontitídou, t.j. reattachmentu. Rozumie sa tým úplná regenerácia
parodontálnych tkanív: cementu koreňa, alveolárnej kosti, periodoncia a epitelových úponov
na zub. Tento relatívne nový spôsob chirurgickej terapie parodontitídy je založený na princípe
mechanickej zábrany prístupu epiteliálnych a väzivových buniek gingívy, t.j. buniek orálneho
epitelu a následného umožnenia vrastania a osídlenia defektu progenitorovými bunkami
(desmodontami) schopnými diferenciácie. Parodontálne vlákna obsahujú tieto bunky
s regeneračným potenciálom, ktoré sú ako jediné schopné regenerovať parodontitídou zničený
závesný aparát.
Úvod
Augmentačné techniky pri terapii parodontopatií predstavujú použitie riadenej tkanivovej
regenerácie. Klinická metóda, umožňujúca regeneráciu závesného aparátu a kosti zubov poškodených
parodontitídou, musí umožniť bunkám parodontálneho ligamenta - desmodontom – pokryť povrch
koreňa zuba. Toto je možné dosiahnuť umiestnením okluzívnej membrány, ktorá sformuje priestor
medzi membránou a povrchom koreňa, do ktorého môžu vrastať tkanivá závesného aparátu.
Membrána taktiež zabráni proliferácii gingiválneho spojivového tkaniva a epitelu k povrchu koreňa
v priebehu hojenia.4
Dôležitou požiadavkou pri riadenej tkanivovej regenerácii je schopnosť membrány udržať
daný chránený priestor nad defektom a jej rezistencia ku kolapsu spôsobenému tlakom priložených
mukoperiostálnych lalokov. To platí hlavne pre resorbovatelné membrány, ktoré strácajú v priebehu
degradačného procesu svoju mechanickú odolnosť.V tom prípade je nutné použitie dodatočných
podporných techník. Membrána má dvojvrstvovú štrukúru. Jedna vrstva je porózna a prikladá sa ku
kosti, čo umožňuje jej vrastanie do defektu. Cez druhú, kompaktnejšiu vrstvu, sa prikladá
mukoperiostálny lalok. Tým sa zabráni vrastaniu mäkkých tkanív do ošetrenej rany. Štruktúru si má
membrána udržovať aj vo vlhkom prostredí a má byť používaná v kombinácii s podporným
materiálom, ktorý vyplní defekt.
Materiál a metódy
Jedným z najdôležitejších cieľov terapie parodontopatií je eliminácia hlbokých vačkov,
pretože práve v nich sa neprestajne zvyšuje počet patogénnych anaeróbnych mikroorganizmov.
Redukcia hĺbky vačku (príp. eliminácia) môže byť dosiahnutá postupmi resekčného alebo
regeneratívneho charakteru alebo kombináciou oboch. Regeneratívne postupy v parodontológii
znamenajú použitie riadenej tkanivovej regenerácie – RTR.
Klinické indikácie RTR v parodontológii7:
- Furkácie – II.stupeň – mandibula, II.stupeň – maxilla bukálne, III.stupeň – mandibula, ak je
vertikálny rozmer ≤ 3mm (podtrieda A - 1-3 mm; Tarnow and Fletcher 1984).
- Kostné defekty – 1,2,3 -stenné (1-stenné s nižšou mierou úspešnosti, kostný štep).
Kontraindikácie7:
- Lokálne faktory - nedostatočná kontrola plaku; nedostatočne endodonticky ošetrené devitálne zuby;
silne kývavé zuby bez stabilizácie.
- Systémové faktory – fajčenie; dekompenzovaný DM, iné celkové ochorenie, ktoré ovplyvňuje
možnosti ošetrenia.
34
Pri klinickom použití sa používajú rôzne materiály. Podľa rôznych charakteristík ich môžeme
deliť nasledovne6,10:
Podľa aktivity:
- osteogénne – obsah preukázateľných buniek, ktoré tvoria kostné tkanivo,
- osteoindukčné – stimulujú (indukujú) tkanivá k tvorbe novej kosti, samé nemajú osteogénny
potenciál,
- osteokondukčné – vypĺňajú priestor defektu, vytvárajú sieť(matrix, podklad), nevytvárajú novú kosť,
neindukujú tvorbu kosti.
Podľa pôvodu materiálu:
- autogénne (autograft, autológne – od toho istého jedinca) - tuber maxillae, z extrakčnej rany,
bezzubá časť alveolárneho výbežku, mentálna časť sánky, vzostupné rameno sánky, lopata bedrovej
kosti;
- isogénne (isograft, syngénne – monozygotné dvojičky, príbuzné osoby) – kortikálna kosť,
trabekulárna kosť (a ich kombinácie);
- alogénne (allograft, homológne – od rovnakého druhu – odvodené od ľudských kadávrov, sú
dostupné cez autorizované a certifikované tkanivové banky) DFDBA (demineralized freeze-dried bone
allograft) – demineralizovaný mrazený vysušený kostný štep, FDBA (freeze-dried bone allograft)
mrazený vysušený kostný štep, mrazená vysušená kostná dreň;
- xenogénne (xenograft, heterogénne, heterológne – od iného druhu) – kolagén, kosť (bovínne - BioOSS, purínne – Puros);
- aloplastické (alloplastic graft, syntetické – chemicky cudzí materiál) – „Plaster of Paris”, calcium
carbonate, calcium phosphate, keramika, hydroxyapatit (HA), biosklo, beta-trikalcium fosfát (β-TCP),
polyméry a iné.
Na trhu je dnes široká škála certifikovaných membrán na použitie v stomatológii, vo
všeobecnosti ich môžeme deliť na:
- Syntetické, neresorbovatelné – Gore-Tex, Gor-Tex Ti, e-PTFE;
- Syntetické, resorbovatelné (bioabsorbovatelné) – Vicryl, Guidor, Resolut, Artisorb, a iné;
- Naturálne, biodegradovatelné (bovínne, purínne) – Bio-Gide, Biomend, Alloderm.
Nároky na optimálnu membránu sú bezpečnosť (zabránenie šíreniu ochorenia),
biokompatibilita (netoxická, neimunogénna), adaptovateľnosť na povrch koreňa a kosti (jednoducho
a bezpečne), rigidita (aby sa membrána neprevaľovala do defektu), permeabilita (pre potrebné
molekuly, nie však pre bunky), integrácia do tkanív (imobilita), dlhodobé udržiavanie priestoru,
biodegradácia (kontrolovatelná), ďalšie vlastnosti (antimikrobiálny efekt, biostimulácia)9.
Pre riadenú tkanivovú regeneráciu máme možnosť výberu neresorbovatelných
a resorbovatelných membrán. V širokom klinickom použití pri RTR sú membrány e-PTFE, u ktorých
možno pomerne presne predpovedať výsledok regenerácie. Taktiež dostupné sú titánom zosilené
membrány.
Použitie nevstrebatelných membrán sprevádzajú určité problémy. Membány e-PTFE sa majú o
4-6 týždňov po aplikácii odstraňovať. Pri sekundárnej operácii, kedy membránu odstraňujeme, často
zistíme, že nezrelé novotvorené tkanivo prestupuje membránu, alebo k nej pevne adheruje.
Mechanické poškodenie tohto tkaniva, ktoré sprevádza odstránenie membrány, ovplyvňuje proces
hojenia. Pokiaľ sa nepodarí novotvorené tkanivo kompletne v priebehu sekundárnej operácie prekryť
lalokom, príde k úbytku regenerovaného tkaniva. 2,8 Niekedy je obtiažne v situácii značného odhalenia
membrány novotvorené tkanivo dokonale uzavrieť lalokom. Bioresorbovatelné membrány nevyžadujú
sekundárnu operáciu, ktorou membránu odstraňujeme. Záťaž je tak menšia ako pre pacienta, tak aj pre
ošetrujúceho. To bol taktiež dôvod, prečo došlo k vývoju rôznych vstrebatelných membrán.1,3
Na kompletnú regeneráciu parodontálnych štruktúr, vrátane cementu, parodontálnych ligament,
kosti a ďasna je potrebná súhra medzi viacerými pluripotentnými bunkami, extracelulárnymi matrix
a proteínovými matrix, systémových hormónov ako aj rastových a diferenciačných faktorov.10
Z týchto faktorov medzi najdôležitejšie patria: PDGF (platelet-derived growth factor – trombocytový
rastový faktor), IGF (insuline-like growth factor – od inzulínu odvodený rastový faktor), TGF-β
(transforming factor beta – transformujúci rastový faktor beta), BMP (bone morphogenetic proteins -2,
-4, -7 – kostné faktory) a FGF (fibroblast growth factor – fibroblastový rastový faktor).
35
Tieto faktory sa používajú čoraz častejšie na vystupňovanie a zlepšenie hojenia parodontu.
Zvýšenie hladín rastových faktorov vedie k zlepšeniu novotvorby kosti a rastové faktory trombocytov
zároveň urýchľujú hojenie mäkkých tkanív v okolí kosti. Na dosiahnutie tohto cieľa sa v klinických
podmienkach používa trombocytový koncentrát (plazma bohatá na trombocyty, PRDP – platelet rich
derived plasma) pripravený z odobratej krvi pacienta pred zákrokom a separovaný v krvnej banke.
Jeho výhody sú nasledovné:
- Urýchľuje endoteliálnu, epiteliálnu a epidermálnu regeneráciu,
- Stimuluje angiogenézu,
- Podporuje syntézu kolagénu a zvyšuje pevnosť regenerovaného tkaniva,
- Pôsobí hemostaticky,
- Organizuje krvný hematóm a zmenšuje pooperačný edém,
- Znižuje bolestivosť a tým redukuje spotrebu analgetík v pooperačnom období,
- Urýchľuje depozíciu extracelulárnej matrix a tým aj uzáver rany,
- Vylučuje možnosť prenosu infekcie a imunitnú odpoveď (autológny materiál)5.
Výsledky a diskusia
Pred chirurgickým výkonom musí byť u pacientov dosiahnutá úprava hygieny, hygienická
inštruktáž a predliečený stav parodontu. (obr.1) Samotný chirurgický zákrok spočíva v odklopení
mukoperiostálnych lalokov z vestibulárnej aj palatinálnej (lingválnej) strany, kyretáže parodontálnych
chobotov, odstránení granulačného tkaniva z mäkkých tkanív (obr.2), zvyškov subgingiválneho
zubného kameňa a nekrotických častí cementu koreňa zuba.
Gél má ideálne vlastnosti na vyplnenie kostného defektu. Pred jeho aplikáciou do defektu sa
odporúča naloženie pomocných stehov. Ich sutúra nasleduje po spomínanej aplikácii gélu a prekrytí
kolagénovou membránou (obr.7,8). Potom priklopíme a adaptujeme mukoperiostálne laloky
a fixujeme ich definitívnou sutúrou (obr.9).
Pooperačne sa podávajú antibiotiká a sú ordinované výplachy dezinfekčnými roztokmi
s obsahom chlórhexidínu. Sledovaný je proces osteogenézy a osteointegrácie.
Po deviatich mesiacoch sa hodnotí úspech operácie, t.j. znovuvytvorenie parodontálnych
štruktúr závesného aparátu – reattachmentu a na rtg nárast kostného tkaniva (obr.10,11).
Obr. 1.
Obr. 2.
Obr. 3.
Obr. 4.
36
Obr. 5.
Obr. 6.
Obr. 7.
Obr. 8.
Obr. 9.
Obr. 10.
Obr. 11.
Závery
Augmentácie v rámci riadenej tkanivovej a kostnej regenerácii v parodontológii sú techniky,
ktoré sa v širokom rozsahu používajú na regeneráciu poškodeného závesného aparátu zubov. Prinášajú
nové aspekty na terapiu parodontopatií. Súčasná moderná parodontológia smeruje k zlepšovaniu
týchto zákrokov pomocou regeneračných faktorov, ktoré sa postupne stávajú súčasťou klinickej praxe.
37
Použitá literatúra
1. Becker W, Becker BE, Mellonig J, et al. A prospective multi-centered study evaluating periodontal
regeneration for class II furcation invasions and intrabony defects after treatment with a bioresorbable barrier
membrane: 1 year results. J Periodontol 1996; 67: 641-649.
2. Cortellini P, Pini Prato G, Tonetti MS. Periodontal regeneration of human infrabony defects with titanium
reinforced membranes. A controlled clinical trial. J Periodontol 1995; 66: 797-803.
3. Cortellini P, Pini Prato G, Tonetti MS. Periodontal regeneration of human intrabony defects with
bioresorbable membranes. A controlled clinical trial. J Clin Periodontol 1996 67: 217-223.
4. Fassmann A, Vaněk J, Dvořáková N, et al., Řízená tkáňová a kostní regenerace ve stomatologii. Praha :
GRADA, 2002. 200s., ISBN 80-247-0316-5.
5. Marx RE, Carlson ER, Eichstaedt RM, Schimmele SR, Strauss JE, Georgeff KR. Platelet.rich plasma: Growth
factor enhancement for bone grafts. Oral Surg Oral Med Oral Pathol 1998;85:638-646
6. Newman MG, Takei HH, Klokkevold PR, Carranza FA, et al., Carranza’s Clinical Periodontology, St.Louis :
Saunders Elsevier, 2006. 1328p., ISBN-13: 978-1416024002
7. Stellungsnahme der Deutsche Gesellschaft für Zahn-, Mund- und Kieferheilkunde, Liesegangstr. 17 a - 40211
Düsseldorf, Stand 06/1999
8. Tonetti MS, Pini Prato G, Cortellini P. Periodontal regeneration of human infrabony defects. IV. Determinants
of healing response. J Periodontol 1993; 64(10): 934-940.
9. Vojtassák J, Bakos D, Danihel L, Kristín J, Böhmer D, Danisovic L, Blasko M. In vitro cytotoxicity testing of
coladerm membrane. Cell Tissue Bank. 2001;2(4):225-33.
10. Wolf HF, Rateitschak EM, Rateitschak KH, Hassel TM, et al., Periodontology - Color Atlas of Dental
Medicine. Stuttgart : Georg Thieme Verlag, 2005. 534p., ISBN 3-13-675003-9.
38
Možnosti monitoringu liekového rizika
Roman Hudec, Lýdia Božeková, Milan Kriška
Univerzita Komenského v Bratislave, Lekárska fakulta, Farmakologický ústav, Bratislava, Slovenská Republika,
[email protected]
Abstrakt
Spontánny monitoring je jednou zo súčastí organizovania farmakovigilancie.
Výhodami spontánneho monitoringu je finančná nenáročnosť, jednoduchosť, široký
komplexný záber, náhodný výber prebiehajúci kontinuálne. Sledovali sme frekvenciu
hlásených nežiaducich účinkov jednotlivých liekov, ako aj ich závažnosť a spektrum v rokoch
1998-2004. Údaje sme čerpali z materiálov Národného centra pre sledovanie nežiaducich
účinkov liečiv pri ŠÚKL-i. Vážne NÚL sa podieľajú na hlásení vyrovnane a ich množstvo
osciluje okolo hodnoty 200/rok. Získané výsledky hovoria o narastajúcej tendencii
v celkovom počte spontánnych hlásení, čo je priaznivý výsledok (z počiatočných 487/rok až
na 860/rok). Vnímanie rizika liekov je na Slovensku vo všeobecnosti nízke. Je to aj vďaka
nízkej spolupráci lekárov v rámci systému farmakovigilancie a v neposlednom rade vďaka
nízkej ochote hlásiť nežiaduce účinky. Postupne sa zvyšuje druh hlásených reakcii, okrem
najčastejšie pozorovaných kožných reakcií, aj iné reakcie (extrapyramídová porucha, alebo
ischémia myokardu a hypertyreóza).
Úvod
Spontánny monitoring je jednou zo súčastí organizovania farmakovigilancie. Ide o spontánne
hlásenia lekárov o výskyte nežiaducich účinkoch liekov. Hlásenia sa realizujú na špeciálnych
tlačivách, ktoré sú zasielané do Centra pre sledovanie nežiaducich účinkov pri Štátnom ústave na
kontrolu liečiv (ŠÚKL).
Hlásená informácia o možnej kauzálnej súvislosti medzi nežiaducim účinkom a liekom sa
označuje ako signál. Tento údaj bol predtým neznámy, alebo nedostatočne dokumentovaný. Pre vznik
signálu je potrebných zväčša viac ako jedno hlásenie (Edwards a Aronson, 2000).
Výhodami spontánneho monitoringu sú (podľa Wood a kol., 1998):
- finančná nenáročnosť
- jednoduchosť
- široký komplexný záber
- náhodný výber prebiehajúci kontinuálne.
Nevýhody spontánneho monitoringu sú (podľa Begaud a kol., 1994):
- nízky záchyt nežiaducich účinkov
- obtiažne sa dá určiť frekvencia NÚL
- nedajú sa hodnotiť nežiaduce účinky typu C a D
- nízka validita - výsledky z malých populačných celkov.
V začiatočných štádiách uvádzania lieku pri klinickom skúšaní je pôsobeniu nového lieku
exponovaných asi 1500 pacientov , čo umožňuje zachytiť len najčastejšie NÚL. Na to, aby sme
objavili vzácne sa vyskytujúce reakcie je potrebné aby bolo liečivu exponovaných minimálne 30 000
pacientov. Po zavedení lieku do používania sú hlásenia z praxe podstatné pre identifikáciu možných
menej častých NÚL (Belton a kol., 1995, Pirmohamed a kol., 1998). Postmarketingové sledovanie je
poslednou fázou klinického hodnotenia nového lieku. Prebieha po zavedení lieku do používania
a vďaka širokému záchytu je veľmi dobrou možnosťou na hodnotenie nežiaducich účinkov (Waller
a kol., 1992, Dunn a Mann, 1999).
Materiál a metódy
Sledovali sme frekvenciu hlásených nežiaducich účinkov jednotlivých liekov, ako aj ich
závažnosť a spektrum. Údaje sme čerpali z materiálov Národného centra pre sledovanie nežiaducich
39
účinkov liečiv pri Štátnom ústave pre kontrolu liečiv Slovenskej republiky. Závažné nežiaduce účinky
vedú k poškodeniu pacienta, prípadne až k smrti.
Získané údaje o hlásených NÚL sme štatisticky vyhodnotili metódou korelačnej analýzy.
Kritická hodnota korelačného koeficientu r pre alfa 0.05 zistená z literatúry je 0,7743.
Výsledky a diskusia
Spontánne hlásenia nežiaducich účinkov po liekoch sa dlhodobo považujú za najlepší zdroj
signálov o riziku liekov a sú externým ukazovateľom percepcie liekového rizika. Možno nepriamo
usudzovať o korelácii medzi percepciou rizika a monitorovaním rizika pomocou spontánnych hlásení.
Sledovali sme trend v počte všetkých hlásení, ktoré prišli do Národného centra pre nežiaduce účinky
(Tab. 1).
Tabuľka 1 Všetky hlásené NÚL v rokoch 1998-2004
Počet hlásení *
Rok
1998
Rok
1999
Rok
2000
Rok
2001
Rok
2002
Rok
2003
Rok
2004
487
533
565
924
740
772
860
* - signifikantná zmena
Najčastejšie lekári hlásili kožné prejavy (erytém, exantém, pruritus) s výnimkou roku 2001.
Nárast počtu spontánnych hlásení v sledovanom intervale je signifikantný s výrazným vrcholom
v roku 2001, kedy až 37,8 % všetkých hlásení predstavoval kašeľ pri užívaní inhibítorov angiotenzín –
konvertujúceho enzýmu.
Postupne sa mení štruktúra hlásení a zvyšuje sa počet liekov, po ktorých sa hlásili nežiaduce
reakcie (v roku 1998: 235; a v roku 2004: 438), čo predstavuje signifikantný nárast. Sledovanie
pôvodu hlásení z hľadiska profesie ukazuje, že v posledných rokoch nastal obrat a hlásenia
z ambulancií prevažujú nad hláseniami z nemocníc.
Podiel vážnych reakcií na celkovom počte hlásení ukazuje tabuľka (Tab. 2).
Tabuľka 2 Hlásené vážne reakcie
Rok
1998
1999
2000
2001
2002
2003
2004
Absolútny počet
Percentuálny podiel zo
všetkých hlásení
162
213
172
215
200
173
185
33,26
39,39
30,44
23,27
27,03
22,41
21,51
Vážne NÚL sa podieľajú na hlásení vyrovnane a ich množstvo osciluje okolo hodnoty 200/rok.
Vzhľadom na vzostup absolútneho počtu hlásení má percentuálny podiel vážnych reakcií klesajúcu
tendenciu.
Vnímanie rizika liekov je na Slovensku vo všeobecnosti nízke. Je to aj vďaka nízkej
spolupráci lekárov v rámci systému farmakovigilancie a v neposlednom rade vďaka nízkej ochote
hlásiť nežiaduce účinky. Výsledkom je malý počet spontánnych hlásení zaregistrovaných na Štátnom
ústave pre kontrolu liečiv.
Predovšetkým organotoxické nežiaduce účinky môžu v príčinnej súvislosti s liečbou uniknúť
pozornosti, vzhľadom k latencii nástupu reakcie a ohraničeným možnostiam diagnostiky.
Vysvetlením nárastu počtu hlásení v roku 2001 by mohlo byť tzv. indukované hlásenie, ktoré
môže byť napr. spôsobené požiadavkou intolerancie ACEI (dráždivý kašeľ) pri preskripcii blokátorov
angiotenzínového receptora (sartanov).
Získané výsledky hovoria síce o narastajúcej tendencii v počte spontánnych hlásení, čo je
priaznivý výsledok, ale v porovnaní s údajmi z konca osemdesiatych rokov, kedy sa počet
spontánnych hlásení na Slovensku pohyboval okolo 1000-1500 hlásení za rok, je súčasných okolo
800 hlásení vlastne poklesom. Situácia v zahraničí je podobná, v Taliansku je hlásených asi 12,3
reakcií na 100 000 obyvateľov a rok v období 1998–2004 (u nás to vychádza asi 12,9 hlásenia/100 000
obyvateľov a rok) (Polimeni a kol., 2006).
Zaznamenali sme relatívne ustálený počet hlásených závažných nežiaducich účinkov.
Postupne sa zvyšuje druh hlásených reakcii, okrem najčastejšie pozorovaných kožných reakcií, aj iné
40
reakcie (extrapyramídová porucha, alebo ischémia myokardu a hypertyreóza). Práve počet závažných
reakcií hovorí o kvalite spontánneho monitoringu, pretože práve takéto hlásenia majú vysokú
výpovednú hodnotu. V Taliansku napríklad predstavovali záväzné hlásenia NÚL v období 1998–2004
42,6 % (na Slovensku len 27 %) (Polimeni a kol., 2006).
Pozitívnu zmenu by prinieslo väčšie zapojenie farmaceutov do spontánneho monitoringu,
pretože farmaceuti sú často konfrontovaní s prípadnými problémami pacientov. Podľa posledných
informácii zo Štátneho ústavu pre kontrolu liekov sa už objavili prvý spolupracujúci farmaceuti.
V zahraničí (USA, či Holandsko) sa farmaceuti podieľajú významným percentom na počte
spontánnych hlásení (Van Grootheest a kol., 2004).
Závery
Vývoj povedomia o riziku farmakoterapie medzi odbornou verejnosťou sa zlepšuje. Prejavuje
sa to stúpajúcim počtom spontánnych hlásení v sledovanom intervale. Situáciu v hlásení NÚL by
pomohol zlepšiť vyšší počet edukačných akcií .
Nedostatočná spolupráca lekárov môže mať viacero príčin: strach z pocitu viny pri výskyte
NÚL, nedostatok času pri záťaži klinickou prácou, neodôvodnené uspokojenie, samoľúbosť, chybná
viera, že na trh prichádzajú len bezpečné lieky, strach z postihu, ignorancia metódy hlásenia, neochota
hlásiť nežiaduce účinky s neistou, len pravdepodobnou kauzalitou, či všeobecná letargia
k administratívnej práci.
Poďakovanie
Práca bola podporená grantom UK/5/2006.
Použitá literatúra
1. Begaud, B., Moride, Y., Tubert-Bitter, P. et al.: False positive in spontaneus reporting: should we worry about
them? Br J Clin Pharmacol. 38: 401–4, 1994.
2. Belton K.J., Lewis S.C., Payne S. et al.: Attitudinal survey of adverse drug reaction reporting by medical
practitioners in the United Kingdom. Br J Clin Pharmacol. 39: 223–6, 1995.
3. Dunn N., Mann R.D..: Prescription-event and other forms of epidemiological monitoring of side-effects in the
UK. Clin Exp Allergy. 29(Suppl 3): 217–39, 1999.
4. Edwards I.R.: Spontaneous reporting - of what? Clinical concerns about drugs. Br J Clin Pharmacol. 48(2):
128–34, 1999.
5. Edwards I.R., Aronson J.K.: Adverse drug reactions: definitions, diagnosis, and management. Lancet.
356(9237): 1255–9, 2000.
6. Pirmohamed M., Breckenridge A.M., Kitteringham N.R. et al.: Adverse drug reactions. Br Med J. 316: 1295–
8, 1998.
7. Polimeni G., Salvo F., Cutronea P. et al.: Adverse reactions induced by NSAIDs and antibacterials. Drug Saf.
29(5): 449–59, 2006.
8. Van Grootheest K., van Puijenbroek E.P., de Jong-van den Berg L.T.: Do pharmacists' reports of adverse drug
reactions reflect patients' concerns ? Pharm World Sci. 26(3): 155–9, 2004.
9. Waller P.C., Wood S.M., Langman M.J.S. et al.: Review of company postmarketing surveillance studies. Br
Med J. 304: 1470–2, 1992.
10. Wood, A.J.J., Stein, C.M., Woosley, R.: Making Medicines Safer - The Need for an Independent Drug
Safety Board. N Engl J Med. 339: 1851–4, 1998.
41
Enzymatic degradation of chitosan-based microspheres
Lucia Kalinovská, Silvia Bubeníková, Dušan Bakoš
Institute of Polymer Materials, Faculty of Chemical and Food Technology, Slovak University of Technology,
Bratislava, Slovak Republic, [email protected]
Abstract
Biodegradable polymers for localized delivery of antibiotics have emerged as an
important approach to treating wound infections. This paper describes the formulation and in
vitro evaluation of biodegradable ofloxacin loaded chitosan-tripolyphosphate and chitosan tripolyphosphate - chondroitin sulphate core-shell type microspheres formulated by ionotropic
gelation and polyelectrolyte complexation. The study was focused on the mutual relation
between the release of ofloxacin from the microspheres and their composition. The amount of
released ofloxacin was determined using UV/VIS spectrophotometric measurements.
Ofloxacin release from the microspheres was biphasic with an initial burst release followed
by a slow release phase. The results obtained showed that the drug release could be controlled
by the manipulating the preparation conditions. This should provide a means for formulating
sustained release of antibiotics from microspheres for the treatment of infections associated
with the wound.
Introduction
Chitosan is a biocompatible, biodegradable biopolymer with unique cationic character and gel
forming properties. Due to these characteristics chitosan has been extensively used in medical and
pharmaceutical areas, especially in drug delivery, wound dressing and as an antimicrobial agent
(Muzzarelli, 2004; Liu, 2004).
Polyelectrolyte complex based on chitosan and tripolyphosphate can be used for the preparation
of chitosan beads and microspheres because of its quick gelling ability (Aral, 1998). This binary
system exhibits, however, poor mechanical strength, which can be a limiting factor for intended
applications (Shu, 2004). To eliminate this drawback high molecular weight polyanion chondroitin
sulphate is being used to improve mechanical properties and tailoring permeability, chemical stability
and controlled release properties of chitosan-based microspheres.
Microspheres with well-known characteristics and good mechanical properties can act as a
donor of various active substances. In our study we have chosen ofloxacin, the fluoroquinolone
antibiotic with a high activity against a wide range of gram-positive and gram-negative bacteria
(Fresta, 2002; Christian, 1996) as a model drug in the in vitro experiments.
The goal of this study was to investigate the effects of the preparation conditions on the kinetics of
ofloxacin release from three different kinds of microspheres, especially chitosan/tripolyphosphate,
chitosan/tripolyphosphate microspheres coated by chondroitin sulphate as well as
chitosan/tripolyphosphate/chondroitin sulphate hydrogel microspheres using specific enzymes.
Materials and methods
High-viscosity chitosan (CHIT) was obtained from Fluka (Germay). Tripolyphosphate (TPP)
was purchased by Acros Organics (Belgium). Chondroitin-4-sulphate (CHS) with was obtained from
EMD Biosciences, (USA). Lysozyme (LYS) was purchased from Fluka (Germany). Ofloxacin (OF)
and Chondroitinase ABC (CHSABC) were obtained from Sigma (USA). All other chemicals were of
analytical grade.
1 wt.% of CHIT solution was used for preparation of microspheres. The solution was prepared by
dissolving 1 g of CHIT and 0.9 g of NaCl in 60 mL of 0.5 % acetic acid aqueous solution (pH 2.2) under
stirring at 40°C for about 4 hours until complete dissolution of CHIT. pH of solution was increased to
5.0 with 1 wt.% NaOH aqueous solution and distilled water was added to have the final mass of solution
100 g. The OF concentration of 2 wt.% in CHIT solution (CHIT/OF) was used in the OF encapsulation
and release studies. Solution was centrifuged at 4000 rpm for 1.5 hour before use.
Three types of anionic solutions (PA) containing oligoanion TPP and polyanion CHS were
prepared: a) 0.5 wt.% TPP dissolved in 0.9 wt.% NaCl, b) mixed TPP and CHS (TPP+CHS) solution
42
containing 0.14 wt.% TPP and 0.06 wt.% CHS, and c) 0.5 wt.% CHS solution in 0.9 wt.% NaCl. The
pH of the TPP and (TPP+CHS) solutions were modified with concentrated acetic acid 7.0. The pH of
CHS coating solution was 7.0.
Three different types of ofloxacin loaded microspheres were prepared depicted in Figure 1. The
first type CHIT/TPP microspheres were prepared by dropping CHIT/OF solution to the TPP solution.
The second type CHIT/TPP/CHS microspheres were prepared by coating CHIT/TPP microspheres with
CHS. The third type CHIT/(TPP+CHS) microspehres was made by dropping CHIT/OF solution to the
(TPP+CHS) solution. All types of microspheres were prepared using multi-loop reactor (Anilkumar,
2001).
CHIT/OF
CHIT/OF
TPP
CHIT/OF
TPP+CHS
TPP
CHS
CHIT/TPP
CHIT/TPP/CHS
CHIT/(TPP+CHS)
Fig. 1. Different types of prepared microspheres.
Diameter and membrane thickness were measured by optical microscopy using Kapa 2000
microscope (Kvant, s.r.o. Bratislava, Slovak Republic) equipped with a CCD camera CC63KW1P (Mintron, Malaysia) and capsule imaging software Prover Image Forge 1.1.
Texture Analyser TA-2xi (Stable micro systems, Goldaming, United Kingdom) was used to
determine the mechanical resistance of microspheres. Mechanical resistance was measured as the
force (in grams) necessary to break one microsphere. Applied compression speed was 0.5 mm/s. The
force needed for 90 % compression was taken as the characteristics of mechanical resistance of
microspheres. The reported force values represent the mean of at least 25 measurements.
Determination of release of OF from microspheres was provided using UV/VIS
spectrophotometer Cecil CE 7250 (Cecil Instruments Ltd., United Kingdom). All measurements were
provided at 25 °C at 293 nm.
Results
The process of CHIT microspheres formation is driven by the electrostatic interactions. It
combines the ionotropic gelling, by interactions between cationic amine groups of CHIT and anionic
phosphate groups of TPP, with the polyelectrolyte complexation between cationic amine groups of
CHIT and anionic sulfate groups of CHS. Microspheres prepared in this work were formed under
different experimental conditions with respect to the process of preparation.
Microspheres produced had spherical shape and core-shell structure (Table 1). All microspheres
had transparent or semi-transparent membranes. Therefore, the membrane thickness was determined
with a relative high precision (± 5 %).
The mechanical resistance of microspheres was determined in the 90 % distance and was given
in grams per microsphere, which allowed the comparison between different types of experiments
(Malgorzata, 2004).
Tab. 1. Preparation and storing conditions of CHIT microspheres and their optical and mechanical
properties.
43
Microsphere type
No.
CHIT/TPP
CHIT/TPP/CHS
CHIT/(TPP+CHS)
1
2
3
Reaction time in PA solution
(s)
TPP CHS coat TPP+CHS
40
40
-
−
300
−
−
−
40
Diameter
(µm)a)
Thickness
(µm)b)
620
630
920
150
160
140
Force at 90
%
deformation
(g)c)
2.80±1.70
4.80±1.70
3.98±3.16
a
Standard deviation < 10%.
Standard deviation < 5%.
c
The values are the mean±s.d. of 25 experiments.
b
In vivo application of microspheres can affect release of the active substance as well as their
behavior. In organism we find several agents that can lead to faster or slower release of an active
substance, one of main enzymes could be considered. Lysozyme is specific enzyme degrading CHIT.
Figure 2 shows the affect of lyzosyme to microspheres. The amount of lysozyme used corresponds the
amount of enzyme on the surface of the organism. In all cases specific curve for degradation by
lysozyme is being observed.
Ofloxacin released (% )
120
100
80
60
1
2
3
40
20
0
0
1
2
3
4
5
140
160
180
Time (hour)
Fig. 2. Enzymatic degradation of microspheres using lysozyme.
The release of OF using chondroitinase ABC was reached only in microspheres containing
CHS. Figure 3 shows the amount of released OF using CHSABC.
44
Ofloxacin released (% )
120
100
80
60
1
2
3
40
20
0
0
1
2
3
4
5
140
160
180
Time (hours)
Fig. 3. Enzymatic degradation of microspheres using chondroitinase ABC.
Conclusions
The results presented in the paper confirm that a very sensitive formation of the microspheres
based on chitosan can be successfully solved using the continual process in the multi-loop reactor,
which is connected with adjusting the size, shape and topology of the microspheres. The modification
CHI/TPP and CHIT/TPP/CHS microspheres with ofloxacin and comparing these systems showed the
difference of OFL release using enzymatic degradation. This drug release application implies a
potentiality for controlling this process.
Acknowledgement
This work was supported by Science and Technology Assistance Agency under the No.
APVT-20-015904 and APVV-51-033205.
Literature
1. Anilkumar, V., Lacík, I., Wang, T.G.: A novel reactor for making uniform capsules. Biotechnol Bioeng. 75:
581–9, 2001.
2. Aral, C., Akbuga, J.: Alternative approach to the preparation of chitosan beads. Int J Pharm. 168: 9–15, 1998.
3. Fresta, M., Guccione, S., Beccari, A.R., Furneri, P.M., Puglisi, G.: Combining molecular modeling with
experimental methodologies: mechanism of membrane permeation and accumulation of ofloxacin. Bioorg
Med Chem. 10: 3871–89, 2002.
4. Christian, J.S.: The quinolone antibiotics. Primary Care Update for OB/GYNS. 3: 87–92, 1996.
5. Liu, H., Du, Y., Wang, X., Hu, Y, Kennedy, J.F.: Interaction between chitosan and alkyl β- -glucopyranoside
and its effect on their antimicrobial aktivity. Carbohydr Polym. 56: 243–50, 2004.
6. Lekka, M., Sainz-Serp, D., Kulik, A.J., Wandrey, Ch.: Hydrogel Microspheres: Influence of Chemical
Composition on Surface Morphology, Local Elastic Properties, and Bulk Mechanical Characteristics.
Langmuir. 20: 9968–77, 2004.
7. Muzzarelli, C., Stanic, V., Gobbi, L., Tosi, G., Muzzarelli, R.: Spray-drying of solutions containing chitosan
together with polyuronans and characterisation of the microspheres. Carbohydr Polym. 57: 73–82, 2004.
45
Biochemická a molekulárno–genetická diagnostika Smith–Lemli–Opitzovho syndrómu
Katarína Kolejáková, Robert Petrovič, Mária Fischerová, Danka Maceková, Jozef Adámať,
Ľubica Strháková, Pavol Ipóth, Darina Ďurovčíková, Ján Chandoga
Centrum lekárskej genetiky FNsP Bratislava, Slovenska Republika, [email protected]
Abstrakt
Smith-Lemli-Opitzov syndróm (SLOS) je autozómovo recesívne ochorenie,
charakteristické širokým spektrom vrodených anomálií. Celosvetová incidencia SLOS sa
odhaduje v intervale 1:10 000 – 1: 60 000. Biochemickou príčinou SLOS je deficitná aktivita
enzýmu 7- dehydrocholesterol reduktázy. Genetická porucha je spôsobená širokým spektrom
mutácií v DHCR7 géne, ktorý je lokalizovaný na chromozóme 11q12-13. Pre diagnostiku
SLOS sme využili biochemické a molekulárno-genetické metódy. GC/MS analýza sterolov
séra sa preukázala ako vhodná metóda na biochemickú diagnostiku SLOS. Pri pozitívnom
biochemickom náleze sa indikovala sekvenčná analýza génu. U pacientov s biochemicky
diagnostikovaným SLOS sme sekvenčnou analýzou identifikovali mutácie: L109P, W151X,
V326L, R352Q, G410S. Následne sme pre rýchlu detekciu frekventovaných mutácií zaviedli
restrikčnú analýzu a alelovo – špecifickú PCR. Zavedením biochemickej diagnostiky a
molekulárno-genetických metód na detekciu mutácií v DHCR7 géne do bežnej klinickej praxe
sa zabezpečila komplexná diagnostika SLOS na Slovensku.
Úvod
Dlhé obdobie bol cholesterol považovaný hlavne za štruktúrny komponent biomembrán,
dôležitú zložku myelínu, prekurzor pre biologicky aktívne látky - steroidné hormóny a žlčové kyseliny
a významný rizikový faktor srdcovo-cievnych ochorení. Pohľad na význam a úlohu cholesterolu sa
rozšíril, keď bol v roku 1993 popísaný Smith-Lemli-Opitzov syndróm (SLOS).
Smith-Lemli-Opitzov syndróm je autozómovo recesívne, dedičné metabolické ochorenie. Je
charakteristické širokým spektrom vrodených anomálií, z ktorých najčastejšie sú kraniofaciálne
anomálie (mikrocefália, mikrognátia, rázštep podnebia), malformácie končatín (polydaktýlia,
syndaktýlia druhého a tretieho prstu na nohe), anomálie genitálií, vnútorných orgánov, poruchy CNS,
rastová a mentálna retardácia. Pred objasnením biochemickej príčiny SLOS, väčšina autorov
rozdeľovala SLOS do dvoch kategórií, na základe závažnosti a početnosti anomálií: SLOS typu I,
ktorý bol charakteristický miernejším fenotypom a SLOS typu II, ktorý bol charakteristický
závažnejším fenotypom. Keďže medzi SLOS typu I a II je veľa medzistupňov, na hodnotenie fenotypu
sa používa aj skóre klinickej závažnosti (Bialer a kol., 1987; Cunniff a kol., 1997; Ryan a kol., 1998;
Kelley a Hennekam, 2000). Na základe tohto skóre sa fenotyp SLOS pacientov delí do troch kategórií:
mierny fenotyp (<20), klasický fenotyp (25-50), ťažký fenotyp (>50).
Celosvetová incidencia SLOS sa odhaduje v intervale 1:10 000 – 1: 60 000 s frekvenciou
heterozygotov 0,8 až 2%. Frekvencia SLOS v Európe sa odhaduje v intervale 1:15 000 – 1: 40 000.
Incidencia v SR sa odhaduje na 1:15 000 – 1:20 000.
Biochemickou príčinou SLOS je deficiencia 7-dehydrocholesterol reduktázy, ktorá katalyzuje
NADPH-závislú redukciu C7-8 dvojitej väzby 7-dehydrocholesterolu za vzniku cholesterolu v
poslednom kroku Kandutsch-Russell biosyntetickej dráhy cholesterolu. Výsledkom deficiencie 7DHCR aktivity sú abnormálne nízke hladiny cholesterolu v plazme a v tkanivách pacientov a na
druhej strane vysoká koncentrácia cholesterolových prekurzorov 7-DHC a 8-DHC. Deficitná aktivita
7-DHCR je spôsobená mutáciami v DHCR7 géne, ktorý je lokalizovaný na chromozóme 11q12-13.
Ľudský DHCR7 gén obsahuje 14 kbp genómovej DNA a je organizovaný do deviatich exónov a
ôsmych intrónov avšak kódujúca oblasť génu zahŕňa exóny 3 až 9. DHCR7 gén kóduje proteín so 475
aminokyselinami. 7-DHCR je integrálny membránový proteín, lokalizovaný v membráne ER resp.
mikrozómov. Do dnešnej doby je celkovo popísaných 121 rôznych mutácií v DHCR7 géne.
Dominantné zastúpenie majú substitučné mutácie meniace zmysel genetickej informácie (missense),
ktoré tvoria 87,6% z celkového počtu mutácií.
Mnohopočetné vrodené anomálie charakteristické pre SLOS, boli objasnené, keď sa zistilo, že
cholesterol hrá dôležitú úlohu v embryonálnom vývoji a morfogenéze stavovcov. Je zodpovedný za
46
správnu funkciu hedgehog signálnej dráhy, ktorá aktivuje promótory génov, potrebných pre
diferenciáciu tkanív v embryonálnom vývoji.
Materiál a metódy
Hodnoty celkového cholesterolu a 7-dehydrocholesterolu v sére pacientov sme stanovili
pomocou plynovej chromatografie spriahnutej s hmotovou spektrometriou. Hodnotu celkového
cholesterolu v sére sme stanovili aj pomocou BIO-LACHEMA-TESTU. Stanovenie je založené na
enzýmovom určení celkového cholesterolu.
Izolácia DNA z leukocytov periférnej krvi pomocou QIAamp DNA Mini Kit (QIAGEN).
Na amplifikáciu siedmych exónov DHCR7 génu sme použili metódu PCR. Jednotlivé exóny
sme amplifikovali za použitia primerov publikovaných v prácach Fitzky a kol. (1998) a Yu a kol.
(2000). 50 µl reakčná zmes obsahovala PCR tlmivý roztok (FINNZYMES) a výsledné koncentrácie
200 µmol/l dNTPs a 0,3 µmol/l primerov. Zmes ďalej obsahovala 1 U DNA polymerázy DyNAzyme
(FINNZYMES) a DNA približne v množstve 150 ng - 200 ng.
Časovo-teplotný profil amplifikácie jednotlivých exónov DHCR7 génu metódou PCR:
iniciálna denaturácia 95°C – 4 min., (denaturácia 95°C – 30 s, hybridizácia primerov 65°C – 30 s,
syntéza DNA 72°C - 30s) 30 cyklov, dosyntetizovanie PCR produktov 72°C – 10 min. PCR produkty
sme prečistili purifikáciou etanolom, kvantifikovali pomocou Mass Ruller (FERMENTAS)
a uskutočnili sekvenačnú reakciu pomocou ABI PRISM Big Dye Terminator v3,0 sequencing Ready
Reaction Kit. Automatické sekvenovanie prebehlo na ABI PRISM 310 Genetic Analyzer.
Reakčná zmes, v ktorej prebehlo štiepenie obsahovala 22 µl PCR produktu, 5 jednotiek AluI
restrikčnej endonukleázy a tlmivý roztok pre AluI restriktázu. Štiepenie sa dosiahlo inkubáciou vzorky
v termostate pri 37°C po dobu 16 hodín. Restrikčné fragmenty sme separovali v 2% agarózovom géli.
Elektroforéza prebehla pri 100 V 40 minút.
PCR prebieha za prítomnosti alelovo – špecifických primerov (Waye a kol., 2002) za
podmienok: iniciálna denaturácia 95°C – 4 min., (denaturácia 95°C – 45 s, hybridizácia primerov
68°C – 45 s, syntéza DNA 72°C - 45s) 30 cyklov, dosyntetizovanie PCR produktov 72°C – 10 min.
Výsledky a diskusia
Analyzovaný súbor tvorilo 12 pacientov s biochemicky diagnostikovaným Smith-LemliOpitzovým syndrómom. V sére pacientov sa merala hladina celkového cholesterolu dvoma metódami
– rutinnou enzýmovou metódou a GC/MS metódou a merala sa aj hladina 7 – DHC metódou GC/MS.
U všetkých pacientov sa potvrdila zvýšená hladina 7-DHC, kým hladina cholesterolu bola znížená,
ako je viditeľné z údajov v tabuľke 1. Hodnoty cholesterolu namerané enzýmovou metódou boli u
jednotlivých pacientov výrazne vyššie v porovnaní s hodnotami cholesterolu, ktoré sme namerali
pomocou GC/MS metódy. Hodnota cholesterolu meraná enzýmovou metódou je pravdepodobne
zvýšená v dôsledku prítomných prekurzorov, ktoré s činidlami dávajú pozitívnu reakciu. Stanovenie
cholesterolu enzýmovou metódou nie je teda vhodné, ak sú prítomné vo vysokých koncentráciách
prekurzory cholesterolu a diagnóza SLOS by sa nemala opierať iba o tento údaj. Koncentrácia 7-DHC
bola u zdravých jedincov v kontrolnom súbore na hranici detekovateľnosti, ale keďže je u pacientov
výrazne zvýšená, je tento parameter spoľahlivým ukazovateľom daného ochorenia. Hodnoty
cholesterolu v kontrolnom súbore (deti do dvoch rokov) sa pohybovali v rozmedzí 1,9 až 2,8 mmol/l
merané obidvoma metódami.
Tab. 1. Biochemické parametre SLOS pacientov.
47
U biochemicky potvrdených pacientov sme uskutočnili sekvenčnú analýzu siedmych exónov
DHCR7 génu. V súbore pacientov sme identifikovali tri rôzne mutácie v DHCR7 géne: nonssense
2mutáciu W151X a missense mutácie L109P a V326L. U slovenských pacientov v laboratóriu v Brne
identifikovali mutácie: R352Q, G410S.
Z celkového počtu 32 mutantných aliel sme v súbore identifikovali 54% aliel s mutáciou
W151X, 25% s mutáciou V326L, 9% s mutáciou L109P, 6% aliel s mutáciou G410S a 6% aliel
s mutáciou R352Q. Genotypy pacientov sú uvedené v tabuľke 2.
Tab. 2. Genotypy SLOS pacientov
Na rýchlu detekciu najfrekventovanejších mutácií sme využili metódy PCR-RFLP a Alelovo –
špecifickú PCR.
1
2
3
4
5
6
7
500
362 bp
282 bp
250
Obr. 1. Restrikčná analýza (AluI) mutácie W151X v exóne 6: Dráha 1, 2: homozygot pre divú alelu
(neštiepený fragment, 362 bp), dráhy 3, 4 heterozygot pre mutáciu W151X (restrikčné fragmenty 362
bp + 282 bp), dráhy 5, 6: homozygot pre mutáciu W151X (restrikčný fragment 282 bp) . Dráha 7:
marker molekulovej hmotnosti delený po 50 bp
4B
4A
3B 3A 2B 2A
250 bp
1
250
202 bp
Obr. 2. Alelovo – špecifická PCR pre mutáciu L109P v exóne 5. Genotypizácia jedinca je založená
na prítomnosti PCR produktu iba v jednej alebo v obidvoch reakciách. Pacient 2: homozygot pre
štandardnú alelu má PCR produkt prítomný jedine v reakcii slúžiacej na amplifikáciu štandardnej alely
génu (dráha 2A, PCR produkt o dĺžke 202 bp), Pacient 3: homozygot pre danú mutáciu má PCR
48
produkt v reakcii slúžiacej na amplifikáciu mutantnej alely (dráha 4B, PCR produkt o dĺžke 202 bp),
Pacient 1: heterozygot pre danú mutáciu, má PCR produkt v obidvoch reakciách (dráha 3A a 3B).
Kontrolný PCR produkt o dĺžke 250 bp je vo všetkých dráhach. 1: marker molekulovej hmotnosti.
1
2A
2B
3A
3B
241 bp
250
162 bp
Obr. 3. Alelovo – špecifická PCR pre mutáciu V326L v exóne 9. Pacient 4: homozygot pre
štandardnú alelu má PCR produkt prítomný jedine v reakcii slúžiacej na amplifikáciu štandardnej alely
génu (dráha 2A, PCR produkt o dĺžke 162 bp), Pacient 2: heterozygot pre danú mutáciu, má PCR
produkt v obidvoch reakciách (dráha 3A a 3B). Kontrolný PCR produkt o dĺžke 241 bp vo všetkých
dráhach. 1: marker molekulovej hmotnosti.
Závery
GC/MS analýza sterolov sa preukázala ako vysoko špecifická a spoľahlivá metóda na
biochemickú diagnostiku SLOS. Biochemická diagnostika je postavená na skutočnosti, že u zdravých
jedincov sú hodnoty 7-DHC nedetekovateľné zatiaľ, čo u postihnutých je tento metabolit v sére vždy
prítomný. Požadovaný cieľ, zaviesť vhodné molekulárno-genetické metódy na detekciu mutácií
v DHCR7 géne do bežnej klinickej praxe, sa podarilo splniť, čím sa CLG FNsP stalo pracovisko s
komplexnou diagnostikou SLOS v SR. Molekulárna analýza otvára možnosti diagnostiky SLOS
pacientov s veľmi miernym fenotypom a hraničnými biochemickými hodnotami, vylúči iné ochorenia
s podobným klinickým profilom ako SLOS a umožní reterospektívnu diagnostiku závažných
perinatálnych letálnych prípadov, kde nie je k dispozícii materiál na biochemickú analýzu.
V postihnutých rodinách môže byť užitočná pre genetické poradenstvo s možnosťou využitia pri
prenatálnej diagnostike. Mutácie zistené u SLOS pacientov na Slovensku sú typické pre strednú
Európu. Mutácia W151X je treťou a V326L piatou najfrekventovanejšou mutáciou z celého SLOS
mutačného spektra. W151X je najfrekventovanejšia v Českej republike a v Poľsku. Zavedením
restrikčnej analýzy a alelovo-špecifickej PCR najfrekventovanejších mutácií sme zjednodušili a
zrýchlili molekulárno-genetické vyšetrenie a diagnostiku SLOS.
Použitá literatúra
1. Bialer, M.G., Penchaszadeh, V.B., Kahn, E., et al.: Female external genitalia and mullerian duct derivates in a
46, XY infant with the Smith-Lemli-Opitz syndrome. Am J Med Genet. 28: 723–731, 1987.
2. Cuniff, C., Kratz, L.E., Moser, A., et al.: Clinical and biochemical spectrum of patients with RSH/SmithLemli-Opitz syndrome and abnormal cholesterol metabolism. Am J Med Genet. 68: 263–269, 1997.
3. Fitzky, B.U., Witsch-Baumgartner, M., Erdel, M., et al.: Mutations in the Delta7-reductase gene at 11q12-13
cause Smith-Lemli-Opitz syndrome. Proc Natl Acad Sci USA. 95: 8181–8186, 1998.
4. Kelley, R.I., Hennekam, R.C.M.: The Smith-Lemli-Opitz syndrome. J Med Genet. 37: 321–335, 2000.
5. Kelley, R.I., Herman, G.E.: Inborn errors of sterol biosynthesis. Rev Genomics Hum Genet. 2: 299–341, 2001.
6. Ryan, A.K., Barlett, K., Clayton, P., et al.: Smith-Lemli-Opitz syndrome: A variable clinical and biochemical
phenotype. J Med Genet. 35: 558–565, 1998.
7. Wassif, C.A., Yu, J., Cui, J., et al.: 27-Hydroxylation of 7- and 8-dehydrocholesterol in Smith-Lemli-Opitz
syndrome: a novel metabolic pathway. Steroids. 68: 497–502, 2003.
8. Waterham, H.R., Wanders, R.J.A.: Biochemical and genetic aspects of 7-dehydrocholesterol reductase and
Smith-Lemli-Opitz syndrome. Biochim Biophys Acta. 1529: 340–356, 2000.
9. Waterham, H.R., Wijburg, F.A., Hennekam, R.C.M., et al.: Smith-Lemli-Opitz syndrome is caused by
mutations in the 7-dehydrocholesterol reductase gene. Am J Hum Genet. 63: 329–338, 1998.
10. Waye, J.S., Nakamura, L.M., Eng, B., et al.: Smith-Lemli-Opitz syndrome: carrier frequency and spectrum
of DHCR7 mutations in Canada. J Med Genet. 39: E31, 2002.
11. Yu, H., Lee, M. H., Starck, L., et al.: Spectrum of Delta(7)-dehydrocholesterol reductase mutations in
patients with Smith-Lemli-Opitz syndrome. Hum Mol Genet. 9: 1385–1391, 2000.
49
Význam HPV v etiopatogenéze prekanceróz a karcinómu krčka maternice
Georgína Kolníková1, Vanda Repiská2, Peter Kolník1, Ľudovít Danihel3
1
Cytomed s.r.o. - Cytologické a bioptické laboratórium, Bratislava; 1Ústav lekárskej biológie a genetiky LF UK,
Bratislava; 2 Ústav patologickej anatómie LF UK a FN Sasinkova 4, 811 08 Bratislava
Abstrakt
Karcinóm krčka maternice je druhým najčastejším nádorom ženskej populácie.
Postihuje predovšetkým mladé ženy v produktívnom veku. Je to tretia najčastejšia príčina
úmrtia na nádorové ochorenie u žien. Celosvetovo je približne 471 000 nových prípadov
a 270 000 úmrtí ročne. 80 % úmrtí je v rozvojových krajinách. Na Slovensku zomrie na toto
ochorenie približne 500 žien za rok. Predpokladá sa, že vo svete, do roku 2020 bude
diagnostikovaných každý rok viac ako 1 milión nových prípadov. Hlavným etiologickým
faktorom vo vývoji nielen squamocelulárnych karcinómov, ale aj adenokarcinómov krčka
maternice je perzistujúca infekcia s vysokorizikovým typom ľudského papilloma vírusu .
Úvod
Papilloma vírusy sú druhovo a tkanivovo špecifické. Bolo objavených viac než sto typov.
Podľa onkogénneho potenciálu ich delíme na vysoko a nízko rizikové typy. Klinicky ich môžeme
deliť na mukokutánne typy (môžu spôsobiť kožné bradavice, laryngeálne papilómy), tzv.
epidermodysplasia verruciformis (prvý krát popísali onkogénny potenciál HPV vírusu, na podklade
tohto ochorenia, môže vzniknúť squamocelulárny karcinóm) a 40 má anogenitálny biotropizmus.
Tvoria samostatnú čeľaď Papillomaviridae. Patria medzi relatívne malé vírusy, kapsida s priemerom
asi 55 nm je tvorená 72 penta- alebo hexavalentnými kapsomérami, ktoré sú formované v
ikosahedrálnej kapside. Ich genóm tvorí 1 molekula cirkulárnej DNA, ktorá obsahuje gény pre včasné
(early, E, Tab. 1) a neskoré (late, L) proteíny, ďalej tzv. nekódujúcu oblasť (LCR, URR) s
regulačnými sekvenciami. Proteíny exprimované z včasných génov iniciujú začiatok replikácie
vírového genómu v bunke (E1, E2) a môžu sa podieľať na malígnej transformácii buniek (E6, E7).
Gény L1 a L2 kódujú majoritný a minoritný kapsidový proteín, majú schopnosť vytvoriť tzv. vírusu
podobné čiastočky (virus like particles), ktoré neobsahujú genóm – sú teda neinfekčné. Táto
skutočnosť zohrala veľkú úlohu vo výskume a vývoji vakcín.
E1 – viaže sa na nekódujúcu regulačnú oblasť v protismere od promótora skorého génu E6/E7.
Asociuje s histónom H1 a s cyklínom E.
E2 – potláča expresiu génov E6/E7 pri produktívnej infekcii. Indukuje apoptózu.
E3- funkcia neznáma.
E4- napomáha uvoľňovaniu viriónov.
E5- aktivuje bunkové faktory transkripcie.
E6 (16-18 kDa)- viaže tumorsupresorový proteín p53 a urýchľuje jeho degradáciu ubiquitínom,
najrýchlejšie HPV 16 a HPV 18.(Tieto typy sú zodpovedné za viac ako 70% karcinómov krčka
maternice). Degraduje bunkové regulačné proteíny c-Myc, DLG a McM7.
E7 (10-14 kDa) viaže proteín Rb a jemu príbuzné bunkové proteíny, ktoré inhibujú proliferáciu buniek. Viaže signálny
proteín c-Jun a inhibuje expresiu inhibítorov cyklín dependentných kináz, čím stupňuje pravdepodobnosť proliferácie
hostiteľskej bunky.
Tab. 1. Skoré štruktúrne proteíny kódované papilomavírusmi
HPV infikuje len mitoticky aktívne bunky bazálneho epitelu. Najčastejším miestom infekcie je
transformačná zóna krčka maternice (miesto prechodu jednovrstvového cylindrického epitelu na
viacvrstvový nerohovatejúci dlaždicovitý epitel). Vstup do bunky sa uskutoční väzbou na špecifický
glykoproteínový receptor 64 integrín exprimovaný na povrchu buniek bazálnej epiteliálnej vrstvy.
Ďalší vývoj infekcie je možný dvoma smermi:
- produktívny – dôjde k syntéze zrelých infekčných čiastočiek, s charakteristickým cytopatickým
znakom (koilocyty), morfológia LG-SIL, genetická stabilita, E6/E7 expresia v zrelých bunkách.
- neproduktívny – genetická instabilita, aneuploidia, proliferácia hostiteľských buniek, E6/E7 expresia
v nezrelých bunkách a morfológia HG-SIL.
Väčšina infekcií má tranzientný charakter. Malígna transformácia nastáva pri perzistujúcej
infekcii, ak sa vírusový genóm integruje do genómu hostiteľskej bunky do náhodného
50
(nehomologického, sekvenčne špecifického) miesta a pri expresii onkoproteínov E6 a E7. Onkogénna
transformácia sa deje interakciou E6 a E7 onkogénnych proteínov vírusu HPV s regulačnými
proteínmi epitelových buniek. Onkoproteín pE6 viaže tumorsupresorový proteín p53, čo vedie k
jeho ubiquitínom sprostredkovanej degradácii. Onkoproteín E7 viaže nefosforylovanú formu
tumorsupresorového proteínu pRb a spôsobuje jeho hyperfosforyláciu a následnú aktiváciu N-myc
a c-myc onkogénov. Následkom toho dôjde k nekontrolovanej proliferácii bunky, genómovej
instabilite a k nahromadeniu onkogénnych mutácií (napr. delécia 3p, strata heterozygozity 6q, 10 p
atď). Vznik neoplastického procesu môže trvať 10 až 12 rokov. Ak onkosupresorové gény sú a priori
poškodené (napr. Li-Fraumeni syndróm – zdedená mutácia génu p 53) výskyt karcinómu je 25 x krát
vyšší do 50 roku veku ako u bežnej populácii. Dysplastické zmeny (prednádorové stavy) krčka
maternice sa týkajú takmer výhradne metaplastického epitelu transformačnej zóny. Sú
charakterizované jednak cytomorfologickými zmenami (anizokaryóza, atypické mitózy, zvýšenie
pomeru jadra k cytoplazme atď), jednak zmenami architektoniky (porucha stratifikácie, ktorá
pripomína rozšírenie bazálnej vrstvy). Dysplázie môžeme deliť na ľahké (syn. CIN I, LG-SIL), stredné
(syn. CIN II, HG- SIL), ťažké a carcinoma in situ (syn. CIN III, HG-SIL ). Dysplastické zmeny vďaka
imunitnému systému môžu regredovať. Ak imunitný systém je z nejakého dôvodu oslabený ( napr.
posttransplantačné stavy, infekcia HIV, imunosupresia z akéhokoľvek dôvodu ) výskyt karcinómu je
oveľa pravdepodobnejší.
Detekcia HPV DNA
V rutinnej praxi sa používajú dve základné metódy detekcie HPV. Metóda založená na
priamej hybridizácii HPV – v tomto mikrodoštičkovom teste sa denaturuje HPV DNA pacientky.
Pridá sa k zmesi jednovláknových špecifických HPV RNA sond. V miestach, ktoré sú
komplementárne vznikajú hybridné DNA/RNA molekuly, tie sa napoja na špecifické anti DNA/RNA
protilátky zakotvené na pevnej fáze (povrch jamky mikrotitračnej doštičky). Detekcia sa robí
chemoluminiscenčne, značené monoklonálne protilátky sa viažu na viacerých miestach hybridnej
molekuly, čím sa signál zosilní. V sete sa nachádza zmes sond pre 5 typov LR HPV (6, 11, 42, 43 a
44) a 13 typov HR HPV (16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59 a 68), pričom niektoré typy HPV
sa v sete nenachádzajú, čo môže vytvoriť skríženú reaktivitu, čo je nevýhodou tejto metódy. Táto
metóda umožňuje veľmi rýchlo zistiť prítomnosť alebo neprítomnosť HPV v analyzovanej vzorke, nie
typ HPV. Metóda založená na amplifikácii signálu HPV, pri ktorej je úsek HPV DNA je namnožený
polymerázovou reťazovou reakciou (PCR). V ďalšom kroku je na zvýšenie špecifity a na určenie typu
HPV použitá hybridizácia. K imobilizovaným typovo špecifickým sondám sa pridáva značený PCR
produkt, ktorý je následne detekovaný reakciou s farebným substrátom. PCR diagnostika umožňuje
rýchlo a veľmi spoľahlivo zistiť prítomnosť konkrétneho typu infekčného agens. Výhodou je, že sú
dostupné kompletné amplifikačné súpravy pre PCR, ktoré obsahujú pozitívnu a negatívnu kontrolu,
čím sa zároveň zabezpečí kontrola priebehu samotnej PCR reakcie (268 bp dlhý fragment génu pre ßglobín). Súprava AMPLICOR HPV je určená na genotypizáciu. Detekuje 13 vysoko-rizikových typov
ľudských papillomavírusov 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59 a 68. Postup je nasledovný:
izolácia DNA pomocou kitu Qiagen, množenie DNA metódou PCR (fragment z vysoko
konzervovanej oblasti génu L1 HPV s veľkosťou 165 bp, pričom primery sú značené biotínom),
hybridizácia PCR produktov s oligonukleotidovými sondami a kolorimetrické stanovenie produktov.
Výhodou metód molekulárnej biológie je vysoká senzitivita – umožňuje zistiť aj latentnú
infekciu a tým aj pravdepodobnosť vzniku karcinómu.
Použitá literatúra
1. Baseman, J., Koutsky, L.: The epidemiology of human papillomavitrus infections. J Clin Virol. 32: S16–S24,
2005.
2. Boyle, P., Ferlay, J.: Cancer incidence and mortality in Europe. Ann Oncol. 16: 481–488, 2005.
3. Bosch, F.X., Lorincz, A., Munoz, N., et al.: .The causal relation between humanpapillomavirus and cervical
cancer. J Clin Pathol. 55: 244–265, 2002.
4. Franco, E.L., Franco, E.D., Ferenczy A.: Cervical cancer: epidemiology, prevention and the role of human
papillomavirus infection. Can Med Assoc J. 164(7): 1017–25, 2001.
5. Rajčáni, J., Čiampor, F. : Čelaď Papillomaviridae. In: Lekárska virológia, VEDA, Bratislava. 324–335, 2006.
6. Snijders, P., Steenbergen, R., Heideman, D., Meijer, C.J.: HPV-mediated cervical carcinogenesis: concepts
and clinical implications. J Pathol. 208: 152–164, 2006.
51
Ultraštruktúrne zmeny indukované alkoholom v mozočku potkana po génovej terapii
Martin Kopáni1, Michal Behuliak2, Peter Celec2, Ivan Varga3, Miriam Petrová4, Štefan Polák3
Univerzita Komenského v Bratislave, Lekárska fakulta, 1Ústav patologickej anatómie; 2Ústav patologickej
fyziologie; 3Ústav histológie a embryológie; 4Farmakologický ústav, Bratislava, Slovenská Republika,
[email protected]
Abstrakt
Centrálny nervový systém je obzvlášť citlivý na toxický účinok alkoholu. Cieľom
práce je vyšetrovanie vplyvu dlhodobého podávania alkoholu na ultraštruktúru mozočka
potkana po podaní génovej terapie. Nami pripravená a aplikovaná antioxidačná terapia
nemala protektívne účinky na alkoholom indukované poškodenie mozočka. Podávanie SOD
vo forme plazmidovej DNA spôsobilo patologické zmeny v ultraštruktúre mitochondrií a
myelínových pošiev nervových vlákien. Predpokladáme, že nastáva buď izolované zvýšenie
aktivity SOD bez adekvátneho zvýšenia aktivity katalázy prípadne glutatión peroxidázy alebo
zmena koncentrácie minerálnych látok v stratum granulosum mozočka potkana s následnou
peroxidáciou lipidov. Ďalšie plánované experimenty budú zamerané na využitie
kombinovaného prístupu antioxidačnej génovej terapie s využitím superoxid dismutázy a
katalázy.
Úvod
Dlhodobé užívanie alkoholu má nepriaznivý účinok na štruktúrne, chemické a fyzikálne
vlastnosti buniek (Clarren et al., 1978). Centrálny nervový systém je obzvlášť citlivý na toxický
účinok alkoholu. Alkoholom indukované zmeny morfológie dendritov u potkanov študovali v rannom
období vývoja (Tavares et al. 1983), v neskoršom období vývoja (Abel et al. 1983) a vo vyššom veku
(Pentney, 1982).
Štruktúra a tvar mitochondrií sa prispôsobujú vonkajším podmienkam. Mitochondrie pri
intoxikácii etanolom sa u potkanov menia aj morfologicky (Porta et al. 1965) aj funkčne (Cederbaum
et Rubin, 1975). Zmeny v štruktúre mitochondrií sa prejavujú zmenou ich funkcie (Wakabayashi,
1999, Wakabayashi et Karbowski, 2001). Cieľom práce je vyšetrovanie vplyvu dlhodobého podávania
alkoholu na ultraštruktúru mozočka potkana po podaní génovej terapie.
Materiál a metódy
Potkany kmeňa Wistar (n=27) boli náhodne rozdelené do 4 skupín: 1. kontrolná skupina
(CTRL), 2. skupina alkohol (ALC), 3. skupina dismutáza superoxidu (SOD), 4. skupina alkohol +
SOD (ALC + SOD). Potkany boli kŕmené ad libitum štandardnou stravou a dostávali buď destilovanú
vodu (CTRL, SOD) alebo roztok alkoholu (ALC, ALC + SOD) namiesto pitnej vody počas doby 28
dní. Koncentrácia etanolu postupne každý týždeň stúpala (5, 10, 15, 20%). Konzumácia alkoholu bola
denne sledovaná počas celej doby štúdie. Plazmid pcDNA3 kódujúci gén pre mitochodriálnu
superoxid dismutázu Mn-SOD (300µg v 100µl fyziologického roztoku; skupiny SOD, ALC + SOD)
alebo rovnaký objem fyziologického roztoku (skupiny CTRL, ALC) bol aplikovaný intramuskulárne
do musculus biceps femoris ľavej zadnej končatiny jeden krát týždenne. Na konci štúdie boli potkany
usmrtené dekapitáciou v celkovej anestéze. Vzorky stratum granulosum potkana sme pre transmisnú
elektrónovú mikroskopiu (TEM) spracovali imerznou fixáciou 0.299 mol.l-1 roztokom glutaraldehydu
(Serva) tlmeného fosfátmi, pH 7,2 – 7,4; 2 hodiny. Po prepláchnutí tlmivým roztokom nasledovala
OsO4 postfixácia (0.0393 mol.l-1, tlmený fosfátmi, pH 7,2 – 7,4; 1 hodinu). Po odvodnení tkaniva
v alkohole so stúpajúcou koncentráciou sme tkanivá zaliali do Durcupanu ACM (Fluka) spôsobom,
ktorý odporúča výrobca. Ultratenké rezy boli zhotovené ultramikrotómom Om U 3 (Reichert). Rezy
na podložných sieťkach bez podložných blán sme kontrastovali uranylacetátom a citrátom olova
(Serva). Dokumentácia bola urobená transmisným elektrónovým mikroskopom CM 100 (Philips,
Holansko) pri urýchľovacom napätí 40 kV.
52
Výsledky a diskusia
V skupine ALC + SOD pozorujeme myelínové pošvy, ktoré sú ložiskovo rozvláknené, občas
sa na obvode vlákna strácajú (obr. 1). Vo vláknach vidno profily malých guľatých mitochondrií, rôzne
nepočetné vezikuly ohraničené jednoduchou hladkou membránou, ojedinelo stredne husté malé zrná.
Niektoré mitochondrie sú značne napučané. Škvrnité prejasnenia v myelínových pošvách. Občas
drobné vezikuly vo vrstve myelínových vlákien.
Obr. 1. Potkan, mozoček, stratum granulosum. Myelínová pošva so štrbinovými prejasneniami
ihlicového tvaru. Ojedinelé profily hladkého ER, zväčša kolabované. V okolitej cytoplazme sú veľké
mitochondrie s rôzne veľkými hustými telieskami.
V skupine ALC + voda vidíme myelínové pošvy občas rozvláknené s lokálnym prejasnením.
Prejasnení je vidno oveľa menej ako v predchádzajúcej skupine. Jemne zrnitá cytoplazma obsahuje
jednoduchou membránou ohraničenú vakuolu a denzné telieska. Časté napučané mitochondrie
oválneho až tubulového tvaru zrnitej štruktúry. Nápadne jasný matrix mitochodrialis. Nápadné riedke
kristy. Iné mitochondrie sú pretiahnutého tvaru, s hustým matrixom a hustejšími kristami.
V skupine voda + SOD pozorujeme jadrá hladkého, občas málo zvlneného povrchu.
Roztrúsený (dispergovaný) chromatín má prevahu nad kondenzovaným, zväčša nasadajúcim na
jadrový obal (obr. 2). Miestami jadrové póry. Občas vidno jednoduché jadrové telieska.
Obr. 2. Potkan, mozoček, stratum granulosum. Jadrá miestami s kondenzovaným chromatínom pri
jadrovom obale. Roztrúsený (dispergovaný) chromatín má prevahu nad kondenzovaným, zväčša
nasadajúcim na jadrový obal. Miestami jadrové póry. Občas vidno jednoduché jadrové telieska.
53
Voľné radikály vznikajúce metabolizmom alkoholu hrajú dôležitú úlohu pri vytváraní
zväčšených a poškodených mitochondrií. Zväčšené, napučané mitochondrie sme pozorovali vo
všetkých skupinách okrem kontrolnej skupiny. Mitochondrie sa zúčastňujú na znižovaní množstva
intracelulárnych kyslíkových radikálov pri oxidačnom strese znížením spotreby kyslíka. Pritom
dochádza k tvorbe zväčšených mitochondrií. V niektorých prípadoch môže dochádzať k tvorbe
megamitochondrií (Karbowski et al, 1999, Wakabayashi, 2001).
Okrem poškodených a zväčšených mitochondrií sme v tých istých skupinách zistili
poškodenie myelínu nervových vlákien v stratum granulosum mozočka potkanov. Z pozorovaných
výsledkov poškodenia mitochondrií a myelínových pošiev nervových vlákien v stratum granulosum
mozočka potkana predpokladáme dve možnosti: a) aplikovaná antioxidačná terapia spôsobovala
ultraštruktúrne zmeny v dôsledku izolovaného zvýšenie aktivity SOD bez adekvátneho zvýšenia
aktivity katalázy alebo glutatión peroxidázy, enzýmov, ktoré detoxifikujú produkt dismutácie
superoxidu – peroxid vodíka b) ultraštruktúrne zmeny boli spôsobené zmenou koncentrácie
minerálnych látok v stratum granulosum mozočka potkana s následnou peroxidáciou lipidov. Do
úvahy prichádza aj kombinácia týchto dvoch javov.
Závery
Nami pripravená a aplikovaná antioxidačná terapia nemala protektívne účinky na alkoholom
indukované poškodenie mozočka. Naviac, aj samotné podávanie SOD vo forme plazmidovej DNA
spôsobilo patologické zmeny v ultraštruktúre mitochondrií a myelínových pošiev nervových vlákien.
Tento výsledok indikuje, že nastáva buď izolované zvýšenie aktivity SOD bez adekvátneho zvýšenia
aktivity katalázy prípadne glutatión peroxidázy alebo zmena koncentrácie minerálnych látok v stratum
granulosum mozočka potkana s následnou peroxidáciou lipidov. Ďalšie plánované experimenty budú
zamerané na využitie kombinovaného prístupu antioxidačnej génovej terapie s využitím superoxid
dismutázy a katalázy.
Poďakovanie
Táto práca bola podporovaná Agentúrou na podporu vedy a vývoja APVT-20-003104.
Použitá literatúra
1. Abel, E.L., Jacobson, S., Sherwin B.T.: In utero alcohol exposure: Functional and structural brain damage.
Neurobehav Toxicol Teratom. 5(3): 363–366, 1983.
2. Cederbaum A.I., Rubin E.: Molecular injury to mitochondria produced by ethanol and acetaldehyde. Fed Proc.
34(11): 2045–2051, 1975.
3. Clarren, S.K., Alvord, A.C., Sumi, S.M., Streissguth, A.P., Smith, D.W.: Brain malformations related to
prenatal exposure to ethanol, J Pediatr. 92(1): 64–67, 1978.
4. Karbowski M, Kurono C, Wozniak M, Ostrowski M, Teranishi M, Nishizawa Y, Usukura J, Soji T,
Wakabayashi T.Free radical-induced megamitochondria formation and apoptosis. Free Radic Biol Med. 26(3–
4): 396–409, 1999.
5. Pentney, R.J.: Quantitative analysis of ethanol effects on the Purkinje cell dendritic tree. Brain Res. 249(2):
397–401, 1982.
6. Porta E.A., Hartroft W.S., De la Iglesia F.A.: Hepatic changes associated with chronic alcoholism in rats. Lab
Invest. 14(8): 1437–1455, 1965.
7. Tavares, M.A., Paula-Barbosa, M.M., Gray, E.G.: A morphometric Golgi analysis of the Purkinje cell
dendritic tree after long-term, alcohol consumption in the adult rat. J Neurocytol. 12(6): 939–948, 1983.
8. Wakabayashi T.: Structural changes of mitochondria related to apoptosis: swelling and megamitochondria
formation. Acta Biochim Polon. 46(2): 223–237, 1999.
9. Wakabayashi T., Karbowski M. Structural changes of mitochondria related to apoptosis. Biol Signals Recept.
10(1–2): 26–56, 2001.
54
Identifikácia proteínu PCNA v karcinóme endometria
Martin Kopáni1, Ľuboš Danišovič2, Dimitris Hatzibougias3, Martin Wawruch4, Dalibor
Hojsík5, Michal Korman6, Bohuslav Uher7,8, Roman Moravčík9, Juraj Bugala9, Marek
Bučko10, Lívia Hlavačková1, Alexandra Krištúfková1
1
Ústav patologickej anatómie; 2Ústav lekárskej biológie a genetiky; 4Farmakologický ústav; 5Ústav súdneho
lekárstva; 6Ústav telesnej výchovy a športu, Lekárska fakulta, Univerzita Komenského v Bratislave; 3Department
of Pathology, Medical School, Aristotle University, Thessaloniki, Greece; 7Katedra botaniky, Prírodovedecká
fakulta, Univerzita Komenského v Bratislave; 8Ústav botaniky a zoologie, Přírodovědecká fakulta, Masarykova
Univerzita v Brne, Česká republika; 9Prírodovedecká fakulta, Univerzita Komenského v Bratislave, Slovenská
republika; 10Oddelenie glykobiotechnológie, Chemický ústav, Centrum glykomiky, Slovenská akadémia vied,
Bratislava, Slovenská republika, [email protected]
Abstrakt
Spolu 40 vo formalíne fixovaných a do parafínu zaliatych bioptických tkanivových
vzoriek s endometrioidným G1 (ECG1, 10) a G3 (ECG3, 10), seróznym (SC, 10) a
svetlobunkovým (SvC, 10) karcinómom endometria (CaE) sme vyšetrili imunohistochemicky
na expresiu proteínu PCNA v jadrách epitelových buniek žliazok endometria. Expresia PCNA
bola vysoká a zásadne sa v jednotlivých histologických podtypoch a stupňoch CaE nelíšila,
pričom najvyššia expresia PCNA bola u agresívnych (SC, SvC a ECG3) typov CaE. Proteín
PCNA nie je vhodným markerom na rozlišovanie jednotlivých histologických podtypov CaE.
Úvod
Výrazne stúpajúci výskyt zhubných nádorov tela maternice žien (American Cancer Society
2000, Jemal et al. 2005, Pleško et al. 1994, Pleško et al. 2003, Redecha et al. 2004) je predmetom
záujmu odborníkov z rôznych vedných odborov. Sú to onkológovia, gynekológovia (Redecha et al.
1996, 2004, 2005, Šuška a Holomáň 1997, Šuška 2003), molekuloví biológovia a genetici
(Weismanová et al. 2002, Repiská et al. 2003, Molnárová et al. 2006), patológovia (Deligdisch a
Cohen 1985, Robboy et al. 1988, 2002, Danihel et al. 1995, 2002, 2003, 2005, Danihel a Breitenecker
1997, Silverberg et al. 2003, Šišovský et al. 2004, 2006a, 2006b, 2006c, 2006d, 2006e, 2007a, 2007b,
2007c, 2007d, Šišovský 2005, Gomolčák et al. 2005, Budaj a Bučeková 2007a,b).
Karcinóm endometria (CaE) je najčastejšia invázna neoplázia ženského pohlavného traktu, 4.
najčastejšie diagnostikovaný karcinóm v Spojených štátoch amerických a celosvetovo 5. najčastejší
karcinóm u žien (American Cancer Society 2000, Ronnett et al. 2002, Jemal et al. 2005).
Imnunohistochemická analýza je veľakrát jedným z rozhodujúcich faktorov stanovenia diagnózy a
prognózy nádorovej choroby a výrazne ovplyvňuje jej liečbu (Danihel a Porubský 1991, Danihel et al.
1995, Azumi a Czernobilsky 2002).
Antigén jadier proliferujúcich buniek (PCNA) je proteín spojený s proliferáciou buniek.
Vzniká v neskorej G1 fáze, s vrcholom v S a zotrváva v G2 a M fáze bunkového cyklu (BC)
(Kallakury et al. 1998). Je kofaktorom DNA polymerázy δ (Lee a Hurwitz 1990), kľúčový v syntéze
DNA v S fáze BC, počas reparácie DNA (Shivji et al. 1992), v replikácii DNA a v regulovaní
progresie BC (Rao et al. 1991).
Identifikácia zmien expresie PCNA v epitelových bunkách žliazok imunohistochemicky (IHC)
v korelácii s morfologickým nálezom pri CaE.
Materiál a metódy
Spolu 40 bioptických vzoriek endometria (z archívu Ústavu patologickej anatómie LF UK v
Bratislave) z materníc po kyretáži alebo hysterektómii (pre krvácanie z maternice alebo nádor zistený
sonografiou) boli zahrnuté v tejto štúdii. Vo formalíne fixované a do parafínu zaliate tkanivové vzorky
s endometrioidným (EC) G1 (ECG1, 10x) a G3 (ECG3, 10x) (od žien vo veku 31-61 r.), seróznym
(SC, 10x) (39-86 r.) a svetlobunkovým (SvC, 10x) (60-86 r.) CaE sme vyšetrili IHC na expresiu
PCNA v jadrách epitelových buniek žliazok endometria. Komplex avidínu a biotínu s peroxidázou
(ABC-Px) a s diaminobenzidínom (DakoCytomation, Glostrup, Denmark) sme použili na
vizualizovanie reakčného produktu. Nálezy sme hodnotili svetelným mikroskopom (Nikon Coolpix
990, Tokyo, Japonsko) semikvantitatívne ako: „-“ negatívne, „+/-“ nepravidelne slabo pozitívne (do
55
5% buniek), „+“ pravidelne slabo pozitívne (> 5% a < 25% buniek), „++“ pravidelne stredne silne
pozitívne (25% až 50% buniek), „+++“ pravidelne silne pozitívne (> 50% buniek).
Výsledky a diskusia
Expresia PCNA bola vysoká a zásadne sa v jednotlivých histologických podtypoch a stupňoch
CaE nelíšila (obr. 1, 2 a 3), pričom najvyššia miera expresie PCNA súvisela s agresívnym (SC, SvC a
ECG3) (obr. 2 a 3) typom CaE (tab. 1).
Stav endometria
Reakci protilátky proti PCNA
Endometrioidný karcinóm endometria, G1 ++ až +++
Endometrioidný karcinóm endometria, G3 +++
Serózny karcinóm endometria
+++
Svetlobunkový karcinóm endometria,
+++
Tab. 1. Prehľad reakcií protilátky proti PCNA s jadrami epitelových buniek žliazok karcinómu
endometria ľudí.
Reakcia: − negatívna, +/− nepravidelne slabo pozitívna, + pravidelne slabo pozitívna, ++ pravidelne
stredne silne pozitívna, +++ pravidelne silne pozitívna.
Obr. 1. Detekcia PCNA v ECG1. Komplex streptavidínu a biotínu s peroxidázou (ABC-Px), 200x.
Obr. 2. Pravidelná silne pozitívna expresia PCNA v ECG3. ABC-Px, 200x.
Obr. 3. Pravidelná silne pozitívna expresia PCNA v SC. ABC-Px, 100x.
Naše výsledky ukazujú dobrú koreláciu expresie PCNA s histologickým podtypom a stupňom
diferencovania CaE a sú v zhode s inými publikovanými prácami, ktoré hodnotili validitu PCNA.
Elhafey et al. (2001) sledovali expresiu PCNA v EC, v SC a v SvC. Tvrdia, že v EC expresia
PCNA koreluje s jeho stupňom histologickej diferenciácie a je nižšia než v agresívnych (SC a SvC)
podtypoch CaE - so zlou prognózou. Chen et al. (2001) zistili, že CaE so zlou diferenciáciou alebo v
pokročilom klinickom štádiu majú vyššiu expresiu PCNA a sú agresívneho fenotypu, a že expresia
PCNA spojená s expresiou ESR/PGR má značnú hodnotu v ich prognóze. Tieto zistenia sú do určitej
56
miery podobné s našimi výsledkami, ktoré ukazujú mierne stúpanie expresie PCNA so stupňom
histologickej diferenciácie EC a najvyššiu expresiu PCNA v ECG3, v SC a v SvC, pričom expresia
PCNA bola v týchto troch stavoch silná a rovnaká. Expresiu ES1R a PGR sme nezisťovali.
Naše zistenia podporujú výsledky Budaja a Bučekovej (2007a,b), ktorí hodnotili expresiu
PCNA v CaE. Ich výsledky ukázali pravidelne silne pozitívnu expresiu PCNA v ECG3, SC a SvC.
Tiež nezistili zásadnú odlišnosť v expresii PCNA medzi ECG1 a ECG3, kde expresia PCNA bola
vysoká.
Závery
Proteín PCNA nie je vhodným rozlišovacím znakom jednotlivých histologických podtypov
CaE.
Poďakovanie
Štúdia podporená GUK/36/2007. Autori ďakujú za podporu a pomoc pri hodnotení
mikroskopických preparátov Prof. MUDr. Ľ Danihelovi, PhD. a MUDr. V. Šišovskému, PhD., a za
technickú spoluprácu p. I. Uhnavej. Mikrofotografie pochádzajú z Ústavu patologickej anatómie LF
UK v Bratislave.
Použitá literatúra
1. American Cancer Society: 2000 cancer statistics. CA Cancer J Clin. 50: 1–64, 2000.
2. Azumi, N., Czernobilsky, B.: Immunohistochemistry. In: Kurman, R.J. (Ed): Blaustein´s Pathology of the
Female Genital Tract. 5th Edn. Springer – Verlag, New York. 1251–1276, 2002.
3. Budaj, M., Bučeková, B., Šišovský, V., Danihel, Ľ.: Identifikácia markerov proliferačnej aktivity v karcinóme
endometria. 46. fakultná konferencia ŠVOČ. Zborník prác, LF UK a SAP, Bratislava. 22–25, 2007a.
4. Budaj, M., Bučeková, B., Šišovský, V., et al.: Identification of proliferation markers in correlation with p53
gene mutation in endometrial carcinoma. Vědecká konference studentů českých a slovenských lékařských
fakult. Program a abstrakta prednášek, 3. lékařská fakulta Univerzity Karlovy v Praze. 2007b.
5. Danihel, Ľ., Porubský, J.: Prínos monoklonálnych protilátok v bioptickej diagnostike nádorov. Bratisl lek
Listy. 92: 460–466, 1991.
6. Danihel, Ľ., Breitenecker, G.: Histologická diagnostika nenádorových a nádorových zmien endometria v peria postmenopauze. In: Šuška, P., Holomáň, K. (Eds): Endometrium v peri- a postmenopauze. SAP, Bratislava.
14–41, 1997.
7. Danihel, Ľ., Babál, P., Porubský, J., et al.: Imunohistochemické markery v diagnostike nádorov maternice.
Bratisl lek Listy. 96: 353–360, 1995.
8. Danihel, Ľ., Gomolčák, P., Korbeľ, M., et al.: Expression of proliferation and apoptotic markers in human
placenta during pregnancy. Acta Histochem. 104: 335–338, 2002.
9. Danihel, Ľ., Horváth, R., Breitenecker, G., Hatzibugias, I.: Súčasná klasifikácia a charakteristika nádorov
endometria. Slov gynek por. 10(Suppl): 14–17, 2003.
10. Danihel, Ľ., Šišovský, V., Palkovič, M., et al.: Karcinóm endometria – histopatologická klasifikácia a
charakteristika. Gynekol prax. 3: 9–12, 2005.
11. Deligdisch, L., Cohen, C.J.: Histologic correlates and virulence implications of endometrial carcinoma
associated with adenomatous hyperplasia. Cancer. 56: 1452–1455, 1985.
12. Elhafey, A.S., et al.: Computerized image analysis of p53 and proliferating cell nuclear antigen expression in
benign, hyperplastic, and malignant endometrium. Arch Pathol Lab Med. 125: 872–879, 2001.
13. Gomolčák, P., Danihel, Ľ., Šišovský, V.: E-cadherin, a-inhibin a calponin – biologicky aktívne látky
v štruktúrach trofoblastu. Lojdov histochemický deň. Slovenská histochemická spoločnosť, Ústav patologickej
anatómie LF UK, Výskumný ústav srdca SAV. Abstrakty, Bratislava. 8, 2005.
14. Chen, Y.P., Shen, M., Chen, C.: Study on expression of PCNA and estrogen, progesterone receptors in
endometrial carcinoma. Hunan Yi Ke Da Xue Xue Bao. 26: 123–125, 2001.
15. Jemal, A., Murray, T., Ward, E., et al.: Cancer statistics. CA Cancer J Clin. 55: 10–30, 2005.
16. Kallakury, B.V., Ambros, R.A., Hayner-Buchan, A.M.: Cell proliferation-associated proteins in endometrial
carcinomas, including papillary serous and endometrioid subtypes. Int J Gynecol Pathol. 17: 320–326, 1998.
17. Lee, S.H., Hurwitz, J.: Mechanism of elongation of primed DNA by DNA polymerase delta, proliferating
cell nuclear antigen, and activator 1. Proc Natl Acad Sci USA. 87: 5672–5676, 1990.
18. Molnárová, A., Kováčová, E., Majtán, J., et al.: Chlamydia and mycoplasma infections during pregnancy and
their relationships to orofacial cleft. Biologia. 61: 719–723, 2006.
19. Pleško, I., et al: Incidencia zhubných nádorov v Slovenskej republike v roku 1990. Aktual klin Onkol. 1994.
20. Pleško, I., et al: Incidencia zhubných nádorov v Slovenskej republike 2000. Národný onkologický ústav,
Ústav experimentálnej onkológie SAV, Národný onkologický register Slovenskej republiky, Bratislava. 207,
2003.
57
21. Rao, V.V., Schnittger, S., Hansmann, I.: Chromosomal localization of the human proliferating cell nuclear
antigen (PCNA) gene to or close to 20p12 by in situ hybridization. Cytogenet Cell Genet. 56: 3–4, 169–170,
1991.
22. Redecha, M., Korbeľ, M., Sasko, A.: Histologické nálezy endometria pri krvácaní v klimaktériu a séniu.
Prakt Gynek. 3: 61–64, 1996.
23. Redecha, M., Nižňanská, Z., Korbeľ, M.: Výskyt zhubných nádorov tela maternice na Slovensku v rokoch
1990-2000. Gynekol prax. 2: 194–199, 2004.
24. Redecha, M., Nižňanská, Z., Korbeľ, M.: Klinická charakteristika karcinómu endometria. Gynekol prax. 3:
13–16, 2005.
25. Repiská, V., Zummerová, A., Miklóši, M., et al.: Využitie metódy RT-PCR pri detekcii cirkulujúcich
mikrometastáz. Rozhledy v chirurgii. 82: 95–102, 2003.
26. Robboy, S.J., Anderson, M.C., Russell, P.: Pathology of the Female reproductive tract. Churchill Livingstone,
London, Edinburg, New York, Philadelphia. 929, 2002.
27. Robboy, S.J., Duggan, M.A., Kurman, R.J.: Gynecologic Pathology. In: Rubin, E., Farber, J.L. (Eds):
Pathology. J. B. Lippincott Company, Philadelphia. 942–989, 1988.
28. Ronnett, B.M., Zaino, R.J., Ellenson, L.H., Kurman, R.J.: Endometrial Carcinoma. In: Kurman, R.J. (Ed):
Blaustein´s Pathology of the Female Genital Tract. 5th Edn. Springer Verlag, New York. 501–559, 2002.
29. Shivji, K.K., Kenny, M.K., Wood, R.D.: Proliferating cell nuclear antigen is required for DNA excision
repair. Cell. 69: 367–374, 1992.
30. Silverberg, S.G., Kurman, R.J., Nogales, F., et al.: Epithelial Tumors and Related Lesions. In: Tavassoli,
F.A., Devilee, P. (Eds): WHO classification of Tumours, Pathology and Genetics, Tumours of the Breast and
Female Genital Organs. Tumours of the Uterine Corpus. IARC Press, Lyon. 221–232, 2003.
31. Šišovský, V.: Imunohistochemická analýza endometria za fyziologických a patologických stavov. Dizertačná
práca. Univerzita Komenského, Bratislava. 144, 2005.
32. Šišovský, V., Danihel, Ľ., Babál, P., et al.: Expresia kyseliny sialovej v endometriu za fyziologických stavov,
v hyperplázii endometria a v karcinóme endometria. XIV. vedecká konferencia slovenských a českých
patológov s medzinárodnou účasťou. Zborník vedeckých prác, Mojmírovce. 2006c.
33. Šišovský, V., Danihel, Ľ., Babál, P., et al.: Imunohistochemická analýza expresie vybraných proteínov
v endometriu za fyziologických stavov, v hyperplázii endometria a v karcinóme endometria. XIV. vedecká
konferencia slovenských a českých patológov s medzinárodnou účasťou. Zborník vedeckých prác,
Mojmírovce. 2006b.
34. Šišovský, V., Danihel, Ľ., Jakubovský, J., et al.: The identification of sialic acid in normal endometrium and
in endometrial carcinoma (85). In: Tribulová, N., Okruhlicová, Ľ. (Eds) Potential therapeutic targets in
cardiovascular and other diseases. VEDA, Bratislava. 88, 2006e.
35. Šišovský, V., Danihel, Ľ., Štvrtina, S., et al.: Angiogenéza v endometriu za fyziologických stavov,
v hyperplázii endometria a v karcinóme endometria. XIV. vedecká konferencia slovenských a českých
patológov s medzinárodnou účasťou. Zborník vedeckých prác, Mojmírovce. 2006a.
36. Šišovský, V., Palkovič, M., Babál, P., et al.: The expresion of the selected proteins in endometrial carcinoma
(79-84). In: N. Tribulová, Ľ. Okruhlicová (Eds) Potential therapeutic targets in cardiovascular and other
diseases. VEDA, Bratislava. 88, 2006d.
37. Šišovský, V., Palkovič, M., Zeljenková, D., et al.: Pôsobenie derivátov organofosfátov na reprodukčné
orgány samíc potkanov Wistar. 12. kongres Slovenskej a Českej spoločnosti patológov s medzinárodnou
účasťou. Zborník vedeckých prác, Bratislava. 48, 2004.
38. Šišovský, V., Palkovič, M., Janega, P., et al.: Expression of the estrogen alpha and progesterone receptor in I.
and II. type of endometrial carcinoma. Morphology 2007 - 41st International Congress of Slovak Anatomical
Society and 44th Lojda Symposium on Histochemistry “Progress in Basic, Applied and Diagnostic
Histochemistry”. Programme and Abstracts, Bratislava. 94, 2007.
39. Šišovský, V., Palkovič, M., Janega, P., et al.: Correlation of the proliferation markers expression with the
estrogen alpha receptor in endometrial carcinoma. Morphology 2007 - 41st International Congress of Slovak
Anatomical Society and 44th Lojda Symposium on Histochemistry “Progress in Basic, Applied and Diagnostic
Histochemistry”. Programme and Abstracts, Bratislava. 94, 2007.
40. Šišovský, V., Babál, P., Danihel, Ľ., et al.: Sialylated glycoconjugates as prognostic indicator in clear cell
endometrial carcinoma? Morphology 2007 - 41st International Congress of Slovak Anatomical Society and
44th Lojda Symposium on Histochemistry “Progress in Basic, Applied and Diagnostic Histochemistry”.
Programme and Astracts, Bratislava. 95, 2007.
41. Šišovský, V., Danihel, Ľ., Babál, P., et al.: Identifikácia markerov proliferačnej aktivity v karcinóme
endometria. Prakt Gynek. 14: 112–120, 2007.
42. Šuška, P.: Nádory maternice. In: Šuška, P. (Ed): Vybrané kapitoly z gynekológie. Univerzita Komenského,
Bratislava, 182–200, 2003.
43. Šuška, P., Holomáň, K.: Endometrium v peri- a postmenopauze. SAP, Bratislava. 186, 1997.
44. Weismanová, E., Weismann, P., Vizváryová, M., et al.: New approach to human high-risk papillomavirus
(HR-HPV) genotyping. Neoplasma. 49: 217–224, 2002.
58
Biologicky aktívne látky prírodného charakteru s potenciálnym využitím pri prevencii
a terapii nádorových ochorení
Marcela Kopásková1, Eva Miadoková1, Slavomíra Naďová1, Viera Vlčková1, Viola Dúhová1,
Peter Rauko2, Pavel Mučaji3, Daniel Grančai3
1
Katedra genetiky, Prírodovedecká fakulta, Univerzita Komenského, Bratislava; 2Ústav experimentálnej
onkológie, Slovenská Akadémia Vied, Bratislava, 3Katedra farmakognózie a botaniky, Farmaceutická fakulta,
Univerzita Komenského, Bratislava, Slovenská Republika, [email protected]
Abstrakt
Študovaný extrakt bol získaný z čerstvých nerozvinutých púčikov trvácej
bodliakovitej rastliny Cynara cardunculus L., z čeľade Asteracea, ktorá sa pestuje ako
zelenina a má široké využitie v ľudovom liečiteľstve. Hlavným cieľom tejto práce bolo
hodnotenie potenciálneho antigenotoxického a antioxidačného účinku extraktu Cynara
cardunculus L. na rôznych modelových systémoch a rozličnými genetickými metódami.
Úvod
V súčasnosti sa venuje pozornosť výskumu látok prírodného charakteru. Význam zeleniny,
ovocia a strukovín ako zložiek zdravej stravy je úplne zrejmý. Jedným z možných dôvodov ich
priaznivých účinkov na zdravie je prítomnosť rôznych antioxidantov, medzi ktoré patria vitamíny C a
E, karotenoidy, selén, foláty, fenolové zložky ako aj flavonoidy. Za posledných desať rokov sa
výskum takmer vo všetkých vyspelých štátoch zameral na účinky flavonoidov a doterajšie štúdia
poukazujú na ich antioxidačné, antikarcinogénne a antimutagénne účinky. Rovnako sa hľadajú také
substancie, ktoré by mali význam pri liečbe a prevencií nádorových ochorení, ale i pri srdcovocievnych, respiračných ochoreniach, alergiách...a pod (Miadoková et al., 2002).
Náš výskum sme zamerali na štúdium antigenotoxického účinku látok prírodného charakteru,
konkrétne extraktu, ktorý bol získaný z rastliny artičoky Cynara cardunculus L.. Je to trváca bylina so
vzpriamenou plstnatou stonkou a kožovitými plstnatými listami, zaraďovaná do čeľade Asteracea.
Pestuje sa hlavne pre nedozreté úbory (Cynara scolomylus L.) a listy. Kvety Cynara cardunculus L. sa
okrem toho v Portugalsku využívajú pri výrobe syrov (Mučaji et al., 1997). Okrem kuchynského
využitia majú liečivé účinky. Už starovekí Egypťania a Gréci používali artičoku pri liečbe
žalúdočných ťažkostí (Li et al., 2004).
V súčasnosti bol popísaný hepatoprotektívny, hypocholesterolemický účinok. Z doterajších
štúdií bol zistený obsah látok (napr. luteolín, apigenín, terpenoidy), ktoré sa vyznačujú antioxidačnými,
antimutagénnymi, antikarcinogénnymi účinkami. Dnes sa pestujú a používajú predovšetkým pre svoje
priaznivé účinky pri chorobách pečene a žlčníka, a pre znižujúci účinok cholesterolu v krvi (Grančai et
al., 1992). Hypocholesterolemický účinok sa pripisuje hlavne cynarínu, kyseline kávovej a
chlorogénovej, flavonoidom a seskviterpénom, ich synergickému pôsobeniu (Grančai et al., 1992;
Schmidtová et al., 1998).
Materiál a metódy
Extrakt Cynara cardunculus (ECC) bol pripravený na Katedre farmakognózie a botaniky FAF
UK, kde rastliny boli dopestované a na extrakt boli použité ich nerozvinuté púčiky. Tie boli následne
macerované v 96% etanole, čím bol pripravený etanolový extrakt. Ten bol zahustený na vákuovej
odparovačke do sirupovitej konzistencie a následne rozdelený na štyri podiely (chloroformový,
etylacetátový, butanolový a vodný). Na izoláciu jednotlivých látok bola použitá chromatografia a IČspektrum. Extrakt, ktorý sme použili bol získaný z etylacetátoveho podielu a obsahoval látky: apigenín
(4',5,7-trihydroxyflavón), luteolín (3',4',5,7-tetrahydroxyflavón) a ich glykozidy: apigenín-7-glukozid
a luteolín-7-glukozid (cynarozid) (Grančai et al., 1992).
Potenciálny genotoxický/antigenotoxický účinok sme stanovovali pomocou batérie
genetických testov. Simultánny test fytotoxicity a klastogenity/antiklastogenity sme realizovali na
rastlinných druhoch Vicia sativa L. a Vicia faba L. podľa protokolu, ktorý introdukoval v roku 1984
prof. Murín (Murín, 1984). Boli použité dva mutagény: N-metyl-N-nitrózomočovina (MNM)
a ofloxacín (OFLX).
59
Mutagenitu/antimutagenitu ECC voči 4-nitrochinolín-N-oxid (4-NQO) a ofloxacínu OFLX
sme sledovali na kvasinkovom kmeni Saccharomyces cerevisiae D7, ktorý nám umožňoval pozorovať
tri genetické zmeny. Mitotický crossing-over v ade2 génovom lokuse, mitotickú génovú konverziu
v trp5 génovom lokuse, reverznú mutáciu v ilv1 génovom lokuse (Zimmermann et al., 1984).
Sledovali sme potenciálny mutagénny/antimutagénny účinok ECC Amesovým testom
v prítomnosti metabolickej aktivácie S9 zmesi na bakteriálnych kmeňoch Salmonella typhimurium
TA97, TA98, TA100, TA102 voči promutagénu 2-aminofluorénu. (Maron a Ames, 1983).
Na myšacích leukemických bunkách línie L1210 sme realizovali revitalizačný test, kde sme
hodnotili, či skúmaný ECC zvyšuje cytotoxický/cytostatický účinok komerčného chemoterapeutika
cis-platiny podľa protokolu Rauko a kol. (Rauko et al., 2003).
Stanovovali sme potenciálnu antioxidačnu činnosť ECC na základe vychytávania voľných 1,1difenyl-2-pikrylhydrazyl radikálov. Postup bol upravený a modifikovaný podľa Tagashira a kol.
(Tagashira et al., 1998).
Výsledky a diskusia
Hodnotením potenciálneho antimutagénneho účinku ECC na dvoch rastlinných modelových
objektoch z čeľade Fabaceae – Vicia sativa L. a Vicia faba L. pomocou „simultánneho testu
fytotoxicity a mutagenity“, výsledky ukázali, že ECC nemal mutagénny účinok na vybrané modelové
objekty. U V. sativa L. aj V. faba L. bolo pozorované štatisticky preukazné zníženie
mutagénneho/klastogénneho účinku vplyvom ECC pri všetkých použitých koncentráciách MNM a
OFLX. Bol tu teda potvrdený antimutagénny/ antiklastogénny účinok ECC.
Podobne antimutagénny účinok ECC sa sledoval na modelovom organizme kvasinky S.
cerevisiae kmeň D7. Ako pozitívna kontrola boli použité mutagény ofloxacín (OFLX) a 4nitrochinolín-N-oxid (4-NQO). Štatisticky preukazný antimutagénny účinok ECC sa prejavil pri
spolupôsobení s 4-NQO. Pri spolupôsobení ECC s OFLX bol náznak antimutagénneho účinku
extraktu ECC, ktorý však nebol štatisticky preukazný.
Z Amesovho testu s metabolickou aktiváciou vyplýva, že ECC, nemal ani na jeden z kmeňov
mutagénny účinok. Zo štatisticky významného zvýšenia počtu histidínových revertantov, ktoré
pozorujeme v tomto variante Amesovho testu u kmeňov TA97 a TA98 pri všetkých použitých
koncentráciách ECC a u kmeňa TA102 pri dvoch najvyšších koncentráciách vyplýva, že ECC mal
komutagénny účinok.
Na základe revitalizačného testu možno skonštatovať, že ECC po samotnej aplikácií na
leukemické bunky L1210 nevykazoval žiadny toxický efekt v porovnaní s kontrolou ale po aplikácií
na bunky poškodené po 24 hod. expozícií cisPt zvyšoval cytostatický/cytotoxický účinok cis-platiny
a signifikantne redukoval viabilitu/revitalizáciu cisPt poškodených buniek.
V metóde DPPH bola preukázaná silná antioxidačná aktivita ECC, ktorá bola zhodná
s antioxidačnou aktivitou kyseliny askorbovej.
Štatisticky významné antigenotoxické účinky ECC potvrdené v celom spektre genetických
modelových organizmov in vitro sú teda v súlade s našimi poznatkami, že ECC má náležitý potenciál
využiteľný pri prevencii a bioterapii nádorov. Flavonoidy ako nutričné faktory hrajú dôležitú úlohu
v prevencii rakoviny (Weisburger, 1999). Napriek tomu, že sú už dnes mechanizmy účinkov
niektorých flavonoidov pomerne dobre preštudované, ich význam ako súčasti chemopreventívnej
výživy alebo výživových doplnkov je však ešte stále len „potenciálny“. Je to v dôsledku toho, že sa
ešte presne nevie, či pri svojom pôsobení, a to hlavne u ľudí, zasahujú práve tie cielené miesta, o
ktorých sa predpokladá, že sú konečným miestom účinkovania konkrétnych flavonoidov (Walle,
2004).
Závery
Na základe výsledkov si môžeme dovoliť tvrdiť, že hodnotený extrakt z Cynara cardunculus
L. sa vyznačuje antimutagénnymi/antikarcinogénnymi, antiklastogénnymi, ako aj antioxidačnými,
terapeuticko/cytotoxickými účinkami. Celkový účinok extraktu z Cynara cardunculus L. závisí od
viacerých faktorov, medzi ktoré okrem iného môžeme zaradiť použitý testovací systém (to znamená
modelový organizmus, typ použitého mutagénu), spôsob aplikácie a použité koncentrácie ECC
a jednotlivých modelových mutagénov.
60
Poďakovanie
Touto cestou si dovoľujem poďakovať Prof. RNDr. Eve Miadokovej, DrSc., ako aj všetkým
spolupracovníkom a kolegom, ktorí prispeli k uskutočneniu experimentov.
Táto práca bola realizovaná aj vďaka finančným prostriedkom APVT-20-002604, VEGA No
1/2337/05, 2/4143/04, 2/4056/24, 1/1311/04.
Použitá literatúra
1. Grančai, D., Nagy, M., Ubik, K.: Obsahové látky Cynara carunculus L., I. Steroly a pentacyklické triterpény.
Farmaceutický obzor. LXI: 577–580, 1992.
2. Li, H., Xia, N., Brausch, I., Yao, Y., Forstermann, U.: Flavonoids from artichoke (Cynara scolymus L.) upregulate endothelial-type nitric-oxide synthase gene expression in human endothelial cells. J Pharmacol Exp
Ther. 310(3): 926–32, 2004.
3. Maron, D., Ames, B.N.: Revised methods for the Salmonella mutagenicity test. Mutat Res. 113: 173–215,
1983.
4. Miadoková, E., Mašterová, I., Vlčková, V., Dúhová, V., Totoh, J.: Antimutagenic potential of
homoisoflavonoids from Muscari racemosum. J Ethnopharmacol. 81: 381–386, 2002.
5. Mučaji, P., Grančai, D., Nagy, M.: Kvantitatívne hodnotenie obsahových látok v nadzemnej a podzemnej
časti Cynara cardunculus L. Farmaceutický obzor. LXVI: 6–7, 1997.
6. Murín, A.: Simultaneous test of phytotoxic and mutagenic effects of polluted waters and herbicidal
chemicals. Biologia. 39, 15–24, 1984.
7. Rauko, P., Bauer, W., Horvath, Z., Hochtl, T., Saiko, P., Karl, D.: Combination effects of Ara-C and 5fluorodeoxyuridine against leukemia cells in vitro and in mice. Anticancer Res. 23(5A): 3841–3846, 2003.
8. Schmidtová, Ľ., Juranová, D., Hózová, R., Valachovič, P., Grančai, D.: Hypolipemický účinok taraxasterolu,
β-sitosterolu a extraktu z artičoky u morčiat. Asteroskleróza. 2: 51–55, 1998.
9. Tagashira, M., Ohtake, Y.: A new antioxidative 1,3-benzodioxole from Melissa officinalis. Planta Med. 64:
555–558, 1998.
10. Walle, T.: Serial Review: Flavonoids and isoflavones (Phytoestrogens: absorption, metabolism, and
bioactivity). Absorption and metabolism of flavonoids. Free Radic Biol Med. 36: 829–837, 2004.
11. Weisburger, J.H.: Antimutagens, anticarcinogens, and effective worldwide cancer prevention. J Environ
Pathol Toxicol Oncol. 18: 85–93, 1999.
12. Zimmermann, F.K, von Borstel, B.C., von Halle, E.S., Parry, J.M., Siebert, D., Zettenbergm G., Barale, R.,
Loprieno, N.: Testing of chemicals for genetic activity with Saccharomyces cerevisiae: a report of the U.S.
Environmental Protection Agency Gene-Tox Program. Mutat Res. 133: 199–244, 1984.
61
Perspektívy využitia kmeňových buniek z pupočníkovej krvi
Miroslav Kubeš1, Zohdy Hamid1, Ján Vojtaššák2
1
Slovenský register placentárnych krvotvorných buniek, o.z., Bratislava; 2Univerzita Komenského v Bratislave,
Lekárska fakulta, Ústav lekárskej biológie a genetiky, Bratislava, Slovenská Republika, [email protected]
Abstrakt
Pupočníková
krv
(PK)
sa
stala
akceptovaným
zdrojom
príbuzenských, nepríbuzenských a autológnych kmeňových buniek na obnovu kostnej drene. Nové
technológie expanzie a transplantácie 2 čiastočne HLA zhodných jednotiek PK odstraňujú
bariéru nedostatku buniek, ktorá limitovala použitie PK u dospelých pacientov.
Mezenchýmové kmeňové bunky (MKB), čo sú adherentné stromálne bunky
nehematopoietického pôvodu boli nedávno získané aj z PK. Podobne ako MKB z kostnej
drene, majú aj tieto schopnosť diferencovať sa do buniek rôznych tkanív ako sú kosť, šľacha,
chrupavka, sval a tukové tkanivo a produkovať rastové faktory a cytokíny, ktoré podporujú
expanziu a diferenciáciu hematopoietických buniek. Majú tiež antiproliferatívny,
imunomodulačný a protizápalový účinok. V budúcnosti môžu mať MKB z PK na liečbu
rejekcie alogénneho štepu, choroby štepu proti príjemcovi, ťažkých autoimunitných ochorení
a iných porúch, pri ktorých je potrebná tkanivová reparácia. Najnovšie, v PK boli dokázané
embryonálnym bunkám podobné kmeňové bunky, ktoré sú schopné diferenciácie do
bunkových typov všetkých troch zárodočných listov (endo-, ekto- a mezoderm). Tieto
predstavujú vývoja schopnú alternatívu k ľudským embryonálnym bunkám na výskumné
účely bez znepokojujúcich etických otázok a majú potenciál posunúť vpred vývoj klinických
aplikácií založených na bunkovej terapii.
Úvod
Kmeňové bunky pupočníkovej krvi (PK) sa stávajú v poslednej dobe čoraz viac stredobodom
pozornosti odbornej aj laickej verejnosti z viacerých dôvodov. Prvým je ich jedinečnosť z hľadiska
biologického. Majú charakter dospelých kmeňových buniek ale niektoré z nich sú podobné
embryonálnym kmeňovým bunkám. Teda z hľadiska perspektív terapeutického využitia sa blížia
embryonálnym bunkám, ale bez kontroverzií etickosti ich využitia na výskumné či liečebné účely.
O ich pluripotentnom potenciáli a schopnosti diferencovať sa na špecializované typy buniek tkanív
a orgánov svedčí stále viac odborných publikácií a objavujú sa aj prvé správy o ich úspešnom
klinickom využití. Ďalším dôvodom je jednoduchá dostupnosť PK odberom pri pôrode a možnosťou
dlhodobého uskladnenia v hlboko zamrazenom stave. Toto predurčuje kmeňové bunky PK byť
výhodným zdrojom kmeňových buniek na prípadné autológne či alogénne využitie počas celého
života jedinca a pre iných aj po jeho smrti. Navyše takto uskladnené kmeňové bunky si zachovávajú
„novorodenecký“ proliferačný potenciál a sú chránené, na rozdiel od dospelých kmeňových buniek,
ktoré si „nosíme“ celý život v kostnej dreni a tkanivách, pred infekciami, poškodením vedľajšími
účinkami liečby, či prirodzeným starnutím. V neposlednom rade môžu slúžiť ako zdroj kmeňových
buniek pre výskum v oblasti génovej terapie a v budúcnosti ako samotný nástroj génovej terapie
závažných ochorení.
Krvotvorné kmeňové bunky pupočníkovej krvi
V PK sa nachádza niekoľko typov kmeňových buniek, ktoré boli postupne objavené vďaka
svojim vlastnostiam a niektoré sú už desiatky rokov aj klinicky využívané. Sú to hlavne krvotvorné
kmeňové bunky, ktorých krvotvorný potenciál bol prvýkrát úspešne dokázaný pri HLA identickej
súrodeneckej transplantácii v roku 1988 pri liečbe dievčatka s Fanconiho anémiou (10). Ako alogénny
zdroj krvotvorných kmeňových buniek sa odvtedy použil vo svete už vyše 8 000 krát a v súčasnosti
prvenstvo v početnosti využívania PK pre účely transplantácií krvotvorby majú Japonci. Takmer na
polovicu všetkých alogénnych transplantácií používajú v tejto krajine ako zdroj krvotvorných
kmeňových buniek PK (33). V spojených štátoch amerických je to zhruba pri 20% transplantácií
dospelých pacientov a 50% transplantácií detských pacientov. V každom prípade počet transplantácií
s využitím PK vo svete ročne stúpa o 20% a čas plného využitia tohto zdroja krvotvorných kmeňových
62
buniek ešte len príde (33). Je to jednak z dôvodu, že počet zamrazených darovaných jednotiek PK v
registroch po celom svete stále pribúda, ale aj z dôvodu veľkého záujmu o adresné zamrazenie
a uskladnenie PK pre autológne alebo príbuzenské použitie.
Prvý register na svete bol založený Dr. Pablom Rubinsteinom v New Yorku v roku 1993
a dnes je v USA jedným z najväčších registrov s takmer 31 tis. zamrazenými jednotkami PK
(www.bmdw.org). Na Slovensku bol založený register PK v roku 1997 ako piaty register na svete
a od roku 1998 je členom organizácie Bone Marrow Donor Worldwide (www.bmdw.org). V databáze
tejto celosvetovej organizácie je dnes popri 10,75 miliónov evidovaných darcov kostnej drene
zaevidovaných už vyše 250 tisíc darovaných jednotiek PK a ročne tento počet narastá asi o 40 tisíc.
Celkový počet evidovaných darcov kostnej drene a zamrazených jednotiek PK by mal pri súčasnom
trende v júni 2008 dosiahnuť 12 miliónov (www.bmdw.org). Počty jednotiek zamrazených PK
v adresných bankách rastú rádovo rýchlejšie. Len v USA je uskladnených dnes vyše 600 tisíc
jednotiek a celkový počet vo svete už presahuje 1 milión. V prvom tohtoročnom čísle časopisu
Pediatrics (január 2007) (12) bola uverejnená prvá prípadová štúdia transplantácie detskej akútnej
lymfoblastickej leukémie na svete vyliečenej autológnou PK u 3 ročného dievčatka. Na Slovensku
bola prvýkrát použitá autológna PK v roku 2004 pri liečbe neuroblastómu u 8 mesačného chlapca ako
súčasť „anglického protokolu“ na podporu obnovy krvotvorby po jednotlivých dávkach chemoterapie.
Dnes má tento malý pacient takmer štyri roky a je zdravý (Dr. Husáková, osobne získaná informácia).
Aké sú výhody používania PK ako zdroja krvotvorných kmeňových buniek na účely
transplantácií? V prvom rade je to jednoduchá a rýchla dostupnosť vhodného transplantátu. V
mnohých prípadoch malígnych ochorení, kedy ide o čas, je táto výhoda rovnajúca sa záchrane života.
Pacient totiž môže podstúpiť indikovanú transplantáciu iba v prípade, že sa klinikom podarí navodiť
stav remisie ochorenia a v tomto, niekedy veľmi krátkom časovom úseku musí byť k dispozícii
transplantát krvotvorných buniek. Vyhľadanie a skontaktovanie dobrovoľného darcu kostnej drene až
po samotný odber trvá vo vyspelých krajinách do dvoch až troch mesiacov. Žiaľ, štatistiky úspešností
transplantácií často neuvádzajú koľko pacientov z dôvodu premeškania vhodného času podstupuje
transplantáciu z horšími vyhliadkami na úspech a u koľkých pacientov nie je vôbec možné pokračovať
v liečbe transplantáciou kvôli relapsu ochorenia.
Pravdepodobnosti vyhľadania vhodného darcu v svetovej databáze sa v kaukazoidnej
populácii pohybujú od 60-85% (BMDW, www.bmdw.org). Horšie sú na tom pacienti z menej
početných a ekonomicky menej vyspelých etník. Vyhliadky pacientov, u ktorých je nevyhnutná
alogénna transplantácia sa zlepšujú jednak vzhľadom na spomínaný nárast počtu zamrazených
jednotiek PK v registroch po celom svete ale aj vzhľadom k novým klinickým skúsenostiam
s transplantáciami PK. Na základe klinických štúdií sa potvrdilo, že pri vhodnom transplantáte z PK
majú pacienti lepšiu dlhodobú prognózu v porovnaní s rovnako vhodným transplantátom z kostnej
drene (37). Úspešnú tranaplantáciu krvotvorných buniek je možné vykonať s PK aj pri menej prísnej
zhode v tkanivových antigénoch v porovnaní s transplantáciou kostnej drene. Výsledky transplantácií
pri použití PK s nezhodou v dvoch antigénoch HLA systému sú porovnateľne dobré ako pri
transplantáciách kostnej drene s nezhodou v jednom HLA znaku. Tento jav sa pripisuje určitej
nezrelosti (naivnosti) imunokompetentných buniek novorodenca.
Zistenie menšej nevyhnutnej zhody HLA antigénov medzi darcom a príjemcom však logicky
vytvorilo aj zvýšenú pravdepodobnosť nájdenia vhodného transplantátu medzi zamrazenými
jednotkami PK, takže pri vyhľadávaní vhodného darcu, či transplantátu v medzinárodnej databáze
bolo nájdených aj viacej transplantátov PK rovnako vhodných pre daného pacienta (zhoda 4 zo 6
antigénov). Vo väčšine prípadov však boli tieto transplantáty z dôvodu malého množstva buniek
jednotlivo nedostatočné pre transplantáciu dospelého pacienta. Pokusy vykonať transplantáciu s dvomi
menšími rovnako vhodnými transplantátmi PK dopadli dobre a z hľadiska dlhodobej prognózy
pacientov lepšie ako keď bola použitá iba jedna dostatočne veľká PK (1). Lepšia percentuálna
úspešnosť liečby bola dosiahnutá pravdepodobne navodením silnejšieho „graft versus leukemia“ (GvL)
efektu vzájomnou stimuláciou dvoch transplantátov navzájom. Takto stimulované imunokompetenté
bunky zrejme lepšie zlikvidovali v tele pacienta zvyškovú chorobu, čo v opačnom prípade vedie
k relapsu ochorenia. Zaznamenaný bol aj znížený výskyt vážnej akútnej choroby štepu proti
hostiteľovi (GvHD). Pozoruhodné je, že po troch týždňoch od transplantácie mala dvojitý
chimerizmus už iba štvrtina pacientov a že po 100 dňoch od transplantácie mali pacienti krvotvorbu už
iba z jedného transplantátu. A to v 75% z toho, ktorý bol podaný ako prvý. Tu sa otvára do budúcnosti
zaujímavá možnosť transplantovať aj autológnu PK hoci malého objemu v kombinácii s vhodnou
alogénnou PK pri ochoreniach, kde bola doteraz indikovaná iba nepríbuzenská transplantácia. A to
63
práve z dôvodu zabezpečenia dostatočnej reakcie štepu proti zvyškovej leukémii v tele príjemcu - GvL
efektu. Pri autológnych transplantáciách sa totiž kvôli chýbajúcemu GvL efektu dosahovali pri
niektorých typoch leukémií zlé výsledky. Ak by sa potvrdila správnosť tejto hypotézy klinickou
štúdiou, rozšírilo by to značne aplikovateľnosť autológnej PK a zabezpečilo zníženú transplantačnú
mortalitu z dôvodov GvHD. Dnes sa na základe trendov prevalencií jednotlivých chorôb v populácii
a rozširujúceho sa počtu diagnóz liečiteľných transplantáciou krvotvorných buniek usudzuje, že
pravdepodobnosť využitia autológnych krvotvorných kmeňových buniek bude rásť. Pasquini a spol.
(31) publikovali pravdepodobnosti podstúpenia autológnej transplantácie a akejkoľvek transplantácie
a dospeli k nasledovným pravdepodobnostiam. Podstúpenie AutoTx/Tx do 20 rokov života je
1:5000/1700, do 50 rokov života 1:1100/450, do 75 rokov 1:450/220.
Ďalšou výhodou transplantátov z PK je väčšia proliferačná schopnosť jej krvotvorných
kmeňových buniek v porovnaní s kmeňovými bunkami kostnej drene a neprítomnosť záťaže
navodenej starnutím, získanými vírusovými ochoreniami počas života, či chemoterapiou. Kmeňové
bunky PK sa podarilo in vitro množiť a expandovať ich počet na dostatočný pre transplantáciu
dospelého pacienta (17,27,28). Výsledky z klinických štúdií transplantácií vykonaných s
namnoženými krvotvornými kmeňovými bunkami už preukázali, že takéto transplantácie sú možné
a bezpečné (14,34,35). V USA bola už úspešne ukončená I. fáza klinického skúšania amplifikačného
kitu CB001 na krvotvorné kmeňové bunky a prejde do II. fázy (www.clinicaltrial.gov).
Mezenchýmové kmeňové bunky (MKB) pupočníkovej krvi
V roku 2000 boli popísané v PK adherentné fibroblastom podobné bunky, ktoré sa svojimi
povrchovými znakmi zhodovali so znakmi MKB získaných z kostnej drene (6). Neskôr viacerí autori
nielen potvrdili multilíniový charakter MKB z PK (4) ale opisovali diferenciáciu aj do buniek
pochádzajúcich z endo- a ektodermu iných zárodočných listov ako sú svalové bunky (8), nervové
a gliálne bunky (3,11), či hepatocyty (15). Predpoklad, že kmeňové bunky z PK majú skutočne
pluripotentný potenciál sa podarilo dokázať a opublikovať v roku 2004 (19). Autori dokázali
diferencovať takzvané USSC (Unrestricted Somatic Stem Cells) do mezodermových osteoblastov,
chondroblastov, adipocytov, hemtopoietických buniek a kardiomyocytov, do ektodermových buniek
všetkých troch neurálnych línií ako aj endodermových hepatálnych buniek. USSC je možné ľahko
nasmerovať v závislosti od kultivačného média na MKB s multilíniovým potenciálom a kedže nie sú
známe povrchové markery, ktorými by sa dali USSC odlíšiť od MKB, tak v imunofenotypových
štúdiách sú opisované ako homogénna populácia. Od MKB sa teda zatiaľ dajú odlíšiť iba dokázaním
ich diferenciačného potenciálu. Zatiaľ neznámou zostáva, či sa podarí izolovať tieto bunky z každej
PK. Z publikovaných výsledkov štúdií vyplýva, že iba z 60% čerstvo odobratých PK sa podarilo
izolovať MKB, či USSC (18,20). Zo zamrazených jednotiek PK sa to darí ešte menej. Rozmrazovanie
buniek totiž vedie k tvorbe bunkových agregátov a následne k strate časti buniek. Keď sa podarí nájsť
taký spôsob zamrazovania alebo spôsob manipulácie s rozmrazenou PK, ktoré nebudú viesť k strate
buniek, úspešnosť izolácie MKB sa určite zvýši. Potenciál využitia, ktorý naznačujú publikované
štúdie na zvieracích modeloch je totiž značný (41). Napríklad pri podaní MKB dochádza
k rýchlejšiemu prihojeniu štepu krvotvorných buniek u NOD/SCID myší (43), pri navodení
neovaskularizácie ischemických postihnutí dolných končatín (7,40), pri liečbe neuropatií po aplikácii
endoteliálnych prekurzorov derivovaných z buniek PK u diabetických potkanov (30), pri regenerácii
ciev srdca alebo mozgu poškodených ischémiou (13,23,25,29,36,38) a ďalšie. Tiež v pokusoch s ex
vivo expanziou CD34+ kmeňových buniek z PK boli dosiahnuté lepšie výsledky, keď expanzia
prebiehala v prítomnosti množiacich sa MKB (24). Ďalej z in vitro štúdií možno spomenúť prácu
Kamolz a spol. (16) ktorí v pokusoch s diferenciáciou na epiteliálne bunky dokázali, že v prítomnosti
dospelých ľudských keratinocytov sa kmeňové bunky z PK krvi diferencujú tiež na keratinocyty a tak
môžu slúžiť ako štartovací materiál na získanie transplantátov pre pacientov s veľkými kožnými
defektmi. Podobne práca El-Badri a spol. (5) potvrdila in vitro neuregeneratívny potenciál MKB z PK
indukciou ich neurálnej diferenciácie. Perspektívy vo využití kmeňových buniek z PK v liečbe
a reparačných zásahoch v poškodenom mozgu a mieche sú napísané v práci Garbuzova-Davis a spol.
(9).
Odbery a zamrazovanie PK sa vykonávajú v väčšej miere len niečo cez 10 rokov, takže na
možnosť ich autológnej aplikácie v klinických štúdiách ešte nebola príležitosť. Avšak prvé skúsenosti
z klinického využitia autológnych MKB z kostnej drene potvrdzujú výsledky získané na zvieracích
modeloch opísané vyššie. Napríklad spomínané ischemické poškodenie dolných končatín sa podarilo
výrazne zlepšiť u diabetických pacientov podaním ich vlastných z kostnej drene mobilizovaných
64
kmeňových buniek (39,43). Lazarus a spol. (21) publikovali súbor 46 pacientov, ktorí boli
transplantovaní s krvotvornými bunkami od svojich HLA identických súrodencov a zároveň dostávali
aj ich namnožené MKB. Zaznamenali zrýchlené prihojenie štepu a obnovu krvotvorby a znížený
výskyt GvHD alebo jej miernejší priebeh. Podobne Le Blanc a Ringden (22,23) publikovali veľmi
sľubné výsledky s liečbou ťažkej na steroidy rezistentnej akútnej GvHD. V USA prebieha v súčasnosti
pilotná klinická štúdia, ktorá by mala dať odpoveď, či môže pomôcť transfúzia autológnej PK deťom
s diabetom prvého typu (www.clinicaltrials.gov). Americký Cord Blood Registry®
(www.cordblood.com)
zahájil
program
s názvom
„Newborn
Possibilities
Program“ (www.newbornpossibilities.com), v ktorom chcú zabezpečiť pre novorodené deti
s potenciálnym neurologickým poškodením (deti s nízkym „Apgar skóre“) zamrazenie PK, aby bola
v prípade potvrdenia ochorenia (DMO) použitá na ich liečbu.
Embryonálnym bunkám podobné kmeňové bunky pupočníkovej krvi
V posledných troch rokoch sa objavili v odbornej literatúre veľmi povzbudivé správy
z hľadiska nájdenia východiska z etického problému využívania ľudských embryonálnych kmeňových
buniek. Ide o objav embryonálnym bunkám podobných kmeňových buniek v PK publikovaný
profesorom McGuckinom a spol. z univerzity v Newcastle (26). Tieto bunky majú na svojom povrchu
špecifické markery embryonálnych buniek ako sú SSEA-4, SSEA-3, Oct-4 a TRA-1-60, TRA-1-81
protilátkami rozpoznávané markery, ale nie SSEA-1. Boli získané ako adherentné strapcovité kolónie
z hustej bunkovej kultúry PK v prítomnosti trombopoietínu, flt3-ligandu a c-kit ligandu v kultivačnom
médiu s fetálnym teľacím sérom po 7 dňoch kultivácie. Keď boli tieto bunky štyri týždne kultivované
v gravitačnom bioreaktore v hepatocytovom rastovom médiu (IMDM+FCS, HGF, bFGF, EGF, c-kit
ligand) začali exprimovať na svojom povrchu hepatocytové špecifické markery ako sú cytokeratín-18,
α-fetoproteín a albumín. Tým bol dosiahnutý prvý dôkaz ich pluripotentného diferenciačného
potenciálu. Dnes firma založená profesorom McGuckinom a spolupracovníkmi ponúka trojrozmerné
hepatálne tkanivo vypestované z takýchto buniek na testy nových liekov farmaceutickým firmám. Do
budúcna sa idú zamerať na vývoj 3D modelov ľudských orgánov z kmeňových buniek, ktoré sa budú
využívať na testovanie nových liekov. Títo vedci z univerzity v Newcastle v spolupráci s americkou
firmou BioE vyvíjali a testovali produkty
zlepšujúce techniku spracovania a uskladňovania
zamrazenej PK tak, aby sa v nej darilo uchovať aj tieto cenné kmeňové bunky. Najnovšie firma BioE
ohlásila, že sa jej pracovníkom podarilo diferencovať kmeňové bunky PK na pľúcne alveolárne bunky
II typu (2), čo sľubuje pokrok v liečbe cystickej fibrózy. Podobne Medistem Laboratories testujú
platformu Angiostem™ , ktorá by mala slúžiť na liečbu kardiovaskulárnych ochorení a tiež
ischemických ochorení končatín. Angiostem™ predstavuje platformu ktorá umožní manipuláciu PK
tak, že ju bude možné využiť pre rôznych jedincov bez potreby imunologickej supresie.
Následne v roku 2006 sa objavili práce potvrdzujúce výsledky dosiahnuté tímom profesora
McGuckina. Zhao a spolupracovníci z Ilinoiskej univerzity v Chicagu identifikovali v PK kmeňové
bunky s embryonálnymi charakteristikami (42). Navyše dosiahli in vitro diferenciáciu týchto buniek
do buniek s neuronálnou a endoteliálnou charaktristikou a in vivo stimuláciu ich diferenciácie do
funkčných, inzulín produkujúcich buniek, ktoré eliminovali hyperglykémiu u diabetických myší.
Závery
PK sa stala v posledných rokoch dôležitým zdrojom kmeňových buniek, jednak pre výskum
a jednak pre klinické aplikácie. Dnes prebieha v USA „regruting“ do 122 nových klinických štúdií
s využitím PK (www.clinicaltrials.gov). V Hong-Kongu, Číne a Taiwane sa chystajú zahájiť v roku
2008 rozsiahlu klinickú štúdiu zameranú na využitie kmeňových buniek na liečbu poranení miechy.
Do štúdie bude zapojených 400 pacientov s rôznymi typmi poranení. Kmeňové bunky sa budú
izolovať z PK HLA kompatilbilného darcu získanej z verejných registrov (The China Post, 9.3.2007).
Je preto opodstatnené očakávať, že už blízka budúcnosť ukáže do akej miery sa potvrdia nádeje
vkladané do kmeňových buniek PK, jej darovania pre všeobecné terapeutické využitie alebo
rodinného uskladňovania.
Použitá literatúra
1. Barker, J.N., Weisdorf, D.J., DeFor, T.E., et al.: Transplantation of 2 partially HLA-matched umbilical cord
blood units to enhance engraftment in adults with hematologic malignancy. Blood. 105: 1343–1347, 2005.
2. Berger, M.J., Adams, S.D., Tigges, B.M., et al.: Differentiation of umbilical cord blood-derived multilineage
progenitor cells into respiratory epithelial cells. Cytotherapy. 8: 480–487, 2006.
65
3. Buzanska, L., Machaj, E.K., Zablocka, B., et al.: Human cord blood-derived cells attain neuronal and glial
features in vitro. J Cell Sci. 115: 2131–2138, 2002.
4. Campagnoli, C., Roberts, I.A.G., Kumar, S., et al.: Identification of mesenchymal stem/progenitor cells in
human first-trimester fetal blood, liver, and bone marrow. Blood. 98: 2396–2402, 2001.
5. El-Badri, N.S., Hakki, A., Saporta, S., et al.: Cord blood mesenchymal stem cells: Potential use in
neurological disorders. Stem Cells Dev. 15: 497–506, 2006.
6. Erice, A., Confer, P., Minguell, J.J.: Mesenchymal progenitor cells in human umbilical cord blood. Br J
Haematol. 109: 235–242, 2000.
7. Finney, M.R., Greco, N.J., Haynesworth, S.E., et al.: Direct Comparison of Umbilical Cord Blood versus
Bone Marrow-Derived Endothelial Precursor Cells in Mediating Neovascularization in Response to Vascular
Ischemia. Biol Blood Marrow Tr. 12: 585–593, 2006.
8. Gang, E.J., Neony, J.A., Hong, S.H., et al.: Skeletal Myogenic Differentiation of Mesenchymal Stem Cells
Isolated from Human Umbilical Cord Blood. Stem Cells. 22: 617–624, 2004.
9. Garbuzova-Davis, S., Willing, A.E., Saporta S., et al.: Novel cell therapy approaches for brain repair; In: Aage
RM (ed): Progress in Brain Research Reprogramming of the Brain. Elsevier. 207–222, 2006.
10. Gluckman, E., Broxmeyer, H.A., Auerbach, A.D., et al.: Hematopoietic reconstitution in a patient with
Fanconi's anemia by means of umbilical-cord blood from an HLA-identical sibling. N Engl J Med. 321:
1174–1178, 1989.
11. Goodwin, H.S., Bicknese, A.R., Chin, S.N., et al.: Multilineage differentiation activity by cells isolated from
umbilical cord blood: Expression of bone, fat, and neural markers. Biol Blood Marrow Tr. 2001,581–588,
2001.
12. Hafani, A., Lampeter, E., Viswanatha, D., et al.: First Report of Autologous Cord Blood Transplantation in
the Treatment of a Child With Leukemia. Pediatrics. 119: e296–300, 2007.
13. Henning, R.J., Burgas, J.D., Ondrovi, L., et al.: Human umbilical cord blood progenitor cells are attracted to
infarcted myocardium and significantly reduce myocardial infarction size. Cell Transplant. 15: 647–658, 2006.
14. Jaroscak, J., Filtry, K., Smith, A., et al.: Augmentation of umbilical cord blood (UCB) transplantation with
ex vivo-expanded UCB cells: results of a phase 1 trial using the Zastroj Replicell System. Blood. 101: 5061–
5067, 2003.
15. Kakinuma, S., Tahala, Y., Chinzei, R., et al.: Human umbilical cord blood as a source of transplantable
hepatic progenitor cells. Stem Cells. 21: 217–227, 2003.
16. Kamolz, L.P., Kolbu, A., Wick N., et al.: Cultured human epithelium: Human umbilical cord blood stem
cells differentiate into keratinocytes under in vitro conditions. Burns. 32: 16–19, 2006.
17. Kawada, H., Ando, K., Tsuji, T., et al.: Rapid ex vivo expansion of human umbilical cord hematopoietic
progenitors using a novel culture system. Exp hematom. 27: 904–915, 1999.
18. Kern, S., Eichler, H., Stočce, J., et al.: Comparative analysis of mesenchymal stem cells from bone marrow,
umbilical cord blood, or adipose tissue. Stem cells. 24: 1294–1301, 2006.
19. Kotlet, G., Senekem, S., Airey, J.A., et al.: A new human somatic stem cell from placental cord blood with
intrinsic pluripotent differentiation potential. J Exp Med. 200: 123–135, 2004.
20. Kotlet, G., Senekem, S., Wernet P.: Comparative generation and characterization of pluripotent unrestricted
somatic stem cells with mesenchymal stem cells from human cord blood. Exp Hematol. 34: 1589–1595, 2006.
21. Lazaru, H.M., Koc, O.N., Devine, S.M., et al.: Cotransplantation of HLA-identical sibling culture-expanded
mesenchymal stem cells and hematopoietic stem sells in hematologic malignancy patients. Biol Blood
Marrow Tr. 11: 389–398, 2005.
22. Le Blanc, K., Ringden, O.: Mesenchymal stem cells: properties and role in clinical bone marrow
transplantation. Curr Opin Imunol. 18: 586–591, 2006.
23. Leor, J., Ghetta, E., Feinberg, M.S., et al.: Human umbilical cord blood-derived CD133+ cells enhance
function and repair of the infarcted myocardium. Stem cells. 24: 772–780, 2006.
24. Li, M.H., Tian, D., Liu, C.Y., et al.: Expansion ex vivo of human bone marrow mesenchymal stem cells and
cord blood CD34+ cells. Zhongguo Shi Yan Xue Ye Xue Za Zhi. 13: 235–239, 2005.
25. Ma, N., Ladilov, Y., Kaminski, A., et al.: Umbilical cord blood cell Transplantation for Myocardial
Regeneration. Transplant Proc. 38: 771–773, 2006.
26. McGuckin, C.P., Forraz, N., Baradez, M.O., et al.: Production of stem cells with embryonic characteristics
from human umbilical cord blood. Cell prolif. 38: 245–255, 2005.
27. McNiece, I.: Ex vivo expansion of hematopoietic cells. Exp Hematol. 32: 409–410, 2004.
28. Miller, J.S., McCullar, V., Verfaillie, C.M.: Ex vivo culture of CD34+/Lin-/DR- cells in stroma-derived
soluble factors, interleukin-3, and macrophage inflammatory protein-1alpha maintains not only myeloid but
also lymphoid progenitors in a novel switch culture assay. Blood. 91: 4516–4522, 1998.
29. Nan, Z.G., Grande, A.W., Sanberg, C.D., et al.: Infusion of human umbilical cord blood ameliorates
neurologic deficits in rats with hemorrhagic brain injury. Ann NY Acad Sci. 1049: 84–96, 2005.
30. Naruse, K., Hamada, Y., Nakashima, E., et al.: Therapeutic neovascularization using cord blood-derived
endothelial progenitor cells for diabetic neuropathy. Diabetes. 54: 1823–1828, 2005.
66
31. Pasquini, M.C., Logan, B.R., Verter, F., et al.: The likelihood of hematopoietic stem cell transplantation
(HCT) in the United States: Implications for umbilical cord blood storage. ASH Annual Meeting Abstracts.
106,1330, 2005.
32. Ringden, O., Uzunel, M., Rasmusson, I., et al.: Mesenchymal stem cells for treatment of therapy-resistant
graft-versus-host disease. Transplantation. 81: 1390–1397, 2006.
33. Rubinstein, P.: Why cord blood? Human imunol. 67: 398–404, 2006.
34. Shpall, E.J., McNiece, I.K., de Lima, M., et al.: Transplantation of ex vivo expanded cord blood. Biol Blood
Marrow Tr. 10: 738–738, 2004.
35. Shpall, E.J., Quinones, R., Miller, R., et al.: Transplantation of ex vivo expanded cord blood. Biol of Blood
Marrow Tr. 8: 368–376, 2002.
36. Taguchi, A., Soma, T., Tahala, H., et al.: Administration of CD34+ cells after stroke enhances neurogenesis
via angiogenesisin a mouse model. J Clin Incest. 114: 330–338, 2004.
37. Wagner, J.E., Barker, J.N., DeFor, T.E., et al.: Transplantation of unrelated donor umbilical cord blood in
102 patients with malignant and nonmalignant diseases: influence of CD34 cell dose and HLA disparity on
treatment-related mortality and survival. Blood. 100: 1611–1618, 2002.
38. Xiao, J., Nan, Z., Motorka, Y., et al.: Transplantation of a novel cell line population of umbilical cord blood
stem cells ameliorates neurological deficits associated with ischemic brain injury. Stem Cells Dev. 14: 722–
733, 2005.
39. Yamaguchi, Y., Yoshida, S., Sumikawa, Y., et al.: Rapid healing of intractable diabetic foot ulcers with
exposed bones following a novel therapy of exposing bone marrow cells and then grafting epidermal sheets.
Br J Dermatos. 151: 1019–1028, 2004.
40. Yang, C., Zhang, Z.H., Li, Z.J., et al.: Enhancement of neovascularization with cord blood CD133+ cellderived endothelial progenitor cell transplantation. Thromb Haemost. 91: 1202–1212, 2004.
41. Zhang, L., Yang, R., Han, Z.C.: Transplantation of umbilical cord blood-derived endothelial progenitor cells:
a promising method of therapeutic revascularisation. Eur J Haematol. 76: 1–8, 2006.
42. Zhao, Y., Wang, H., Mazzone, T.: Identification of stem cells from human umbilical cord blood with
embryonic and hematopoietic characteristics. Exp Cell Res. 312: 2454–2464, 2006.
43. Zhou, D.H., Juany, S.L., Juany, K., et al.: Mesenchymal stem cells from human cord blood promote
engraftment of human umbilical cord blood-derived CD34+ cells in NOD/SCID mice. Zhonghua Xue Ye Xue
Za Zhi. 26: 732–735, 2005.
67
Znižovanie rizika liečby a adherencia k sekundárnej terapii po infarkte myokardu
Monika Laššánová1, Milada Laššánová2, Ján Murín3
Univerzita Komenského v Bratislave, Lekárska fakulta, 1Farmakologický ústav; 2Ústav lekárskej chémie,
biochémie a klinickej chémie; 3I. interná klinika, Bratislava, Slovenská Republika, [email protected]
Abstrakt
Vzhľadom k tomu, že kardiovaskulárne lieky predstavujú jednu z najpredpisovanejších liekových skupín, ako aj fakt, že dobrá adherencia lekárov k národným
odporúčaniam má potenciál racionalizovať liečbu a znižovať jej riziko, v predkladanej práci
sme sa zamerali na analýzu sekundárnej prevencie u pacientov po infarkte myokardu (IM).
Do súboru boli zaradení 103 pacienti, ktorí spĺňali kritéria diagnózy IM. Ako prediktívny
faktor vzniku nežiaducich účinok liekov a potenciálnych liekových interakcií, sme v súbore
sledovali počet liekov. Priemerný počet liekov ± SD pri prijatí bol 3,9 ± 2,8 lieku vs. 6,5 ± 1,9
pri prepustení. Hospitalizácia viedla k signifikantnému nárastu počtu liekov pri prepustení
(p<0,001). Preskripcia 4 EBM liekových skupín u pacientov po IM pri preložení alebo
prepustení (N=82) bola: antitrombotickú liečbu malo 97,6% (N=80), liečbu inhibítormi
enzýmu konvertujúceho angiotenzín malo 91,4% (N=75), beta-blokátory malo 61% (N=50)
a 24,3% (N=20) pacientov malo hypolipidemickú liečbu. Pozitívne hodnotíme fakt, že počas
hospitalizácie došlo u sledovaných skupín liekov k signifikantnému nárastu ich užívania
oproti stavu pri prijatí (p<0,001) pre všetky 4 EBM skupiny. Rezervy vidíme v adherencii
lekárov k predpisovaniu beta-blokátorov a hypolipidemík.
Úvod
Pohľad na bezpečnosť farmakoterapie sa neustále vyvíja. Kým v minulosti sa kládol dôraz
predovšetkým na účinnosť terapie, v posledných desaťročiach sa do popredia dostáva okrem účinnosti
aj jej bezpečnosť. Problematike nežiaducich účinkov liekov (NÚL) treba venovať zvýšenú pozornosť,
nakoľko NÚL signifikantne zvyšujú morbiditu a mortalitu, zvyšujú náklady na liečbu a predstavujú
tretiu až šiestu vedúcu príčinu smrti (Schlienger, 2000; Kelly, 2001). Jeden z najdôležitejších
rizikových faktorov farmakoterapie predstavuje polypragmázia, ktorá vedie k nárastu liekových
interakcií a podieľa sa na vzniku NÚL (Kelly, 2001; Nguyen a kol., 2006; Krähenbühl-Melcher, 2007).
Mnohé práce konštatujú, že starší pacienti užívajú v priemere 3-4 lieky, ale nie je zriedkavé užívanie
aj 12 liekov súčasne, čím sa výrazne zvyšuje incidencia NÚL (Adamcik a Rhodes, 1993; Nikolaus
a kol, 1996). Napríklad pri súčasnom používaní viac ako 6 liekov sa NÚL objavujú u 19,8%
hospitalizovaných, u pacientov liečených menej ako 6 liekmi boli NÚL pozorované u menej ako 3,3%
pacientov (Perlík, 1999). Na optimalizáciu, racionalizáciu a minimalizáciu rizík liečebného procesu, sa
odborníkmi z danej oblasti vypracovávajú odporúčania (guidelines) pre optimálnu diagnostiku a liečbu
jednotlivých ochorení. Tieto odporúčania vychádzajú zo spracovaných informácií medicíny založenej
na dôkazoch (Evidence based Medicine – EBM) (Sackett a kol., 2000). Štandardné diagnostické a
liečebné postupy, odporúčania vznikajú na základe zváženia benefitu a rizík liečby, na základe
najnovších poznatkov o používaní liekov s prihliadnutím na ekonomické zdroje a prispievajú
k zvýšeniu racionálnej farmakoterapie konkrétneho pacienta (Sackett a kol., 2000; Scholten a kol.,
2005). Vzhľadom k tomu, že kardiovaskulárne ochorenia predstavujú vedúcu príčinu mortality a
morbidity tak na Slovensku, ako aj celosvetovo a počet úmrtí na kardiovaskulárne ochorenia
celosvetovo stúpa, národné kardiologické spoločnosti vypracovávajú odporúčania na liečbu
najčastejších kardiovaskulárnych ochorení. Jedným z takýchto guidelinov, sú aj odporúčania na
sekundárnu prevenciu po infarkte myokardu, ktoré boli vypracované na základe veľkých,
multicentrických štúdií, ktoré demonštrovali efektívnosť a prospešnosť liečby antitrombotikami
(predovšetkým antiagregačnými látkami, ATC - B01AC), inhibítormi enzýmu konvertujúceho
angiotenzín/inhibítormi angiotenzínových receptorov (ATC – C09), beta-blokátormi (ATC – C07) a
liekmi znižujúcimi hladiny lipidov (predovšetkým statínmi, ATC – C10AA), v redukcii morbidity a
mortality u pacientov po infarkte myokardu (Braunwald a kol., 2002; Antman a kol., 2004; Smith a
kol., 2006).
68
Materiál a metódy
Predkladaná práca hodnotí súbor 103 pacientov, ktorí na základe klinického obrazu, EKG
záznamu a pozitívnych myokardiálnych markerov, spĺňali kritéria diagnózy – infarkt myokardu (IM),
pri prijatí na Koronárnu jednotku I. Internej kliniky Lekárskej fakulty UK v Bratislave od 1.1. 1999 do
31.12. 1999. U týchto pacientov sme následne, retrospektívne sledovali všetky ich ďalšie
hospitalizácie na I. Internej klinike LFUK do septembra 2005. V retrospektívnej štúdii sme
analyzovali terapiu, s akou boli pacienti prijatí a s akou terapiou odchádzali do ambulantnej
starostlivosti po IM. Takto sme monitorovali adherenciu lekárov k národným odporúčaniam k
sekundárnej farmakologickej prevencii po IM.
Deskriptívna štatistika IM súboru: Spojité premenné sme vyjadrili ako priemer ± smerodajná
odchýlka. Diskrétne premenné sme vyjadrili frekvenciou ich výskytu a percentuálnym zastúpením.
Štatistické testy: Užívanie liekových skupín pri prijatí a pri prepustení z nemocnice sme porovnali
McNemarovým testom. Na zistenie vzťahu medzi diskrétnymi premennými sme použili χ2 test
v kontingenčných tabuľkách a v prípade nízkych očakávaných početností Fisherov exaktný test. Na
porovnanie spojitých premenných pri prijatí a pri prepustení sme použili párový Studentov t-test resp.
párový Wilcoxonov test v závislosti od toho, či nebola alebo bola zamietnutá normalita. Na
porovnanie spojitých premenných v dvoch súboroch sme použili 2-výberový Studentov t-test resp. 2výberový Mann-Whitneyov test v závislosti od toho, či nebola alebo bola zamietnutá normalita.
Výsledky a diskusia
Vzhľadom k tomu, že kardiovaskulárne lieky predstavujú jednu z najpredpisovanejších
liekových skupín, ako aj fakt, že dobrá adherencia lekárov k národným odporúčaniam má potenciál
racionalizovať liečbu a znižovať jej riziko, v predkladanej práci sme sa zamerali na analýzu
sekundárnej prevencie u pacientov po IM. Tá zahŕňa medicínske postupy (4 EBM liekové skupiny) a
životosprávne opatrenia, ktoré majú viesť k redukcii komplikácií IM, rekurencii IM a zabráneniu
progresie koronárnej aterosklerózy.
Do predkladaj štúdie sme zaradili 103 pacientov, ktorí boli na Koronárnu jednotku I.
internej kliniky LFUK prijatí od 1.1.1999 do 31.1.1999 s diagnózou infarkt myokardu. V súbore boli
zastúpení viac muži (61; 59,2%) ako ženy (42; 40,8%). Priemerný vek ± SD pacientov súboru bol 71,5
± 11,3 roka (medián 75,0 roka). Ženy boli staršie ako muži. V priebehu hospitalizácie zomrelo 21
(20,4%) a do ambulantnej starostlivosti bolo prepustených 76 (73,8%) pacientov, 6 (5,8%) pacienti
boli preložení na iné oddelenie v rámci nemocničnej starostlivosti.
Ako prediktívny faktor vzniku nežiaducich účinok liekov a potenciálnych liekových
interakcií, sme v súbore sledovali počet liekov, s ktorými prišiel pacient do nemocnice a s ktorými bol
preložený alebo prepustený do ambulantnej starostlivosti. Priemerný počet liekov ± SD u 103
pacientov súboru pri prijatí bol 3,9 ± 2,8 lieku. Pri prijatí nemalo 14 (13,5%) pacientov v anamnéze
žiadnu medikamentóznu liečbu. Najviac, 15 liekov, mal pri prijatí jeden (0,97%) pacient. U 82
pacientov, ktorí boli preložení, alebo prepustení do ambulantnej starostlivosti bol priemerný počet 6,5
± 1,9 liekov, pričom minimum mali 2 lieky a maximum 12 liekov pri prepustení. Zaznamenali sme
štatisticky významný nárast počtu liekov pri prepustení oproti počtu liekov pri prijatí (p<0,001) (tab.
1).
N
Priemer
SD
Minimum liekov
Maximum liekov
P
Počet liekov pri
prijatí
Celý súbor
103
3,9
2,8
0
15
Počet liekov pri
Počet liekov pri
prijatí
prepustení
Preložení/prepustení pacienti
82
82
3,4
6,5
2,5
1,9
0
2
8
12
<0,001
Tab. 1. Počet liekov u pacientov pri prijatí a pri prepustení.
Vysvetlivky: SD – smerodajná odchýlka, p – štatistická významnosť podľa Wilcoxon testu.
69
V štúdii Wawrucha a kolektívu došlo u 600 pacientov ≥ 65 ročných tiež k signifikantnému
nárastu počtu liekov pri prepustení z nemocnice (Wawruch a kol., 2007). Dôvodom na zvýšenie počtu
liekov počas hospitalizácie, môže byť jednak zhoršenie klinického stavu pacienta, alebo diagnostika
nového ochorenia. Na druhej strane je práve hospitalizácia vhodným obdobím na prehodnotenie liečby
a prípadné vysadenie liekov, ktoré už nie sú nevyhnuté vzhľadom na aktuálny stav pacienta. Práve
zníženie počtu liekov signifikantne znižuje riziko vzniku NÚL a interakcií (Bressler a Bahl, 2003). U
2 pacientov sa počet liekov znížil, u 71 pacientov sa zvýšil a u 9 sa nezmenil. Medzi pohlaviami nie je
rozdiel v počte liekov pri prepustení a pri prijatí. Starší pacienti (≥ 65 rokov), nemali pri prepustení
viac liekov než mladší pacienti.
V predkladanom súbore sme taktiež analyzovali výskyt, čiže užívanie, 4 EBM liekových skupín,
ktoré majú byť preskribované, na základe medicíny založenej na dôkazoch, všetkým pacientom
v rámci sekundárnej prevencii po IM. Tým sme sledovali farmakologickú adherenciu lekárov k
národným odporúčaniam kardiologickej spoločnosti po AIM. Podľa ATC klasifikácie sme stanovovali
užívanie, čiže preskripciu nasledovných EBM-liekových skupín: B01 – antitrombotiká (B01AA –
antagonisty vitamínu K, antikoagulanciá, B01AB – heparíny a B01AC – antiagreganciá), C09 –
inhibítory enzýmu konvertujúceho angiotenzín alebo blokátory angiotenzínových receptorov, C07 –
beta-blokátory a C10 – hypolipidemiká (C10AA – statíny a C10AB fibráty). Spomínané liekové
skupiny na základe EBM zlepšujú prognózu a znižujú mortalitu u pacientov po IM (Antman a kol.,
2004, Smith a kol., 2006). Celková preskripcia u pacientov po IM pri preložení alebo prepustení
(N=82) bola: antitrombotickú liečbu malo 97,6% (N=80), liečbu inhibítormi enzýmu konvertujúceho
angiotenzín malo 91,4% (N=75), beta-blokátory malo 61% (N=50) a 24,3% (N=20) pacientov malo
hypolipidemickú liečbu.
Analyzovali sme tieto 4 EBM skupiny liekov pri prijatí a pri prepustení u 82 pacientov, ktorí
boli preložení alebo prepustení do ambulantnej starostlivosti. Pozitívne hodnotíme fakt, že počas
hospitalizácie došlo u sledovaných skupín liekov podľa McNemar Testu k signifikantnému nárastu ich
užívania oproti stavu pri prijatí (p<0,001) pre všetky 4 EBM skupiny (graf 1). Z týchto čísel
jednoznačne vyplýva potreba zvýšiť adherenciu našich lekárov k predpisovaniu BB a hypolipidemík.
120,00%
pri prijatí
100,00%
*
pri prepustení
*
p<0,001
80,00%
*
60,00%
40,00%
*
20,00%
0,00%
liečba
antitrombotikami
liečba ACEi
liečba betablokátormi
liečba
hypolipidemikami
Graf 1. EBM liečba pacientov súboru pri prijatí a pri prepustení.
Vysvetlivky: * - signifikantný nárast vo všetkých 4 EBM skupinách podľa McNemar testu.
Závery
V sledovanom súbore hospitalizácia viedla k nárastu počtu liekov pri prepustení, oproti počtu
pri prijatí. Pacienti ≥ 65 rokov nemali pri prepustení viac liekov než mladší pacienti. Adherencia
lekárov k národným odporúčaniam k sekundárnej prevencii po IM je dobrá. Pri všetkých štyroch EBM
liekových skupinách (antitrombotiká, ACEinhibítory, beta-blokátory hypolipidemiká) došlo k nárastu
ich preskripcie pri prepustení. Aj napriek tomu vidíme najväčšie rezervy v predpisovaní betablokátorov a hypolipidemík.
70
Použitá literatúra
1. Adamcik, B.A., Rhodes, R.S.: The Pharmacist’s Role in Rational Drug Therapy of the Aged. Drugs Aging.
3(6): 481–48, 1993.
2. Antman, E.M., Anbe, D.T., Armstrong, P.W., et al.: ACC/AHA guidelines for the management of patients
with ST-elevation myocardial infarction; A report of the American College of Cardiology/American Heart
Association Task Force on Practice Guidelines (Committee to Revise the 1999 Guidelines for the Management
of patients with acute myocardial infarction). J Am Coll Cardiol. 44: E1–211, 2004.
3. Braunwald, E., Antman, E.M., Beasley, J.W., Califf, R.M., Cheitlin, M.D., et al.: ACC/AHA guideline update
for the management of patients with unstable angina and non-ST-segment elevation myocardial infarction-2002: summary article: a report of the ACC/AHA Task Force on Practice Guidelines (Committee on the
Management of Patients With Unstable Angina). Circulation. 106(14): 1893–900, 2002.
4. Bressler, R., Bahl, J.J.: Principles of drug therapy for the elderly patient. Mayo Clin Proc. 78: 1564–77, 2003.
5. Kelly, W.N.: Can the frequency and ricks of fatal adverse drug events be determined? Pharmacotherapy. 21(5):
521–7, 2001.
6. Krähenbühl-Melcher, A., Schlienger, R., Lampert, M., Haschke, M., Drewe, J., Krähenbühl, S.: Drug-related
problems in hospitals: a review of the recent literature. Drug Saf. 30(5): 379–407, 2007.
7. Nguyen, J.K., Fouts, M.M., Kotabe, S.E., Lo, E.: Polypharmacy as a risk factor for adverse drug reactions in
geriatric nursing home residents. Am J Geriatr Pharmacother. 4(1): 36–41, 2006.
8. Nikolaus, T., et al.: Elderly patient´s problems with medications. An in-hospital and follow-up study. Eur J
Clin Pharmacol. 49: 255–9, 1996.
9. Perlík, F.: Klinická farmakologie v praxi. 1. vyd. TRITON, Praha. 58–70, 1999.
10. Sackett, D.L., Strauss, S.E., Richardson, W.S., et al.: Evidence-based medicine: How to practice and teach
EBM. 2nd edition. Churchill Livingstone, New York. 261, 2000.
11. Schlienger, R.G.: Management of adverse drug effects. Ther Umsch. 57(9): 584–90, 2000.
12. Scholten, R.J., Clarke, M., Hetherington, J.: The Cochrane Collaboration. Eur J Clin Nutr. 59(Suppl 1):
S147–9, 2005.
13. Smith, S.C., Allen, J., Blair, S.N., et al.: AHA/ACC guidelines for secondary prevention for patients with
coronary and other atherosclerotic vascular disease: 2006 Update, endorsed by the National Heart, Lung, and
Blood Institute. Circulation. 113: 2363–72, 2006.
14. Wawruch, M., Zikavska, M., Wsolova, L., et al: Polypharmacy in elderly hospitalised patients in Slovakia.
Pharm World Sci. 2007 (In press).
71
Two- and three-dimensional tissue constructs based on nanofiber layers
Petr Lesný1,2,3, Pavla Jendelová1,2,3, Oldřich Jirsák4, Lenka Martinová4, Jiří Michálek3,5,
Martin Přádný3,5, Eva Syková1,2,3
1
Institute of Experimental Medicine, Academy of Sciences of the Czech Republic, Prague; 2Department of
Neuroscience, 2nd Medical Faculty of Charles University, Prague; 3Center for Cell Therapy and Tissue Repair,
Prague; 4Department of Nonwovens, Faculty of Textile Engineering, Liberec; 5Institute of Macromolecular
Chemistry, Academy of Sciences of the Czech Republic, Prague, Czech Republic, [email protected]
Abstract
The construction of three-dimensional structures is at the center of attention of tissue
engineering. Current developments in nanotechnology, primarily the technique of producing
nanofiber layers using a Nanospider™ device, led us to investigate the properties of the
nanofiber layers with the aim of utilizing them for two- and three-dimensional tissue
reconstruction. We prepared nanofiber layers from the copolymer of 2hydroxyethylmethacrylate (HEMA) and ethoxyethylmethacrylate (EOEMA) and cultivated
the bone marrow derived mesenchymal stem cells and chondrocytes on them. Both of the cell
types grew to confluence on the top of the nanofiber layer, it was possible to cultivate them on
the opposite sides of the nanofiber layer. By stacking the nanofiber layers containing the cell
types on each other and compressing, we created three-dimensional tissue construct
resembling the developing mesenchymal tissue.
Introduction
The preparation of three-dimensional structures is at the center of attention of tissue
engineering. There are many methods available for creating three-dimensional tissue constructs –
utilizing macroporous (e.g. fibrous) materials or dispersing the cells in a homogeneous environment,
such as an agarose hydrogel or fibrin glue. Electrospun nanofibers have been known for a long time;
however, conventional electrospinning methods do not allow their production in sufficient quantities
for experiments with tissue engineering. Current developments in nanotechnology, primarily the
technique of producing nanofiber layers using a Nanospider™ device [1], led us to investigate their
properties with the aim of utilizing such nanofibers for tissue engineering, mainly for threedimensional tissue reconstruction.
Materials and methods
A Nanospider™ device was used to prepare layers from biocompatible copolymer of 2hydroxyethylmethacrylate (HEMA) and ethoxyethylmethacrylate (EOEMA). The thickness of the
layers was between 10 and 100 micrometers. The nanofiber layers were examined using an electron
microscope and utilized for cell cultivation.
Bone marrow derived mesenchymal stem cells (BMSCs) and chondrocytes were cultivated on
both sides of the nanofiber layers under standard cultivation conditions. We prepared nanofiber layers
with BMSCs or chondrocytes on both sides and also layers with BMSCs on top and chondrocytes on
the bottom of the nanofiber layer. The growth of the cells was evaluated using confocal microscopy.
After reaching confluence, the individual layers were folded, compressed and further
cultivated for 21 days. The resulting three-dimensional cell-polymer constructs were examined using
standard histological techniques.
Results and discussion
Although the growth of cells on the layers from the copolymer of HEMA and EOEMA was
negligible, both the chondrocytes and BMSCs grew to confluence on nanofiber layers from the
copolymer. (Fig. 1, 2). We were able to cultivate chondrocytes and BMSCs on the opposite sides of a
nanofiber layer; the interactions between cells on the two sides differed according to the thickness of
the nanofiber layer. On the layers 10 micrometers thick, the cell processes were able to grow through
the layer to the opposite side, while on layers between 10 and 50 micrometers in thickness, the cells
72
from both layers were in contact through processes growing within the layer (Fig. 3). In nanofiber
layers thicker than 50 micrometers, we did not observe any contact between the cells of the two layers.
Nanofiber layers containing the same cell type on both sides were placed above each other and
compressed. The cells from proximal layers adhered to the adjacent nanofiber layers. Utilizing this
approach, 1mm thick constructs were created from 7 – 10 nanofiber layers containing BMSCs (Fig. 4)
or chondrocytes (Fig. 5) on both sides. These implants were mechanically stable and resembled
developing mesenchymal tissue; however, the accumulation of cartilage-specific extracellular matrix
in the chondrocyte based constructs was very low.
The growth of many cell types, such as connective tissue, neural, glial and
mesenchymal cells, on nanofibers has been described by many authors. The strong adhesion
of the cells to the nanofiber layers is probably mediated by the positive charge that is given to
the fibers in an electrostatic field and which attracts biomacromolecules and cells to the
surface, similarly to the gas-plasma treated layers of tissue plastic.
Using the approach of cultivating cells on Nanospider-produced nanofiber layers and
mechanically folding the implants to achieve multiple layers, we were able to construct in
vitro two- and three-dimensional tissue equivalents. By changing the types of cells growing
on the nanofiber layers, we expect that we will be able to construct specific tissues in vitro,
including epithelial tissue or parenchymatous organs in the future.
A patent application for this method of three-dimensional tissue construct preparation has
been filed in the Czech Republic [2].
Fig. 1. The growth of BMSCs, stained with phalloidin (red) and DAPI (blue), on the surface of a
nanofiber layer. Scalebar = 50 µm.
Fig. 2. A confocal image reconstruction of BMSCs, stained with phalloidin, growing on a slightly
sinuated nanofiber layer. The cells copy the surface of the layer. Scalebar = 50 µm.
73
Fig. 3. BMSCs (red) and chondrocytes (green) growing on the opposite sides of a 10 µm thick
nanofiber layer. Scalebar = 50 µm.
Fig. 4. A three-dimensional construct, stained with haematoxylin and eosin and resembling loose
mesenchymal tissue, created by folding layers containing BMSCs together and connecting them via
cell growth. Scalebar = 1 mm.
Fig. 5. A three-dimensional construct resembling loose mesenchymal tissue created by folding layers
containing chondrocytes together and connecting them via cell growth. Staining for collagen II shows
its deposition in the proximity of the cells. Scalebar = 50 µm.
Acknowledgements
Supported by grants GACR 309/06/1246, 1A8697-5, 2B06130 and AVOZ503905703.
References
1. Jirsák, O., et al.: CZ 294274 (B6), WO 2005/024101.
2. Lesný, P., et al.: Czech patent application PV2007-54.
74
Mitochondrial/caspase-9 dependent cell death of cancer cells growing in suspension
induced by plant isoquinoline – berberine
Silvia Letašiová1, Soňa Jantová1, Ľuboš Čipák2
1
Department of Biochemistry and Microbiology, Institute of Biochemistry, Nutrition and Health Protection,
Faculty of Chemical and Food Technology, STU; 2Cancer Research Institute, Slovak Academy of Science,
Bratislava, Slovakia, [email protected]
Abstract
Berberine, an isoquinoline plant alkaloid, is known to generate a wide variety of
biochemical and pharmacological effects. In our work, we investigated the cytotoxic effects
and the way of death of berberine-treated suspension-growing cells, Ehrlich ascites carcinoma
(EAC) cells and human promonocytic U937 cells. Berberine exhibited cytotoxic effect which
was in a dose-dependent manner. Morphological evidence of apoptosis, including DNA
laddering formation was observed when EAC cells were treated with 10 µg.mL-1 for 48 h and
U937 cells with 75 µg.mL-1 of berberine for 24 h. Flow cytometry analysis revealed that
berberine induced sub-G0 fraction (apoptotic cells) of EAC and U937 cells. Berberine induced
significant changes of ∆ψm in berberine-treated U937 cells. The highest tested concentration
of berberine (75 µg.mL-1) induced significant decrease in ∆ψm in U937 cells. The cells treated
with berberine concentration of 75 µg.mL-1 induced ROS production in a time- dependent
manner. The activation of caspase-9 and caspase-3 were also seen in berberine-treated U937
cells. On the other hand, berberine did not significantly activate the caspase-8.
Introduction
Berberine, an isoquinoline plant alkaloid widely used in traditional Chinese and Ayurvedic
medicine, displays a varied pharmacological and biochemical activities. Berberine has demonstrated
significant antimicrobial activity (Amin et al 1969). It can also be used as an antidiarrhea,
antihypertension, antiarrhythmias and antiinflammatory agent (Kuo et al 1995, Račková et al 2004).
Berberine has been demonstrated to posses anticancer activity; significant cytotoxicity has been
reported against some human cancer cell lines, murine leukemia cells and L9 rat glioma cell line
(Chen et al 1994; Iizuka et al 2000; Jantová et al 2003).
In the present work, we evaluated cytotoxic/antiproliferative activity and the ability of
berberine to induce apoptosis using suspension-growing cancer cell lines – Ehrlich ascites carcinoma
(EAC) cells and human promonocytic U937 cells. We monitored the ability of berberine to induce
apoptotic DNA fragmentation, to elevate the production of reactive oxygen species (ROS), to change
the mitochondrial membrane potential and to activate the caspases -3, -8 and -9.
Materials and methods
Berberine (2,3-methylenedioxy-9,10-dimethoxyprotoberberine chloride, Fig. 1), obtained from
Sigma (Slovakia), was dissolved in dimethyl sulfoxide (DMSO). Final concentration of DMSO never
exceeded 1% in either control or treated samples.
Fig. 1. Chemical structure of berberine.
75
Ehrlich ascites carcinoma (EAC) cells and human promonocytic U937 cell line (obtained from
the ATCC (Rockville, MD, USA)) cells were cultured in minimal Eagle medium (EAC) and RPMI
1640 medium (U937) supplemented with penicillin G (100 µg.mL-1 ), streptomycin (100 µg.mL-1), Lglutamine (292.3 µg.mL-1), and 10% heat-inactivated fetal calf serum at 37˚C in a humidified
atmosphere containing 5% CO2. The cell growth and viability were assessed by 0.4 % trypan blue
staining.
The cell growth inhibition assay – the starting inoculums of 3.76 x 105 EAC cells mL-1 and of
2.0 x 105 U937 cells mL-1 in the exponential phase of growth were used. Five milliliters of the
suspension were added to Petri dishes (diameter 60 mm). Cell growth and viability were assessed by
direct counting of 0.4% trypan blue dye – excluding cells.
Cell cycle analysis by flow cytometry – the control and berberine – treated cells (0.5 x 106)
were harvested, washed twice with PBS and exposed to 0.1% Triton X-100 in PBS supplemented with
RNA-ase (50 µg.mL-1, Sigma) for 25 min at 37˚C. Afterwards, DNA was stained by propidium iodide
(50 µg.mL-1, Sigma) for 15 min at 4˚C. Samples were analyzed by a Coulter Epics XL (Beckman
Coulter Company, Miami, Florida, USA) flow cytometer with the use of System II software provided
by the manufacturer. Excitation was elicited at 488 nm with the Argon laser.
Electrophoretic analysis of apoptosis – the control and berberine – treated cells (1x106) were
harvested, washed with PBS and then lysed in 100 µL of solution (10 mM TRIS, 10 mM EDTA, 0.5%
Triton X-100) supplemented with proteinase K (1 mg.mL-1). Samples were then incubated at 37˚C for
1 h and heated at 70˚C for 10 min. Following lysis, RNA-ase (200 µg.mL-1) was added and repeated
incubation at 37˚C for 1 h followed. The samples were subjected to electrophoresis at 40 V for 3 h in
2% (w/v) agarose gels complemented with ethidium bromide (1 µg.mL-1). Separated DNA fragments
(DNA ladders) were visualized using a UV transilluminator (254 nm, Ultra-Lum Electronic UV
Transilluminator, USA).
Detection of mitochondrial membrane potential – the changes in mitochondrial membrane
potential were determined using 3,3´-dihexyloxacarbocyanine iodide (DiOC6(3)) by flow cytometry.
Detection of reactive oygen species (ROS) – level of ROS was examined using 2,7dichlorodihydrofluorescein diacetate (H2DCF-DA) by flow cytometry and fluorescence microscopy.
Caspase-3, caspase-8 and caspase-9 activities assays – the caspase-3, -8 and -9 activities were
measured according to the manufacturer´s protocol (CaspACETM Assay System, Promega Corporation,
USA).
Results and discussion
In this study we tested the cytotoxic/antiproliferative activity of berberine on EAC and U937
cells in vitro. The proliferation of EAC and U937 cells during permanent exposure to berberine
concentrations ranging from 0.01 to 100 µg.mL-1 is shown in Figure 2. After 12 h (EAC cells) and 24
h (U937 cells) of culturing, the highest tested concentrations (100, 50 and 10 µg mL-1 for EAC cells
and 75 µg.mL-1 for U937 cells) had an acute cytotoxic effect manifested by the decrease of viable
EAC and the total inhibition of cell proliferation of U937 cells number. After 24 h, part of the cell
population proliferated, but after 36 and 48 h of culturing, viable EAC cell number decreased almost
to zero. Berberine at concentration of 50 µg.mL-1 for U937 cells induced a delayed cytotoxic effect.
After 24 h, a part of the cell population proliferated, but after 48 h, the division of the U937 cells was
nearly arrested. The antiproliferative effect of berberine at the next tested concentrations (1.0, 0.1 and
0.01 µg.mL-1 for EAC cells and 25, 10 and 5 µg mL-1 for U937 cells) was directly proportional to the
concentration and the time of exposure.
Next, the effect of berberine on cell cycle profile of EAC and U937 cells was examined. The
flow cytometry revealed that berberine had no effect on the cell cycle profile of EAC and U937 cells.
On the other hand, sub-G0 fraction was detected (data not shown).
The ability of berberine to induce apoptotic cell death was assessed by the electrophoretic
analysis of internucleosomal fragmentation of DNA. Berberine induced apoptotic DNA fragmentation
when EAC cells were treated with 10 µg mL-1 for 48 h and when U937 cells were treated with 75
µg.mL-1 for 24 h and 75 and 50 µg.mL-1 for 48 h (data not shown).
The mitochondrial membrane potential changes (∆ψm) as markers of mitochondrial function
are often associated with apoptosis. To determine the impact of berberine on ∆ψm the cells were
treated with 50 and 75 µg mL-1 of berberine for 24 h, and analyzed by flow cytometry. As it is shown
in Figure 3 berberine induced significant changes of ∆ψm in U937 cells. The highest tested
concentration of berberine induced significant decrease in ∆ψm in more than 90% of U937 cells.
76
Because reactive oxygen species (ROS) play an important role in apoptosis and changes of
mitochondrial membrane potential are considered to be involved in ROS production, next we
investigated the ability of berberine to generate ROS using fluorescence sensitive probe (H2DCF-DA)
that detects various active oxygen species. The cells were exposed to 75 µg mL-1 of berberine for
various time (0 - 8 h) and analyzed for presence of ROS by fluorescence microscopy. As it is
presented in Figure 4 the generation of ROS due to presence of berberine was time-dependent. After
30 min of incubation, berberine induced significant increase in level of ROS, with the peak between
90 - 120 min. In 2 hours the level of berberine-generated ROS decreased to the level of ROS in
untreated cells, with the complete loss of ROS-generated fluorescence after 4 hours.
To address the particular role of caspases on berberine-induced apoptosis, we used a general
and potent caspase inhibitors, namely Ac-DEVD-pNA (caspase-3), Ac-LETD-pNA (caspase-8) and
Ac-LEHD-pNA (caspase-9). The time-dependent spectrophotometric analysis of caspase-3 activity in
U937 cells treated with 75 µg mL-1 of berberine is illustrated in Figure 5. As it is presented, berberine
induced time-dependent increase in caspase-3 activity (Figure 5B). Stable increase in caspase-3
activity was observed up to 6 h, then caspase activity slightly decreased.
The time-dependent luminometric analysis of caspase-8 and caspase-9 activity in U937 cells
treated with 75 µg mL-1 of berberine is illustrated in Figure 5. As it is shown, the value of caspase-9
activity was comparable to caspase-9 activity of U937 cells induced by 180 µg mL-1 of cisplatin
(positive control for caspase-9 activation) (Figure 5A). Stable increase in caspase-9 activity was
observed up to 30 min, then activity slightly decreased. Contrary to the above results, berberine does
not significantly activate the caspase-8 (Figure 5C), as the minimal difference between untreated and
berberine-treated cells was observed.
A
B
4500000
4000000
3500000
control
0.01
0.1
1
10
50
100
Number of cells
3000000
2500000
2000000
1500000
1000000
500000
0
0
12
24
36
48
60
Time (h)
Fig. 2. Cell proliferation of EAC (A) and U937 (B) cells in response to berberine in the course of 48 h.
Concentration of berberine is µg.mL-1. Each point represents the mean ± SD of three experiments.
Fig. 3. Detection of mitochondrial membrane potential changes by flow cytometry using DiOC6(3) in
berberine-treated U937 cells. Data represent mean values±SD from three independent experiments.
* P < 0.05, ** P < 0.01, *** P < 0.001.
77
A
B
Fig. 4. Monitoring of the reactive oxygen species production using H2DCF-DA by flow cytometry (A)
and fluorescence microscopy (B) in U937 cells treated with 75 µg.mL-1 of berberine. Data repre-sent
mean values ± SD from three independent experiments. * P < 0.05, ** P < 0.01, *** P < 0.001.
A
B
C
Fig. 5. Effect of berberine on activation of caspase-9 (A), caspase-3 (B) and caspase-8 (C) in U937
cells treated with berberine at concentration of 75 µg.mL-1 for 24 h (for caspase-3) or 20 h (for
caspase-8 and caspase-9). Data represent mean values ± SD from three independent experiments. PC,
positive control (6 µM cisPt); nc, negative control (U937 cells treated with solvent – DMSO); berb,
U937 cells treated with berberine-concentration of 75 µg.mL-1.
* P < 0.05, ** P < 0.01, *** P < 0.001.
Conclusions
Berberine induced different cytotoxic effects in EAC and U937 cells which were
concentration- and time-dependent. Cell cycle analysis and agarose gel electrophoresis confirmed that
berberine induced apoptosis in both tested cell lines. In U937 cells berberine induced ROS production
in a time-dependent manner and decrease in ∆ψm which correlates with the activation of caspase-9
and caspase-3. The data presented here suggests that berberine induces apoptosis in U937 cells
through a mitochondrial/caspase-9 dependent pathway.
Acknowledgment
This study was supported by Science Grant Agency 1/4305/07 and Science and Technology
Assistance Agency under contract No. APVT-20-007304.
78
References
1. Amin, A.H., Subbahaiah, T.V., Abbasi. K.M.: Berberine sulfate: antimicrobial activity, bioassay, and mode of
action. Can J Microbiol. 15: 1067–1076, 1969.
2. Chen, K.I., Hao, D.M., Liu, Z.X., Chen, Y.C., You, Z.S.: Effect of berberine alone or in combination with
argon ion laser treatment on 9L rat glioma cell line. Chin Med J. 107: 808–812, 1994.
3. Iizuka, N., Miyamoto, K., Okita, K., Tangoku, A., Hayashi, H., Yosino, S., Abe, T., Morioka, T., Hazama S.,
Oka, M.: Inhibitory effect of Coptidis Rhizoma and berberine on the proliferation of human esophageal
cancer cell lines. Cancer Lett. 148(1): 19–25, 2000.
4. Jantová, S., Čipák, L., Čerňaková, M., Košťálová, D.: Effect of berberine on proliferation, cell cycle and
apoptosis in HeLa and L1210 cells. J. Pharm. Pharmacol. 55: 1143–1149, 2003.
5. Kuo, C.L., Chou, C.C., Yung, B.Y.M.: Berberine complexes with DNA in the berberine-induced apoptosis in
human leukemic HL-60 cells. Cancer Lett. 93: 193–200, 1995.
6. Račková, L., Májeková, M., Košťálová, D., Štefek, M.: Antiradical and antioxidant activities of alkaloids
isolated from Mahonia aquifolium. Structural aspects. Bioorg Med Chem. 12: 4709–4715, 2004.
79
Účinok vitamínu C na etanolom indukované zmeny fosfolipidovej monovrstvy
Tomáš Málek1, Martin Kopáni1, Martin Weis2, Ľuboš Danišovič3
1
Univerzita Komenského v Bratislave, Lekárska fakulta, Ústav patologickej anatómie; 2Slovenská technická
univerzita, Fakulta elektrotechniky a informatiky, Katedra fyziky; 3Univerzita Komenského, Lekárska fakulta,
Ústav lekárskej biológie a genetiky, Bratislava, Slovenská Republika, [email protected]
Abstrakt
Vplyv molekúl etanolu na vlastnosti membrán je predmetom mnohých štúdií. Cieľom
práce je vyšetrovanie štruktúrnych, elektrických a mechanických vlastností dipalmitoylfosfátidylcholínovej (DPPC) monovrstvy nachádzajúcej sa na povrchu subfázy metanol –
voda a etanol – voda po pridaní vitamínu C. Pri monovrstve DPPC na subfáze etanol – voda
dochádza k adsorpcii/ absorpcii molekúl etanolu na fosfátocholínovú (PO2) skupinu molekuly
DPPC. Po pridaní vitamínu C do roztoku etanol – voda pozorujeme, že molekuly vitamínu C
ovplyvňujú interakciu molekúl etanolu s molekulami monovrstvy DPPC. Otázkou zostáva, či
by sa účinok vitamínu C prejavil pri fyziologickej funkcii membrán in vivo v koncentráciách
blízkych koncentrácii v plazme alebo interstíciu.
Úvod
Mechanizmy toxického účinku etanolu pri jeho chronickom príjme boli predmetom mnohých
štúdií. Etanol je výrazným induktorom oxidačného stresu. Protektívne účinky antioxidantov v tomto
kontexte sa potvrdili v mnohých štúdiách (Ďuračková et al., 1993). Vitamín C je pre človeka
esenciálnou látkou. Je potrebný na syntézu proteínov.
V práci ukazujeme iný účinok vitamínu C voči toxickým účinkom etanolu. Cieľom práce je
sledovanie štruktúrnych a mechanických zmien monovrstvy dipalmitoyl-fosfatidylcholínu (DPPC) na
subfáze etanol – voda po pridaní vitamínu C.
Materiál a metódy
Na meranie sme použili rovnaké meracie zariadenie ako v práci Weis et al. (2006).
Koncentrácia vitamínu C je 100mM/l.
Výsledky a diskusia
Pri monovrstve DPPC na subfáze etanol – voda dochádza k adsorpcii/ absorpcii molekúl
etanolu na fosfátocholínovú (PO2) skupinu molekuly DPPC (obr.1). Po pridaní vitamínu C do roztoku
etanol – voda pozorujeme, že molekuly vitamínu C ovplyvňujú interakciu molekúl etanolu s
molekulami monovrstvy DPPC (resp. PO2 skupinou).
Obr. 1. Etanol sa viaže na fosfátocholínovú skupinu molekuly DPPC, čím vytláča vodu z jej pozície
(detail vpravo). V – molekuly vody, E – molekuly etanolu, P – fosfátocholínová skupina molekuly
DPPC.
80
Výsledky merania ukazujú, že pri monovrstve DPPC na subfáze etanol – voda + vitamín C je
plocha molekuly DPPC väčšia ako pri monovrstve DPPC na subfáze etanol – voda.
Z grafu závislosti modulu pružnosti monovrstvy DPPC na vode, etanol + voda a etanol – voda
+ vitamín C sme zistili nárast modulu pružnosti DPPC monovrstvy na subfázach etanol - voda a etanol
– voda + vitamín C.
Výsledkom interakcie monovrstvy DPPC s molekulami vody a etanolu môže byť zmena
elektrického náboja povrchu membrány, mechanických vlastností, permeability a difúzie iónov cez
membránu. Patra et al. (2006) predpokladajú, že alkohol mení štruktúru membrány. Alkohol spôsobuje,
že proteíny membrány vytvárajú nevhodnú štruktúru, ktorá zabraňuje vykonávať ich fyziologickú
funkciu. Klemm et Williams (1996) zistili, že etanol mení usporiadanie molekúl vody okolo
fosfátocholínovej skupiny. Nadviazaním molekúl etanolu na túto skupinu sa molekuly vody posunú a
vytvoria nahromadenie okolo alkylovej skupiny alkoholu Chiou et al. (1992) pozorovali pomocou
FTIR spektroskopie, že po pridaní etanolu do roztoku reverzných micél tvorených DPPC je časť vody
nadviazaná vodíkovými väzbami na molekuly DPPC nahradená molekulami etanolu. Autori
konštatujú, že interakcia alkoholov s fosfátocholínovou skupinou lipidov membrán spôsobuje
slabnutie interakcie membrána – voda a destabilizuje membránu. Etanol spôsobuje dehydratáciu
biomembrán.
Vitamín C môže spôsobiť dva javy: a) molekuly vitamínu C interagujú s molekulami DPPC
alebo b) molekuly vitamínu C sa prednostne viažu na molekuly etanolu a tak zabraňujú nadväzovaniu
molekúl etanolu na molekuly DPPC. Predpokladáme, že molekuly vitamínu C ovplyvňujú molekuly
DPPC. Molekuly vitamínu C sa adsorbujú k monovrstve tvorenej molekulami DPPC a zabraňujú
nadväzovaniu molekúl etanolu.
Z výsledkov meraní plochy molekuly DPPC predpokladáme, že molekuly vitamínu C pôsobia
proti zmenšovaniu rozmeru obalu vytvoreného molekulami vody okolo fosfátocholínovej skupiny
molekuly DPPC.
Mechanické vlastnosti bunkovej membrány hrajú dôležitú úlohu v mnohých biologických
procesoch. Pružnosť membrány hovorí o jej mechanickej pevnosti. Mechanické vlastnosti sú do veľkej
miery ovplyvnené prítomnosťou molekúl etanolu, aj keď sa tieto molekuly priamo neabsorbujú do
monovrstvy. Zo získaných výsledkov merania pružnosti predpokladáme postupné zvyšovanie tuhosti
membrány. Vitamín C výrazne nezmenšuje tuhosť DPPC monovrstvy po adsorpcii molekúl etanolu.
Monovrstva tvorená molekulami DPPC na vode je pružnejšia a flexibilnejšia voči vonkajším
mechanickým vplyvom ako monovrstva DPPC na subfáze etanol – voda + vitamín C.
Podľa vyššie uvedených výsledkov uvažujeme o vplyve etanolu in vivo na funkciu
biomembrán. Otázkou však zostáva, do akej miery má etanol vplyv na fyziologickú funkciu
biomembrán in vivo, najmä v koncentráciách blízkych koncentrácii v plazme, respektíve v interstíciu.
Do akej miery sa môžu prejaviť jeho dehydratačné vlastnosti v živých systémoch? Ako model pre
úvahu môžu slúžiť práce zaoberajúce sa mechanizmom účinku celkových anestetík. Lipidová teória o
mechanizme účinku celkových anestetík a aj alkoholov predpokladá zmeny vo funkcii biomembrán.
Ak by mal etanol výraznejšie účinky na biomembrány, mohlo by ísť o jeden z mechanizmov toxicity
etanolu, ešte pred jeho oxidáciou na acetaldehyd. Ako bolo uvedené vyššie, dehydratáciou
biomembrány sa menia jej fyzikálne vlastnosti (permeabilita, difuzibilita) a biologické vlastnosti
vychádzajúce zo zmeny vo fyzikálnych vlastnostiach (zmeny funkcie proteínov).
Závery
Z nameraných hodnôt usudzujeme, že protektívny účinok vitamínu C môže spočívať aj v
súvislosti inej ako antioxidačnej. Domnievame sa, že môžeme očakávať analogický efekt aj v
podmienkach in vivo a in vitro. V našom experimente bol použitý vitamín C v prostredí bez
metabolizmu, ktorým by sa produkovali reaktívne radikály kyslíka. Neuplatňovali sa antioxidačné
účinky vitamínu C v relevantnej miere. Otázkou zostáva, či by sa účinok vitamínu C prejavil pri
fyziologickej funkcii membrán in vivo v koncentráciách blízkych koncentrácii v plazme alebo
interstíciu.
Poďakovanie
Táto práca bola podporovaná Agentúrou na podporu vedy a vývoja č. APVT-20-003104.
81
Použitá literatúra
1. Durackova, Z., Bergendi, L., Liptakova, A., Muchova, J.: Free radicals derived from oxygen, and medicine.
Bratisl Lek Listy. 94: 419–434, 1993.
2. Chiou, J.S., Krishna, P.R., Kamaya, H., Ueda, I.: Alcohols dehydrate lipid membranes: an infrared study on
hydrogen bonding. Biochim Biophys Acta. 1110: 225–233, 1992.
3. Klemm, W.R., Williams, H.J.: Amphiphilic binding site of ethanol in reversed lipid micelles. Alcohol. 13:
133–1388, 1996.
4. Patra, M., Salonen, E., Terama, E., Vattulainen, I., Faller, R., Lee, BW., Holopainen, J., Karttunen, M.: Under
the influence of alcohol: The effect of ethanol and methanol on lipid bilayers. Biophys J. 90: 1121–1135, 2006.
5. Weis, M., Kopan,i M., Jakubovsky, J., Danihel, L.: Ethanol and methanol induced changes in phospholipid
monolayer. Appl Surf Sci. 253: 2425–2431, 2006.
82
EGFR a onkológia?
Peter Michalka
Interné oddelenie, Národný onkologický ústav,Bratislava, Slovenská republika, [email protected]
Abstrakt
Nové terapeutické možnosti, ako napríklad ovplyvnenie EGFR receptora, naznačujú
možnú cestu v liečbe malígnych chorôb. EGFR (erbB1, receptor pre epidermový rastový
faktor) je jeden zo štyroch membránových proteínov známych ako HER1-4, ktorý hrá
kľúčovú úlohu v homeostáze normálnych tkanív a fetálneho vývaja organizmov. Zmeny
v tejto rodine receptorov vyúsťujú ku vzniku nádorových chorôb. U karcinómu pľúc ide
o bodovú mutáciu a u karcinómu prsníka dochádza k amplifikácii. EGFR je aktivovaný
rastovými faktormi (EGF, TGF-α) – ligandmi, ktoré sa viažu na extracelulárnu doménu
receptora. Pri aktivácii dochádza k autofosforylácii intracelulárnej tyrozínkinázovej domény.
Tím je zahájená signálna kaskáda, ktorou je prenesený signál až do jadra. V jadre sa
prenesená informácia prejaví aktiváciou transkripcie cieľových génov. Liečba založená na
inhibícii EGFR dokáže podľa doterajších výskumov inhibovať prenos proliferačných signálov.
Medzi ovplyvnenia EGFR patrí použitie monoklonových protilátok voľných alebo s
naviazanými toxínmi, či rádionuklidom, použitie tyrozínkinázových inhibítorov, antisense
oligonukleotidov alebo protinádorové vakcíny. V úvahe je aj génová terapia. V súčastnosti
sú k dipozícii najmenej 4 anti-EGFR monoklonové protilátky.
Ovplyvnenie EGFR receptora v liečbe malígnych chorôb nazývame ako cielenú liečbu. Tieto
nové terapeutické možnosti naznačujú možnú cestu v liečbe nádorových chorôb. Príchod neustále
nových informácií z oblasti molekulovej biológie a patogenézy nádorov nám naznačenú cestu
začínajú pomaly dláždiť a spriechodňovať.
EGFR (erbB1, receptor pre epidermový rastový faktor) je jeden zo štyroch proteínov skupiny
membránových proteínov známych ako HER1-4. Ďalšie proteíny sú erbB2 (HER2/neu), erbB3
(HER3) a erbB4 (HER4). Proteíny obsahujú extracelulárnu doménu a intracelulárnu kinázovú časť.
HER3 proteín je defektný, a preto potrebuje na dimerizáciu iného člena zo skupiny HER. HER2 nemá
prirodzený ligand a zvyčajne podlieha heterodimerizácii, ale môže aktivovať aj homodimerizáciu (vo
vysokých koncetráciách) aj pri absencii ligandu.
EGFR je transmembránový proteín ako už bolo povedané s extracelulárnou doménou,
transmembránovým lipidovým segmentom a intracelulárnou tyrozínkinázovou doménou. Tento
receptor je exprimovaný na všetkých epitelových bunkách a mnohých iných bunkách. EGFR ako
súčasť rodiny epidermových receptorov rastových faktorov, hrá kľúčovú úlohu v homeostáze
normálnych tkanív a fetálneho vývaja organizmov. Zmeny v tejto rodine receptorov sú sprevádzané
vznikom nádorových chorôb. Gén kódujúci EGFR patrí medzi protoonkogén sídliaci na chromozóme
7q22.
Protoonkogény sú gény, ktoré hrajú kľúčovú úlohu v kaskáde odovzdávania signálov
dôležitých pre proliferáciu, adhezivitu, migráciu a dĺžku života buniek. Prerušenie tohto jemne
ladeného systému odovzdávania signálov môže viesť k malígnej transformácii buniek. Medzi
produkty protoonkogénov patria: rastové faktory, receptory pre rastové faktory, produkty potrebné
pre transdukciu mitogénnych signálov z bunkovej membrány cez cytoplazmu do bunkového jadra.
Modifikáciu alebo amplifikáciu protoonkogénov môžu zapríčiniť genetické zmeny vyvolané účinkom
chemických látok, radiáciou alebo vírusmi. Na zmenenú expresiu protoonkogénu stačí zmena v jednej
alele príslušného génu. Zmeny v géne môžu spôsobiť mutácie (najčastejšie bodové), amplifikácia
protoonkogénu alebo chromozómové translokácie.
U karcinómu pľúc ide o bodovú mutáciu (EGFR – erbB1) a u karcinómu prsníka dochádza
k amplifikácii (HER 2/neu – erbB2). Bodovou mutáciou EGFR – erbB1 dochádza ku vzniku
abnormálneho (skráteného) EGF receptora a ten je zodpovedný za tvorbu abnormálneho signálu pre
proliferáciu bunky. Aktivácia mutovaného HER1/EGFR iniciuje proliferáciu nádorových buniek a
rezistenciou k apoptóze. HER1/EGFR je pri karcinómoch často dysregulovaný. Zvýšená expresia
HER1/EGFR sa spája so zlou prognózou, lebo koreluje s progresiou nádoru do potencovaného
83
malígneho fenotypu. Z viac ako 200 štúdií v ktorých bol hodnotený vzťah expresie EGFR k prognóze
vyplýva, že u karcinómu hlavy a krku, vaječníkov, cervixu, močového mechúra a karcinómu
pažeráku je výrazne zvýšená expresia EGFR spojená s kratšou dobou do relapsu i kratším celkovým
prežívaním. U karcinómu žalúdka, prsníka, endometria a kolorektálneho karcinómu je prognóza na
základe expresie EGFR menej jednoznačná. U karcinómu hlavy a krku, cervixu, vaječníkov a
močového mechúra bol EGFR potvrdený aj ako nezávislí prognostický faktor. Existuje taktiež
spojenie medzi zvýšenou expresiou receptorov rodiny EGFR a rezistencii k hormonálnej terapii,
chemoterapii a rádioterapii.
EGFR je aktivovaný rastovými faktormi (EGF, TGF-α) – ligandmi, ktoré sa viažu na
extracelulárnu doménu receptora. Pri aktivácii dochádza k autofosforylácii intracelulárnej
tyrozínkinázovej domény. Táto fosforylácia vedie k dimerizácii receptorov. Tím je zahájená signálna
kaskáda, v ktorej je rada na seba nadväzujúcich fosforylácii, a takto je prenesený signál až do jadra.
V jadre sa prenesená informácia prejaví aktiváciou transkripcie cieľových génov. V kaskáde
intracelulárnych signálov pri aktivácii EGFR je aj účasť proteínkináz MAPK a P13K/Akt, ktoré vedú
k proliferácii, rezistencii k apoptóze a zvýšenej tendencii k angiogenéze.
V posledných prácach sa uvádza, že mutácie KRAS môžu byť prediktývnym faktorom
úspechu alebo neúspechu liečby tzv. cielenou liečbou. Tento vzťah bol najlepšie pozorovaný
u kolorektálneho karcinómu, kde mutácia KRAS predurčuje vo väčšom percente neúspech cielenej
liečby a kratšie prežívanie pacientov. Preto v španielsku týmto pacientom nie je ani cielená liečba
ponúknutá. U karcinómu pľúc tento vzťah zatiaľ nebol pozorovaný resp. potvrdený.
Iné gény môžu slúžiť ako biomarker, ktorý môže predurčiť typ liečby a prežívanie pacientov.
Ako napríklad gén BRCA1, ktorý sa spája s karcinómom prsníka. Najnovšie práce poukazujú na to,
že vysoká expresia BRCA1 u nemalobunkového karcinómu pľúc poukazuje na zlú odpoveď tumoru
pri liečbe platinovými derivátmi. Títo pacienti lepšie odpovedajú ak je v liečbe Taxán. Taktiež
poukazuje na kratšie obdobie do recidívy tumoru a vyššiu úmrtnosť.
Liečba založená na inhibícii EGFR dokáže podľa doterajších výskumov inhibovať prenos
proliferačných signálov. Preto vývoj liekov tejto skupiny dodáva nádej v liečbe onkologických
chorôb. Medzi ovplyvnenia EGFR patrí použitie monoklonových protilátok voľných alebo s
naviazanými toxínmi, či rádionuklidom, použitie tyrozínkinázových inhibítorov, antisense
oligonukleotidov alebo protinádorové vakcíny. V úvahe je aj génová terapia.
V súčastnosti sú k dipozícii najmenej 4 anti-EGFR monoklonové protilátky. Výsledky
klinickej štúdie I. fázy však boli sklamaním lebo pri použití myších protilátok sa u pacientov vytvárali
protilátky HAMA (human anti-mouse antibody), ktoré myšie protilátky neutralizovali. Následne bola
vytvorená chimerická monoklonová protilátka C225 (cetuximab). Výhodou celkovo alebo čiastočne
humanizovaných protilátok je dlhší polčas rozpadu, minimálny vývoj protilátok proti monoklonovým
protilátkam (HAMA) a výrazne zlepšená aktivácia imunitného systému pacienta. Výhodou liečby
monoklonovými protilátkami je nulová hematologická a gastrointestinálna toxicita. U pokročilých
chorôb sa monoklonovými protilátkami dosahuje často stabilizácia. Do tejto skupiny patrí napr.
Cetuximab.
Ako už bolo spomínané monoklonové protilátky môžu byť využité ako nosiče rádioaktívneho
izotopu alebo toxínu. Po naviazaní protilátka dôjde k aktivácii receptora a zároveň je internalizovaný
toxín, ktorý nádorovú bunku usmrtí. V prípade naviazaného rádioaktívneho izotopu je zdroj žiarenia
v priamom kontakte s nádorovou bunkou a môže ju zničiť. Tieto protilátky okrem liečebného účinku,
môžu byť využité aj na diagnostiku. Predklinicky sa overujú možnosti využitie imunotoxínov
naviazaných na monklonovú protilátku proti EGFR. Ako imunotoxín sa skúša pseudomonádový
exotoxin A. Vzhľadom k nevyhnutnej internalizácie toxínu sú využívané fragmenty protilátky
(variabilná časť ťažkého a ľahkého reťazca protilátky), na ktorú je exotoxín naviazaný. Priechod
bunkovou membránov je takto uľahčený, a takto konštruovaný toxín má výraznú protinádorovú
aktivitu. Pilotné štúdie sa robia u karcinómov pľúc. Využiteľnosť imunotoxínov je však často
obmedzená z dôvodu malého účinku a výraznejšej toxicity.
Behom posledného desaťročia bolo vytvorené veľké množstvo inhibítorov blokujúcich
tyrozínkinázovú aktivitu EGFR. Malé molekuly týchto aktívnych látok sa kompetitívne viažu na
väzobné miesto pre makroergický fosfát ATP na intracelulárnu doménu EGF receptora. Takto dôjde
k zablokovaniu fosforylácie a prenosu signálu. V tejto skupine sú perorálne lieky s veľmi dobrou
toleranciou. Nežiadúcimi účinkami sú hnačky a kožná toxicity. Ďalšie analýzy štúdií ukázali, že bol
vyšší efekt u žien, u japonských pacientov a pri histologickom type bronchoalveolárny karcinóm. Do
tejto skupiny liečiv patrí Cefitinib (ZD1839, Iressa), Erlotinib (OSI-774, Tarceva, CP-358).
84
Antisense oligonukleotidy ovplyvňujúce expresiu receptoru pre epidermový rastový faktor sú
krátke jednoreťazové sekvencie oligonukleotidov komplementárnych ku známej sekvencii báz
cieľovej mRNA. Zmyslom týchto látok je znížiť expresiu určitého génu. Ako EGFR, tak aj jeho
ligandy (TGF-α, EGF) môžu byť cielom tejto liečebnej stratégie. Z predklinických výskumov in vitro
vyplýva, že použitie EGFR antisense oligonukleotidov vedie ku zníženiu expresie EGFR, ihibície
proliferácie nádorových buniek a indukcii apoptózy. Tento účinok môže byť zosilnený súčasným
použitím cytostatík. Uplatnenie v klinickej praxi však tieto látky zatiaľ nenašli.
Záverom možno povedať, že liečba ovplyvnením EGFR prináša nádej pre pacienta a začína
písať nové kapitoly liečby a prežívania pacientov. Novú nádej v liečbe hrá aj molekulová biológia
a zdá sa, že onedlho za pomoci metód molekulovej biológie bude môcť ušiť liečbu na mieru pre
každého pacienta.
Použitá literatúra
1. Adam, Z., Vorlíček, J., Kostíková, J. et al: Obecná onkológia a podporná liečba. Vydavateľstvo Grada, Praha,
2003.
2. Variola, R.: Čo dnes vieme o chemoterapii pokročilého nemalobunkového karcinómu pľúc. Vydavateľstvo
Osveta, Martin, 2005.
3. Chustecka, Z.: BRCA1 Expression May Guide Chemotherapy for NSCLC. Conference Coverage, Medscape
Hematology-Oncology, September 2007.
4. Dacic, S., Flanagan, M., Cieply, K., Ramalingam, S., Luketich, J., Belani, Ch., Yousem, S.A.: Significance of
EGFR Protein Expression and Gene Amplification in Non-Small Cell Lung Carcinoma. Journal Article, Am J
Clin Pathol, June 2006.
5. Kelly, K.: Is It Time to Consider the Implications of Sequencing EGFR-Targeted Therapy With Other
Targeted Agents? www.medscape.com, Slide/Lecture Presentation, September 2007.
6. Mladosievičová, B.: Patofyziológia nádorových chorôb. In: Hulín et al: Patofyziológia, Slovak Academic
Press, Bratislava: 120-137, 1998.
7. Tsuta, K., Takano, T., Fukui, T., Yokozawa, K., Sakamoto, H., Yoshida, T., Maeshima, A.M., Shibata, T.,
Furuta, K., Ohe, Y., Matsuno, Y.: Detection of EGFR Mutations in Archived Cytologic Specimens of NonSmall Cell Lung Cancer Using High-Resolution Melting Analysis. Journal Article, Am J Clin
Pathol, October 2006.
8. www.cancernetwork.com
85
Polymorfizmus HLA-DQB1 pri oligoartritickej forma juvenilnej idiopatickej artritídy
(JIA)
Zuzana Párnická1, Eva Košková2, Ivana Shawkatová1
1
Univerzita Komenského v Bratislave, Lekárska Fakulta, Imunologický ústav, Bratislava; 2Národný ústav
reumatických chorôb, Piešťany, Slovenská Republika, [email protected]
Abstrakt
Cieľom práce bolo porovnanie alelovej frekvencie lokusov HLA DQB1 u pacientov
trpiacich oligoartritickou formou juvenilnej idiopatickej artritídy (JIA) s alelovou frekvenciou
v zdravej slovenskej populácii. Vyšetrovaný súbor predstavovalo 30 pacientov
trpiacich oligoartritickou formou JIA. Diagnóza bola stanovená na podklade kritérií ILAR
(The International League of Associations for Rheumatology). Kontrolnú populáciu
predstavoval súbor 143 osôb. Autori na určenie HLA alel použili metódu PCR-SSP
(polymerázová reťazová reakcia so sekvenčne špecifickými primermi). Na štatistické
vyhodnotenie použili Fisherov exaktný test. Vo vyšetrenom súbore sme zaznamenali vyšší
výskyt aliel HLA-DQB1* 04 a *05. Výskyt HLA-DQB1* 02 bol výrazne nižší v porovnaní
s kontrolou.
Úvod
Podľa klasifikácie ILAR, juvenilná idiopatická artritída (JIA) predstavuje ochorenie detského
veku (tj. začína pred 16. rokom života ) neznámej etiológie, ktoré charakterizuje artritída pretrvávajúca
viac ako 6 týždňov. Pacienta zaraďujeme do jedného zo siedmych subtypov prípadne do skupiny
„nezaradených“ šesť mesiacov po stanovení diagnózy JIA1. Tieto podskupiny sa líšia počtom
postihnutých kĺbov na začiatku ochorenia, resp. ďalšími klinickými a laboratórnymi nálezmi2.
Na genetickej determinácii JIA sa podieľajú aj gény hlavného histokompatibilného komplexu
(HLA). Gény HLA predstavujú najpolymorfnejší systém ľudského genómu.
Cieľom našej práce bolo porovnanie alelovej frekvencie lokusov HLA DQB1 u pacientov
trpiacich oligoartritickou formou JIA s alelovou frekvenciou v zdravej slovenskej populácii4. Tieto
výsledky v diskusii porovnávame s dátami získanými z iných svetových pracovísk.
Spojitosť medzi HLA a JIA je známa už od sedemdesiatych rokov 20. storočia3. Na Slovensku
táto téma v súvislosti s HLA alelami triedy II nebola komplexne spracovaná. Prehľad asociácií HLA a
JIA nájdeme napr. v prácach Bošáka2, Černej, Alberta a Scholza1, Thomsonovej8. Uvádza sa, že
oligoartritická forma (pauciartikulárna forma) JIA je asociovaná s HLA-DQB1* 0301 a 0402.
Materiál a metódy
Vyšetrili sme súbor 30 pacientov trpiacich oligoartritickou formou juvenilnej idiopatickej
artritídy. Chorí sú v zdravotníckej starostlivosti NÚRCH v Piešťanoch. Vek pacientov sa pohyboval
od 4 do 16 rokov. Diagnóza bola stanovená na podklade kritérií ILAR. Kontrolnú populáciu
predstavoval súbor 143 zdravých nepríbuzných osôb5.
Metódy DNA-typizácie majú na pracoviskách Lekárskej fakulte UK bohatú tradíciu a viedli
k vyriešeniu problémov, ktoré by boli inými metódami nemožné alebo len ťažko realizovateľné, napr.
v práci Repiskej a kol.8. Z dôvodov veľkej presnosti HLA alely (určovali metódou PCR-SSP
(polymerázová reťazová reakcia so sekvenčne špecifickými primermi)7; sondy pochádzali z firmy
Olerup SSPAB, Švédsko.
Štatistické vyhodnotenie sme robili Fisherovým exaktným testom.
Výsledky a diskusia
Pri určovaní DQ-alel sme zistili zvýšenú frekvenciu HLA-DQB1*04 (6,7% u pacientov s JIA
oproti 4,5% v zdravej populácii, p = 0,5129, odds ratio /OR/ = 1,44) a HLA-DQB1*05 (28% u
pacientov s JIA oproti 19,6% v zdravej populácii, p = 0,1609, odds ratio /OR/ = 1,44) (Tab. 1).
Výrazne znížená bola frekvencia HLA-DQB1*02 (13% u pacientov s JIA oproti 21% v zdravej
populácii, p = 0,2, odds ratio /OR/ = 0,63). Výsledky odzrkadľujú tendenciu naznačenú aj v prácach
86
iných autorov (3 a 9). Žiaden z výsledkov Fisherovho testu nedosiahol signifikantnú úroveň, ale
naznačil trend, ktorý je charakteristický aj v iných populáciách.
HLA- DQ sú vo väzbovej nerovnováhe s alelami HLA-DRB1. Znamená to, že z rozdielov
frekvencií medzi chorými a kontrolou sa nedá usúdiť, či asociácia s DQ je primárna alebo je iba
odrazom asociácie s DR. Objasnenie tejto skutočnosti si bude vyžadovať ďalší výskum.
HLA-DQB1 poč.
Frekvencia
a=60
*0201-3
8
f pac.
0,1333
f kontr.
0,2098
Fisher (p)2-str. OR
0,2085
0,6303
*0301-13
20
0,3333
0,3426
1
0,9738
*0401-2
4
0,0667
0,0455
0,5129
1,444
*0501-4
17
0,2833
0,1958
0,1609
1,444
*0601-20
11
0,1833
0,2063
0,7258
0,8827
Tab.1. Frekvencia aliel HLA-DQB1 slovenských pacientov s oligoartritickou formou JIA.
Závery
Naše výsledky sú v zhode s výsledkami autorov z iných krajín. Najvyššia bola frekvencia aliel
HLA-DQB1*04 a najnižšia HLA-DQB1*02.
Poďakovanie
Práca bola podporená grantom VEGA1/3437/06.
Použitá literatúra
1. Albert, E.D., Scholtz, S.: Juvenile arthritis: genetic update. Bailliére s Clin Reumatol. 12: 209–18, 1998.
2. Bardfeld, R.: Juvenilní idiopatická artritida. In: Rovenský, J., Pavelka, P. (eds.) Klinická reumatológia. Osveta,
Martin. 253–264, 2000.
3. Bošák, V.: Imunogenetika reumatických chorôb. In: Rovenský, J. (ed.) Reumatológia v teórii a praxi IV.
Osveta, Martin. 191–209, 1996.
4. Bošák, V.: HLA- systém a jeho význam v revmatologii. In: Pavelka, K., Rovenský, J. Klinická revmatologie.
110, 2003
5. Buc, M., Nyulassy, Š., Štefanovič, J., Michalko, J., Mozolová, D.: HL-A system and juvenile rheumatoid
arthritis. Tissue Antigens. 4: 395–397, 1974.
6. Fazekašová, H., Shawkatová, I., Buc, M., Ferenčík, S.: Frekvencia alel lokusov HLA-DRB1 a HLA-DQB1 v
slovenskej populácii. Bratisl lek Listy. 99(11): 601–604, 1998.
7. Olerup, O., Zetterquist, H.: HLA-DR typing by PCR amplification with sequence-specific primers (PCR-SSP)
in 2 hours: an alternative to serological DR typing in clinical practice including donor-recipient matchingin
cadaveric transplantation. Tissue Antigens. 39: 225–235, 1992.
8. Repiská, V., Vojtaššák, J., Danihel, Ľ., Korbeľ, M., Böhmer, D., Malová, J., Zábudlá, K.: Application of DNA
polymorphism analysis to detection of complete hydatidiform mole origin. Biologia. 58(3): 403–408, 2003.
9. Thomson, W., Donn, R.: Genetic epidemiology: Juvenile idiopathic arthritis genetics- What´s new? What´s
next? Arthritis Res. 4(5): 302–306, 2002.
87
Molekulárna a biochemická podstata peroxizómových dedičných ochorení
Robert Petrovič, Ján Futas, Mária Fischerová, Katarína Kolejáková, Jozef Adámať, Danka
Maceková, Ľubica Strháková, Pavol Ipóth, Ján Chandoga
Centrum lekárskej genetiky FNsP Bratislava, Slovenska Republika, [email protected]
Abstrakt
Peroxizómy predstavujú subcelulárne štruktúry, ktoré sa nachádzajú u eukaryotických
mikroorganizmov a vo väčšine buniek živočíšneho alebo rastlinného pôvodu. Metabolické
funkcie peroxizómov zahŕňajú oxidáciu širokého spektra látok za prítomnosti kyslíka. Z
hľadiska bunkovej patológie sú najvýznamnejšie procesy α a β-oxidácie karboxylových
kyselín, zvlášť významná je β-oxidácia karboxylových kyselín s veľmi dlhým reťazcom
(VLCFA), ktorá prebieha výlučne v peroxizómoch. Mutácie peroxizómových génov
spôsobujú závažné metabolické poruchy. V súčasnosti sú známe takmer dve desiatky
peroxizómových dedičných ochorení, ktoré sa rozdeľujú na generalizované (porucha
biogenézy peroxizómov) a na izolované defekty jednotlivých peroxizómových enzýmov.
Kombinovaná incidencia peroxizómových dedičných ochorení sa v Európe odhaduje na
1:10 000. Všetky ochorenia okrem X-viazanej adrenoleukodystrofie sa vyznačujú
autozómovo-recesívnym typom dedičnosti. V diagnostike peroxizómových dedičných
ochorení (PDO) sa využívajú biochemické a molekulárno-genetické metódy, ktoré zachytia
viaceré abnormality a zmeny prejavujúce sa na rôznych úrovniach postihnutého organizmu.
Táto škála metód umožňuje nielen postnatálnu, ale aj prenatálnu diagnostiku.
Úvod
Peroxizómy predstavujú subcelulárne štruktúry kategórie mikroteliesok, nachádzajú sa tak u
jednobunkových eukaryotov ako aj u väčšiny živočíšnych a rastlinných buniek. Peroxizómy sú
prítomné vo väčšine cicavčích buniek, ale ich veľkosť a množstvo je variabilné. Peroxizómy sú
okrúhle alebo oválne organely s veľkosťou 0,2 až 1 µm a obsahujú približne 50 enzýmov s vysokou
variabilitou v ich spektre a množstve, v závislosti od nutričných podmienok a vplyvu xenobiotík tzv.
peroxizómových proliferátorov. Peroxizómy vznikajú delením existujúcich štruktúr, po importe
proteínov alebo formovaním de novo. K biogenéze peroxizómov sú potrebné cytosólové bielkoviny,
membránové importné proteíny a typické zoskupenie aminokyselín v polypeptidových reťazcoch,
ktoré má charakter topogénneho signálu – PTS (peroxisomal targeting signal). Funkciu PTS
zabezpečuje C-koncový tripeptid zložený spravidla z aminokyselín serínu, lyzínu a leucínu (SKL
tripeptid - PTS1) alebo N-koncový PTS2 charakterizovaný konsenzom sekvencie AMK Arg-Leu/IleXXXXX-Gln/His-Leu (X-ľubovoľná AMK).
Pre biogenézu peroxizómov sú nevyhnutné membránové proteíny – peroxíny, kódované PEX
génmi. Rozsiahlymi štúdiami na kvasinkách sa identifikovalo 32 PEX – génov (Wanders and
Waterham, 2005). Produkty týchto génov sú nevyhnutné pre normálny import proteínov do
peroxizómov. Medzi tieto proteíny sa zaraďujú receptor pre PTS1 (kódovaný génom PEX5), receptor
pre PTS2 (kódovaný génom PEX7), ďalej sem patria rôzne proteíny zabezpečujúce kotvenie a stabilitu
receptorov, proteíny translokácie a ďalšie, ktoré sa zúčastňujú na peroxizómovej biogenéze.
Expresia jadrových génov kódujúcich peroxizómové proteíny je regulovaná nukleárnymi
receptormi, ktoré sú aktivované peroxizómovými proliferátormi (PPAR- peroxisome activated
receptors). C-doména týchto receptorov sa viaže na špecifickú oblasť promótorov peroxizómových
génov (PPRE – peroxisomal proliferator response elements) obsahujúcu najčastejšie tandemové
usporiadanie sekvencie TGACCT.
Mutácie peroxizómových génov často spôsobujú závažné metabolické poruchy. Metabolické
funkcie peroxizómov zahŕňajú oxidáciu širokého spektra látok za prítomnosti kyslíka, pričom
produkovaný peroxid vodíka môže byť degradovaný pomocou katalázy, respektíve využitý ďalej
v peroxidázovej reakcii. V reakciách katalyzovanými katalázou a superoxiddizmutázou sa bunky
pozbavujú toxického superoxidového aniónu (Wanders and Denis, 1992). Z hľadiska bunkovej
patológie sú najvýznamnejšie procesy α a β oxidácie karboxylových kyselín a syntéza plazmalogénov.
88
Zvlášť významná je β-oxidácia karboxylových kyselín s veľmi dlhým reťazcom, ktorá prebieha
výlučne v peroxizómoch.
V súčasnosti je známych 16 ochorení, ktorých príčinou je buď generalizovaná porucha
v biogenéze peroxizómov, alebo deficiencia jednotlivých peroxizómových enzýmov (tabuľka č.1).
Väčšina sa manifestuje neurologickými poruchami a všetky okrem X-viazanej adrenoleukodystrofie sa
vyznačujú autozómovo-recesívnym typom dedičnosti. Odhady o frekvencii výskytu peroxizómových
chorôb sú veľmi rozdielne, v západnej Európe sa odhaduje výskyt jedného prípadu na 10 000 - 20 000
novorodencov.
Peroxizómové poruchy sa členia do dvoch skupín podľa rozsahu poškodenia metabolických
funkcií. Skupinu A tvoria ochorenia s generalizovanou stratou peroxizómových funkcií, vyznačujúce
sa stratou alebo výrazným znížením počtu peroxizómov. Príčinou tejto skupiny chorôb je defektná
biogenéza peroxizómov. B skupina sa vyznačuje iba izolovaným defektom a stratou jednej
peroxizómovej funkcie (Moser, 2000).
Ochorenie
Skratka
Defektný proteín
Poruchy v peroxizómovej biogenéze
Zellwegerov syndróm
ZS
Peroxíny
Neonatálna
NALD
Peroxíny
adrenoleukodystrofia
Infantilná Refsumova choroba
IRD
Peroxíny
Rhizomelická
RCDP 1
Pex7p
chondrodysplázia punctata typ1
Hyperpipekolová acidémia
HPA
?
Defekty v jednotlivých peroxizómových proteínoch a enzýmoch
X-viazaná drenoleukodystrofia X-ALD
ALDP
Defekt Acyl-KoA oxidázy
ACOX1acyl-KoA oxidáza
(pseudo-neonatálna ALD)
deficiency
Defekt D-bifunkčného proteínu D-BP
D-BP/MF2/
deficiency
MFEII/D-PBE
Defekt 2-methylacyl-KoA
Racemase
AMACR
racemázy
deficiency
Rhizomelická
RCDP 2
DHAPAT
chondrodysplázia punctata typ2
Rhizomelická
RCDP 3
ADHAPS
chondrodysplázia punctata typ3
Refsumova choroba (defekt
ARD
Fytanoyl-KoA
fytanoyl-KoA hydroxylázy)
hydroxyláza
Primárna hyperoxalúria typ1
PH1
Alanín:glyoxylát
aminotransferáza
Mulibrey nanizmus
MUL
Trim37p
Akatalazémia
Kátaláza
Glutárová acidémia typ3
GA3
?
Gén
Chromozóm
MIM #
PEX-gény
PEX-gény
Viac lokusov
Viac lokusov
214100
214110
PEX-gény
PEX7
Viac lokusov
6q21-q22.2
202370
215100
?
?
266510
ABCD1
ACOX1
Xq28
17q25.1
300100
264470
HSD17B4
5q2
261515
AMACR
5p13.3-p12
604489
GNPAT
1q42.1-42.3
222765
AGPS
2q33
600121
PHYH/
PAHX
AGXT
10p15-p14
266500
2q37.3
259900
TRIM
CAT
?
17q22-23
11p13
?
253250
115500
?
Tab.1. Peroxizómové dedičné ochorenia.
Zmeny v biochemických parametroch pri peroxizómových ochoreniach sa rutinne využívajú
v diagnostike, zvlášť akumulácia VLCFA v plazme u pacientov s poruchou peroxizómovej biogenézy
(PBD), X-adrenoleukodystrofiou, s defektom Acyl-KoA oxidázy a D-bifunkčného proteínu je jav
ktorý si našiel veľmi skoré uplatnenie v diagnostike. Pre uvedené ochorenia je charakteristický nález
zvýšených hladín VLCFA v plazme – zvýšené sú hladiny kyseliny cerotovej (C26:0) a súčasne je
výrazne zvýšený pomer C26:0/C22:0 a taktiež C24:0/C22:0. Biochemická diagnostika sa dá
uskutočniť pomocou plynovej chromatografie. Pri určení definitívnej diagnózy sa ďalej využívajú
zmeny v plazmatických hladinách kyseliny fytánovej, pristánovej, pipekolovej ako aj prítomnosť
abnormálnych koncentrácii žlčových kyselín - THCA, DHCA. Keďže u viacerých peroxizómových
dedičných ochorení je defektná syntéza plazmalogénov, využívajú sa v diagnostike aj analytické údaje
o ich zastúpení v erytrocytoch. De novo syntéza plazmalogénov je nedostatočná u PBD a RCDP.
Oproti tomu u X-ALD a ďalších je biosyntéza neporušená.
Molekulárno-genetická analýza zahŕňa priame sekvenovanie zodpovedného génu, alebo
v prípade častej mutácie je možné využiť aj metódu PCR/RFLP. Medzi skríningové metódy patria
dHPLC (Montagna a kol., 2005) a SSCP (Lachtermacher a kol., 2000).
89
Materiál a metódy
Analýza karboxylových kyselín (VLCFA, fytánová a pristánová kyselina) v sére: VLCFA,
fytánová a pristánová kyselina boli zo séra alebo plazmy extrahované Folchovou metódou (Folch a
kol., 1957), následne derivatizované (metylované) (Lepage and Roy, 1986) a analyzované pomocou
GC/MS.
Analýza pipekolovej kyseliny v sére a moči: Derivatizácia – príprava N[O,S]-etoxykarbonyl
etyl esterov aminokyselín bola uskutočnená podľa Hušeka (1991). Celé spektrum aminokyselín
(vrátane pipekolovej kyseliny) sére a moča bolo analyzované pomocou GC/MS podľa Petroviča a kol.
(2005).
Analýza plazmalogénov v erytrocytoch: Hladiny plazmalogénov boli determinované na
základe pomerov C16:0 dimetylacetálov ku kyseline palmitovej (C16:0) a C18:0 dimetylacetálov ku
kyseline steárovej (C18:0) pomocou GC/MS s modifikovanou metodikou podľa Bjorkhema a kol.
(1986).
Molekulárna analýza génu ABCD1: cDNA slúžila ako templát pre 4 PCR reakcie, ktoré
pokrývali celý kódujúci úsek ABCD1 génu, ktorý je defektný pri X-ALD. PCR produkty boli priamo
osekvenované na automatickom genetickom analyzére ABI 310. Zistené nové, doposiaľ nepopísané
mutácie boli verifikované pomocou PCR/RFLP.
Molekulárna analýza vybraných exónov niektorých PEX génov: Vybrané exóny PEX génov PEX1 (13. 15. a 18. exón), PEX26 (1. a 2.), PEX6 (1.), PEX12 (2. a 3.), PEX10 (3. 4. a 5.) a PEX2 (4.)
boli amplifikované pomocou PCR (Steinberg a kol., 2004) a priamo osekvenované pomocou
automatického genetického analyzéra ABI 310.
Výsledky a diskusia
Poruchy v biogenéze peroxizómov, X-ALD, deficit ACOX a D-BP sa biochemicky
manifestujú zvýšenou hladinou kyseliny cerotovej (C26:0) a pomerov C26:0/C22:0 a C24:0/C22:0.
Zistené hodnoty diagnosticky významných parametrov VLCFA u kontrolných jedincov a pacientov
s peroxizómovým ochorením a ich porovnanie s publikovanými údajmi je zosumarizované v tabuľke
č.2. Na podklade výsledkov kontrolnej skupina boli stanovené následovné horné hranice referenčných
hodnôt (priemer + 2SD): C26:0 <0,037 µg/ml, C26:0/C22:0 <0,018, C24:0/C22:0 <1,08.
Počet vzoriek
Kontrolné vzorky
táto štúdia
131
Moser a kol. (1999)
29.000
Takemoto a kol. (2003)
50
Poruchy peroxizómovej biogenézy
táto štúdia
3
Moser a kol. (1999)
Takemoto a kol. (2003)
8
X-viazaná adrenoleukodystofia
táto štúdia
7
Moser a kol. (1999)
239
Takemoto a kol. (2003)
11
C26:0 [µg/ml]
C26:0/C22:0
C24:0/C22:0
0.21 ± 0.08
0.24 ± 0.16
0.17 ± 0.01
0.010 ± 0.004
0.014 ± 0.006
0.012 ± 0.005
0.85 ± 0.11
0.81 ± 0.09
1.04 ± 0.15
3.51 ± 0.88
3.66 ± 1.50
7.24 ± 3.22
0.458 ± 0.239
1.187 ± 0.723
1.34 ± 0.24
3.14 ± 0.64
1.22 ± 0.36
1.36 ± 0.48
1.14 ± 0.58
0.060 ± 0.027
0.066 ± 0.025
0.106 ± 0.045
1.61 ± 0.25
1.57 ± 0.25
2.01 ± 0.32
Tab.2. Hodnoty VLCFA u kontrol a pacientov s peroxizómovým ochorením.
Pipekolová kyselina sa akumuluje v moči a sére pacientov s poruchou biogenézy peroxizómov
(obrázok č.1). Pipekolová kyselina bola zvýšená u všetkých 3 PBD pacientov ako v sére (101, 26 a 21
µmol/l, ref. <5) tak aj v moči (53, 66 a 41 mmol/mol kretinínu, ref. <10), ale nezvýšená u pacientov s
izolovaným enzýmovým defektom. Veľmi významným je aj zistenie, že nedochádza k prekryvu
hodnôt pipekolej kyseliny u pacientov s PBD a referenčných vzoriek, čo umožňuje rutinnú
a spoľahlivú diagnostiku u generalizovaných peroxizómových ochorení zo vzoriek moča.
Analýza plazmalogénov v erytrocytoch v kombinácii s VLCFA analýzou dáva dôležitú
informáciu o charaktere peroxizómového ochorenia (či sa jedná o generalizovnú formu alebo
deficienciu jedného proteínu). Na obrázku č.1 je znázornený takmer úplný deficit plazmalogénov
v erytrocytoch u pacienta s PBD.
90
Obr. 1. GC-MS chromatogram plazmalogénov v erytrocytoch. Fyziologický záznam (vľavo)
a patologický (vpravo).
Pre toto závažné najfrekventovanejšie peroxizómové ochorenie vyznačujúce sa X-viazaným
recesívnym typom dedičnosti je charakteristické zvýšenie hladín VLCFA v sére. Na našom pracovisku
sme zachytili 5 nepríbuzných rodín s X-ALD a u každej sa vyskytla privátna mutácia (tabuľka č.3).
# číslo rodiny pacient
#1 proband
#1 brat
#2 proband
#2 matka
#3 proband
#3 matka
#3 stará matka
#4 proband
#5 proband
#5 brat
kontrolné vzorky
VLCFA (GC-MS)
C26:0
C26:0/
C24:0/
[µg/ml]
C22:0
C22:0
1.34
0.036
1.44
1.57
0.112
1.65
1.19
0.048
1.58
0.35
0.020
1.16
1.73
0.072
1.32
0.86
0.041
1.12
0.17
0.007
0.79
0.75
0.070
1.50
1.09
0.046
1.70
0.86
0.036
2.09
<0.39
<0.019
<1.05
Genotyp
Fenotypa
Terapiab
Nástup
ochorenia
R104G/R104G/L160P/L160P/WT
R324P/R324P*/WT
WT/WT
S633I‡/R660P‡/R660P/WT/WT
AMN
AMN
ADO
ADO
ccALD
ccALD
Asympt.
-
žiadna
žiadna
žiadna
žiadna
LO
LO
BMT
-
10 r.
15 r.
34 r.
22 r.
6 r.
7 r.
-
Tab. 3. Biochemický a molekulárny nález u X-ALD rodín zo Slovenska.
a
Fenotypy: ccALD-detská cerebrálna forma, AMN-adrenomyeloneuropathy, ADO-adultná forma,
Asympt- doteraz asymptomatická forma
b
Terapia: LO-Lorenzov olej, BMT – transplantácia kostnej drene
*mutácia vzniknutá de novo
‡ Mutácia u týchto pacientov popísaná aj predtým Dvořákovou a kol. (2001).
Príklad – Rodina č. 3: #3 proband: 27-ročný pacient, s prvými neurologickými prejavmi v 22-tich
rokoch. Neskoršie sa u neho vyvinula paraparéza, tažká demencia a apatia. U probanda bola zistená
mutácia v 2. exóne, c.971G>C (R324P), ktorá vytvorila restrikčné miesto pre NlaIV, matka je
heterozygotná pre túto mutáciu, ale matkina matka je homozygot pre divý typ (obrázok č.2).
Obr. 2. Molekulárna analýza ABCD1 v rodine č.3. Čiastkový chromatogram zachytávajúci novú
mutáciu c.971G>C (R324P) v ABCD1, ktorá vytvára restrikčné miesto pre NlaIV – šípka poukazuje
91
na miesto mutácie. (A) hemizygozný proband, (B) heterozygotná matka probanda , (C) probandova
stará matka (divý typ) (D) RFLP analýza – štiepenie 268 bp PCR produktu – mutantná alela (3
fragmenty 97, 95 a 76 bp), divý typ (2 fragmenty 173 a 95 bp). 1. dráha – 50 bp ladder; 2 – kontrola
proband; 3 – probandova stará matka; 4 – proband; 5 - probandova matka.
Závery
Podarilo sa nám zaviesť biochemické metódy založené na plynovej chromatografii spriahnutej
s hmotovou spektrometriou, pomocou ktorých sme dosiahli analýzu plazmalogénov v erytrocytoch,
pipekolovej kyseliny v sére a moči. Ďalej sme zdokonalili analýzu mastných kyselín s veľmi dlhým
reťazcom, kyseliny fytánovej a pristánovej v sére. Pomocou týchto metód sa nám podarilo
skompletizovať biochemický algoritmus diagnostiky dedičných peroxizómových ochorení. Zaviedli
sme digitonínový permeabilizačný test na kultivovaných fibroblastoch, pomocou ktorého je možné
zistiť poruchu v peroxizómovej biogenéze. Ďalej sme zaviedli a optimalizovali molekulovú analýzu
všetkých 10-tich exónov génu ABCD1 (pomocou priameho sekvenovania cDNA, ktorá bola získaná
reverzným prepisom príslušnej mRNA). Zistené mutácie sme verifikovali pomocou restrikčného
štiepenia (PCR/RFLP). Vybrané exóny génov PEX1, PEX2, PEX6, PEX10, PEX12 a PEX26 (celkovo
14 amplikónov) sme analyzovali pomocou sekvenovania PCR produktov, pre ktoré bola templátom
genómová DNA. Taktiež sme zaviedli PCR metódu na detekciu Pro12Ala polymorfizmu v PPARG
géne. Pomocou vyššie uvedených novozavedených metód sa nám podarilo identifikovať 4 nové,
doposiaľ nepopísané, mutácie v géne ABCD1 u pacientov s X-viazanou adrenoleukodystrofiou
a definitívne biochemicky alebo molekulárne potvrdiť diagnózu peroxizómového dedičného ochorenia
u viac ako 20-tich slovenských pacientov.
Použitá literatúra
1. Bjorkhem, I., Sisfontes, L., Bostrom, B., et al.: Simple diagnosis of the Zellweger syndrome by gas-liquid
chromatography of dimethylacetals. J Lipid Res. 27: 786–791, 1986.
2. Dvorakova, L., Storkanova, G., Unterrainer, G., et al. Eight novel ABCD1 gene mutations and three
polymorphisms in patients with X-linked adrenoleukodystrophy: The first polymorphism causing an amino
acid exchange. Hum Mutat. 18: 52–60, 2001.
3. Folch, J., Lees, M., Sloane Stanley, G.H.: A simple method for the isolation and purification of total lipides
from animal tissues. J Biol Chem. 226: 497–509, 1957.
4. Husek, P.: Amino acid derivatization and analysis in five minutes. FEBS Lett. 280: 354–360, 1991.
5. Lachtermacher, M.B., Seuanez, H.N., Moser, H.W., Smith, K.D.: One-step multiplex PCR strategy for
identification of mutations by SSCP and DNA sequencing. Biotechniques. 29: 234–236, 2000.
6. Lepage, G., Roy, C.C.: Direct transesterification of all classes of lipids in a one-step reaction. J Lipid Res. 27:
114–120, 1986.
7. Montagna, G., Di, B.A., Cappa, M., et al.: Identification of seven novel mutations in ABCD1 by a DHPLCbased assay in Italian patients with X-linked adrenoleukodystrophy. Hum Mutat. 25: 222, 2005.
8. Moser, A.B., Kreiter, N., Bezman, L., et al.: Plasma very long chain fatty acids in 3,000 peroxisome disease
patients and 29,000 controls. Ann Neurol. 45: 100–110, 1999.
9. Moser, H.W.: Molecular genetics of peroxisomal disorders. Front Biosci. 5: D298–306, 2000.
10. Petrovic, R., Futas, J., Chandoga, J., Jakus, V.: Rapid and simple method for determination of N(epsilon)(carboxymethyl)lysine and N(epsilon)-(carboxyethyl)lysine in urine using gas chromatography mass
spectrometry. Biomed Chromatogr. 19: 649–654, 2005.
11. Steinberg, S., Chen, L., Wei, L., et al.: The PEX Gene Screen: molecular diagnosis of peroxisome biogenesis
disorders in the Zellweger syndrome spectrum. Mol Genet Metab. 83: 252–263, 2004.
12. Takemoto, Y., Suzuki, Y., Horibe, R., et al.: Gas chromatography/mass spectrometry analysis of very long
chain fatty acids, docosahexaenoic acid, phytanic acid and plasmalogen for the screening of peroxisomal
disorders. Brain Dev. 25: 481–487, 2003.
13. Wanders, R.J., Denis, S.: Identification of superoxide dismutase in rat liver peroxisomes. Biochim Biophys
Acta. 1115: 259–262, 1992.
14. Wanders, R.J., Waterham, H.R.: Peroxisomal disorders I: biochemistry and genetics of peroxisome
biogenesis disorders. Clin Genet. 67: 107–133, 2005.
92
Detection of 4-amino-3-acetylquinoline induced DNA damage in murine L1210 and
NIH-3T3 cells using Comet assay
Andrej Repický, Soňa Jantová, Silvia Letašiová
Institute of Biochemistry, Nutrition and Health Protection, Faculty of Chemical and Food Technology, Slovak
University of Technology, Bratislava, Slovakia, andrej.repický@stuba.sk
Abstract
Quinolines are known to be multitarget agents with broad spectrum of biological
activity. In our previous study we showed that newly prepared 4-amino-3-acetylquinoline
(AAQ) possesses cytotoxic/antiproliferative effects on cancer cell lines HeLa and L1210 and
on non-cancer NIH-3T3 cells. In this study, we investigated genotoxic influence AAQ on
murine L1210 leukemia cells and non-cancer fibroblast NIH-3T3 cells. Results from Comet
assay showed that AAQ caused DNA damage which was concentration- and time-dependent.
Genotoxic effect on leukemia L1210 cells was higher than that on non-cancer NIH-3T3 cells.
Introduction
Quinoline derivatives are known to possess a variety of biological activities and represent the
basis for the preclinical and clinical development of novel antimalarial, antipsychotic and antitumor
agents. Some of these agents are in use as potent drugs and some are used in combination with other
anticancer drugs to overcome multidrug resistance of some tumors. Quinolines may induce cell cycle
arrest, generation of reactive oxygen spesies (ROS), disruption of mitochondrial membrane potential,
DNA single-strand breaks, activation of caspases and interact with DNA (Kaur et al. 2007, Shenoy et
al. 2007).
Based on above mentioned effects of quinoline a new series of substituted nitrogen atom
containing heterocyclic compounds was prepared for screening of their antibacterial and cytotoxic
activities in vitro. The strongest biological activities was found for 4-amino-3-acetylquinoline (AAQ).
AAQ induced concentration-dependent G2/M cell cycle arrest increasing with the time of treatment
and apoptotic death of L1210 cells. On the other hand, AAQ cytotoxic concentrations caused necrotic
death of NIH-3T3 cells. Here we report studies of the genotoxic effects of AAQ on leukemia L1210
cells and fibroblast cells NIH-3T3.
Materials and methods
The murine leukemia cell line L1210 and murine fibroblast cell line NIH-3T3 (Type Culture
Collection, Rockville, MD, USA) were used. They were grown in RPMI medium (L1210) or minimal
Eagle medium (NIH-3T3) supplemented with 10% fetal bovine serum and penicillin and streptomycin
(100 µg/ml) at 37°C in a 5% CO2 95% air humidified incubator. L1210 cells grew in suspension and
were subcultivated three times a week. The suspension of cells was blown and total cell number of
cells as their viability was stated. Before an uniform monolayer of NIH-3T3 cells was formed, cells
were freed from the surface of culture dish by 0.25% solution of trypsin and subcultivated two-three
times a week. Cell viability was determined by 0.4% Trypan blue exclusion test.
The studied 4-amino-3-acetylquinoline (fig. 1) was prepared by Cernuchova et al.(2005).
Chromatographically pure quinoline was dissolved directly in 100% dimethyl sulfoxide (DMSO), its
final concentration never exceeded 0.5% (v/v) in either control or treated cell samples. The solutions
of tested derivative were prepared freshly before each test. Culture media, fetal bovine serum and
antibiotics (penicillin G, streptomycin) were obtained from Biocom (Bratislava, Slovakia). Other
chemicals were purchased from Sigma (St Louis, MO, USA).
Fig. 1. Chemical structure of 4-amino-3-acethylquinoline.
93
Comet assay is based on the ability of DNA strand breaks to migrate in a weak electric field in
the direction of anode, giving the nucleus the appearance of the tail of a comet when visualised by
fluorescence microscopy. The procedure of Comet assay was used with minor changes suggested by
Slamenova et al. (1999) and Gabelova et al (1997). A base layer of 100 µl of 0.75% NMP agarose in
PBS buffer was placed on microscope slides. Cells were treated with quinoline in concentrations of
53.7, 26.9, 5.37, 0.54 and 0.054 µmol/l for 24 h. Treated as well as untreated (control) cells were
suspended in 0.75% LMP agarose. 85 µl of LMP agarose containing 2x104 cells was spread on the
base layer. Triplicate slides were prepared per sample. The agarose was allowed to solidify and the
slides were placed in lysis mixture (2.5 mol/l NaCl, 100 mmol/l, Na2EDTA, 10 mmol/l, Tris-HCl (pH
10.0) and 1% Triton X-100) at 4°C. The slides were transferred to an electrophoresis box containing
an alkaline solution at pH>13.0 (300 mmol/l NaOH, 1 mmol/l Na2EDTA) and kept in this solution for
40 min at 4°C for DNA strands to unwide. A voltage of 25 V (current of 300 mA) was applied for 30
min. The slides were removed, neutralised by 2x10 min washing in Tris-HCl (0.4 mmol/l, pH 7.5) and
stained with 20 µl ethidium bromide (EtBr, 10 µg/ml). EtBr stained nucleus were evaluated with a
Zeiss Jenalumar fluorescence microscope (magnification 200x). For each sample 100 comets were
scored by computerised image analysis (Comet 5.5 Europe, Kineting Imaging, Liverpool, UK) for
determination of DNA in tail, lineary related to the frequency of DNA strand breaks.
Results are shown as the arithmetic means ± standard deviations of the mean of three separate
experiments, each concentration was done in five Petri dishes. The significance of differences between
values acquired by Comet assay was evaluated by Student’s t-test, statistically different from control:
*p < 0.05, ** p < 0.01, *** p < 0.001.
Results and discussion
With the aim of obtaining new antitumor agents a series of seventeen substituted nitrogen
atom containing heterocyclic compounds was prepared. Previous testing of these compounds for
cytotoxic properties in vitro on four bacterial strains, four yeast strains and two filamentous fungi
strains has been reported. The antimicrobial activity was not found for AAQ. On the other hand, AAQ
manifested significant in vitro cytotoxic/antiproliferative effect on the cell line HeLa and L1210
(Černuchová et al. 2005, Repický et al. 2007). AAQ induced concentration-dependent G2/M cell cycle
arrest increasing with the time of treatment and apoptotic death of L1210 cells. AAQ elevated the
level of ROS, decreased the mitochondrial membrane potential and activated caspases-9 and -3 in
time-dependent manner. It can be concluded that AAQ induced apoptosis in L1210 cells through
mitochondrial/caspase-9/caspase-3-dependent pathway. No effect of AAQ on the cell cycle profile and
induction of apoptotic DNA fragmentation of NIH-3T3 cells was detected. On the other hand, AAQ
induced necrotic death of NIH-3T3 cells. However, cytotoxic effect of AAQ on non-cancer NIH-3T3
cells was two-four times weaker than on leukemia L1210 cells (Jantová et al. 2007, Repický et al.
2007). DNA damage could be one of the cause of cytotoxic effect of AAQ and therefore the aim of
present study was to examine the genotoxic effect of AAQ on murine leukemia L1210 cells and noncancer fibroblast NIH-3T3 cells.
The ability of AAQ to induce DNA damage was investigated using Comet assay. We
examined the formation of DNA damage induced by AAQ concentrations of 53.7, 26.9, 5.4, 0.54 and
0.054 µmol/l on L1210 and NIH-3T3 cells after 24 h treatment. As it is evident from Figure 2, the
level of direct DNA strand breaks increased proportionally to the increased concentration of used
derivative in both used cell line.
After comparing the genotoxic effects of AAQ on L1210 cells and on NIH-3T3 cells, as it is
shown in Table1, it can be concluded that leukemia L1210 cells are more sensitive to the tested
derivative than non-cancer fibroblast NIH-3T3 cells. The genotoxic effect of the highest tested
concentration of AAQ (53.7 µmol/l ) on L1210 cells was almost 60% while in NIH-3T3 it caused
approximately 37% of DNA damage.
94
**
50
40
30
20
**
60
% of D N A
dam age
*
**
40
**
*
***
% of D N A
dam age
80
20
10
0
0
NC 53.70 26.85 5.37 0.54 0.054
NC 53.70 26.85 5.37 0.54 0.054
concentration (µmol/l)
concentration (µmol/l)
A
B
Fig. 2. Detection of DNA damage in L1210 (A) and in NIH-3T3 (B) cells after 24 h treatment
with AAQ concentration of 53.70-0.054 µmol/l . NC is negative control (cells treated with 0.5%
DMSO). *** p < 0.001, ** p < 0.01, * p < 0.05.
A
AAQ concentration
% of damage
SD
NC
15.30
±0.60
53.7
59.41
±7.37
26.85
57.51
±3.91
5.37
39.89
±8.57
0.54
30.74
±2.91
0.054
16.94
±2.95
B
AAQ concentration
NC
53.7
26.85
5.37
0.54
0.054
% of damage
9.17
37.35
30.00
28.18
14.51
10.48
SD
±0.03
±4.20
±4.00
±1.05
±5.20
±0.64
Tab.1: Percentage values of DNA damage in L1210 (A) and in NIH-3T3 cells (B) after 24 h
treatment with AAQ concentration of 53.70-0.054 µmol/l. Values are the arithmetic means ± standard
deviations for three separate experiments, each concentration was done in five separate Petri dishes.
NC is negative control (cells treated with 0.5% DMSO).
Conclusion
AAQ is a new prepared quinoline which in our preliminary studies demonstrated
cytotoxic/antiproliferative effects on leukemia cell line L1210. In this work, the ability of AAQ to
induce DNA damage was examined on L1210 cells and non-cancer NIH-3T3 cells using Comet assay.
Based on the obtained results can be concluded that AAQ caused genotoxic effects. Induction of DNA
breaks in murine treated cells was concentration- and time- dependent. Comparison of percentage
values of DNA damage showed higher sensitivity of cancer L1210 cells than that in NIH-3T3 cells.
Acknowledgements
This study was supported by the Grant Agency for Science Research of the Ministry of
education of the Slovak Republic, VEGA number 1/1173/04 and Technology Assistance Agency
under the contract No. APVT 20-007304.
95
References
1. Černuchová, P., Vo-Thanh, G., Milata, V., Loupy, A., Jantová, S., Theiszová, M.: Utilization of 2ethoxymethylene-3-oxobutanenitrile in the synthesis of heterocycles possessing biological activity.
Tetrahedron. 61: 5379–5387, 2005.
2. Gábelová, A., Slameňová, D., Ružeková, Ľ., Farkašová, T., Horváthová, E.: Measurement of DNA strand
breakage and DNA repair induced with hydrogen peroxide using single cell gel
electrophoresis, alkaline
DNA unwinding and alkaline elution of DNA. Neoplasma. 44: 380–388, 1997.
3. Jantová, S., Repický A., Čipák, Ľ., Janikovicsová, M.: Cytotoxic activity of quinoline AAQ on
leukemia
cell lines. Zborník príspevkov: XXIV. Xenobiochemické sympózium 22.-24.5.2007
Liptovský Ján SR, 66,
2007.
4. Kaur, K., Patel, S.R., Patil, P., Jain, M., Khan, S.I., Jacob, M.R., Ganesan, S., Tekwani, B.L., Jain, R.:
Synthesis, antimalarial, antileishmanial, antimicrobial, cytotoxicity and methemoglobin (MetHB) formation
activities of new 8-quinolinamines. Bioorg Med Chem. 2: 915–930, 2007.
5. Repický, A., Jantová, S., Milata, V.: cytotoxic activity of novel synthetic heterocyclic compounds on
leukemia cell line L1210. Book of abstrakts from the conference Synthetic and natural compounds
in
cancer therapy and prevention. March 28-30. 2007 Bratislava SR, 70, 2007.
6. Shenoy, S., Vasania, V.S., Gopal, M., Mehta, A.: 8-Methyl-4-(3-diethylaminopropylamino) pyramido
[4´,5´;4,5] thieno (2,3-b) quinoline (MDPTQ), a quinoline derivative that causes ROS-mediated apoptosis in
leukemia cell lines. Toxicol Appl Pharmacol. 1: 80–88, 2007.
7. Slameňová, D., Tabelová, A., Ružeková, Ľ., Chalupa, I., Horváthová, E., Farkašová, T., Bozsakyová, E.,
Štětina, R.: Detection of MNNG-induced DNA lesions in mammalian cells; validation of comet assay against
DNA unwinding technique, alkaline elution of DNA and chromosomal aberrations. Mutat Res. 383: 243–252,
1999.
96
Polymorfizmus génu PSMB9 v slovenskej populácii
Ivana Shawkatová1, Vanda Repiská2
Univerzita Komenského v Bratislave, Lekárska fakulta, 1Imunologický ústav; 1Ústav lekárskej biológie
a genetiky, Bratislava, Slovenská Republika, [email protected]
Abstrakt
V génovej oblasti HLA sa nachádzajú okrem iných aj gény s účasťou na opracovaní
proteínov prezentovaných HLA-molekulami triedy I. Dva z týchto génov (PSMB9 a PSMB8)
kódujú enzýmové podjednotky proteazómového komplexu. Tieto gény sú polymorfné, i keď
podstatne menej ako klasické HLA-gény. Práve variabilita týchto génov je už dlhšie
predmetom skúmania pre jej potenciálny funkčný význam. Naším cieľom bolo zaviesť
metódu na genotypizáciu polymorfizmu lokusu PSMB9 a určiť frekvencie alel PSMB9 génu
v populačnej vzorke slovenskej populácie s perspektívou skúmať potenciálny vplyv
polymorfizmu génov PSMB v patogenéze autoimunitných chorôb. Frekvencie dvoch alel
génu PSMB9 a genotypové frekvencie sme určili v súbore 96 zdravých osôb. Distribúcia
zistených alel a genotypov v našej populácii nie je (podľa očakávania) signifikantne odlišná
od distribúcie v iných sledovaných kaukazoidných populáciách.
Úvod
V HLA-oblasti sa nachádzajú štyri gény zodpovedné za opracovanie antigénov
prezentovaných HLA-molekulami triedy I. Dva z týchto génov (PSMB9 a PSMB8, donedávna
označované ako LMP2 a LMP7) kódujú enzýmové podjednotky proteazómového komplexu, v ktorom
dochádza k degradácii proteínov na malé peptidy. Ďalšia dvojica (TAP1 a TAP2) kóduje transportné
proteíny prenášajúce vzniknuté peptidy k HLA-molekulám triedy I, ktoré ich prezentujú v imunitnej
odpovedi (Beck et al., 1992). Gény TAP a PSMB vykazujú určitú variabilitu a preto je predpoklad, že
rôzne alelové varianty sú zodpovedné za zmeny v opracovaní antigénu, ktoré môžu v konečnom
dôsledku viesť k vzniku autoimunitných chorôb. Funkčný význam polymorfizmu týchto génov nie je
definitívne jasný a je stále predmetom skúmania.
Gén PSMB9 má iba 2 alely, ktoré sa líšia nukleotidovou substitúciou guanínu za adenín v
pozícii 194. Výsledkom je aminokyselinová substitúcia histidínu za arginín v kodóne 60. Tieto dve
alely sú v literatúre označované písmenami H/R (Powis et Teisserenc 1997).
Vyšetrovaný súbor a metódy
Na Imunologickom ústave LF UK sme v priebehu ostatných rokov zozbierali vzorky DNA
získané od nepríbuzných zdravých osôb slovenskej populácie (väčšinou dobrovoľných darcov krvi
alebo kostnej drene z rôznych oblastí Slovenska z Kliniky hematológie a transfúziológie Fakultnej
nemocnice v Bratislave). Z tohto súboru náhodne vybraných vzoriek zdravej populácie sme čerpali pri
rôznych populačných štúdiách v HLA-oblasti ako aj pri populačnej analýze polymorfizmu génu
PSMB9 (Čechová et al., 1998). Vzorky boli získané s informovaným súhlasom zúčastnených osôb.
Genómovú DNA sme izolovali z periférnej krvi postupom, ktorý je modifikáciou štandardnej
vysoľovacej metódy (Miller et al. 1988).
Typizáciu génu PSMB9 sme uskutočňovali pomocou metódy PCR-RFLP. Gén PSMB9 sme
najprv amplifikovali metódou PCR a následne štiepili restrikčným enzýmom Cfo I. Ak v sekvencii
nukleotidov bolo prítomné restrikčné miesto (substitúcia G za A v nukleotide 194), štiepením vznikli
dva menšie fragmenty (Powis et Teisserenc 1997). PCR amplifikácia prebiehala v celkovom objeme
25 µl v 0,2 ml PCR-platničkách na termálnom cykleri PTC-100™-MJ Research Inc. (USA). Reakčná
zmes obsahovala genómovú DNA (100 ng), pár oligonukleotidových primerov so sekvenciami 5´GGC AGT GGA GTT TGA CGG - 3´ a 5´- GGC TGT CGA GTC AGC ATT C - 3´ (po 50 pM),
deoxynukleozidtrifosfáty (po 100 µM z každého), Taq-polymerázu (0,15 U) a tlmivý roztok (50 mM
KCl, 1,5 mM MgCl2). Teplotný algoritmus amplifikácie bol nasledovný: horúci štart 5 min pri 94,5
°C, 30 cyklov pozostávajúcich z troch krokov: 1. denaturácia 1 min pri 94 °C, 2. hybridizácia 6 min
pri 59 °C, 3. syntéza DNA 1 min pri 72 °C, na záver syntéza DNA 10 min pri 72 °C.
97
Amplifikovaný fragment s dĺžkou 2 255 bp sme štiepili restrikčným enzýmom Cfo I (Gibco,
Anglicko) vo výslednom objeme 15 µl reakčnej zmesi v zložení: 9 µl produktu PCR, 10 U enzýmu
Cfo I, 1,5 µl 10x reakčného tlmivého roztoku pre enzým, 3,5 µl redestilovanej vody. Reakcia
prebiehala v mikroskúmavkách 2 hod. pri teplote 37 °C. V prípade prítomnosti restrikčného miesta
vznikli dva fragmenty s dĺžkou 1167 bp a 1088 bp, prislúchajúce alele označovanej písmenom H,
resp.R (obr.1). Fragmenty sme vizualizovali na UV-transiluminátore po elektroforetickej separácii v
1,5 % agarózovom géli (1 hod pri napätí 5 V/1 cm gélu). Pre lepšiu orientáciu sme používali 100 bp
marker relatívnej molekulovej hmotnosti.
Obr. 1. Výsledok typizácie PSMB9 génu metódou PCR-RFLP po elektroforéze v 1,5 % agarózovom
géli: 1 - genotyp HH, 2 - genotyp HR, 3 - genotyp RR.
Výsledky a diskusia
Na našom pracovisku sme zaviedli metódu PCR-RFLP na typizáciu dimorfizmu génu PSMB9,
pričom sme vychádzali z údajov publikovaných v literatúre (Powis et Teisserenc 1997). Frekvencie
dvoch alel génu PSMB9 a genotypové frekvencie sme určili v súbore 96 zdravých osôb. Zistili sme, že
v našej populácii má alela označovaná písmenom H frekvenciu 32,8 % a alela R frekvenciu 67,2 %
(tab. č. 1). Pre porovnanie uvádzame aj frekvencie alel v niektorých iných populáciach (prehľadne
Rueda Faucz et al. 2000). Distribúcia alel v našej populácii nie je (podľa očakávania) signifikantne
odlišná od distribúcie v iných sledovaných kaukazoidných populáciach. Genotypové frekvencie sú
uvedené v tabuľke č. 2. Rovnako distribúcia jednotlivých genotypov nie je štatisticky preukazne
odlišná od distribúcie pozorovanej v kaukazoidnej populácii USA (Maksymowych et al. 2000).
Frekvencie genotypov sú v súlade s Hardyho – Weinbergovým zákonom.
alela
f (KAN)
f (FRA)
f (USA)
f (SEN)
f (SLO)
(n = 420)
(n = 324)
(n = 372)
(n = 234)
(n = 192)
24,0
24,5
26,0
34,0
PSMB9*H
32,8
76,0
74,5
74,0
66,0
PSMB9*R
67,2
Tab. 1. Frekvencie alel PSMB9 v slovenskej populácii v porovnaní s frekvenciami v iných
populáciách. SLO-slovenská, KAN-kanadská, FRA-francúzska, USA-kaukazoidná z USA, SENsenegálska, f – alelová frekvencia (%), n – počet vyšetrených alel.
genotyp
f (SLO)
(2n = 96)
f (USA)
(2n = 282)
PSMB9*HH
PSMB9*HR
PSMB9*RR
7,4
15,6
38,7
34,4
53,9
50,0
Tab. 2. Frekvencie genotypov PSMB9 v slovenskej populácii a v kaukazoidnej populácii USA. SLOslovenská, USA-kaukazoidná z USA, f – genotypová frekvencia (%), 2n – počet vyšetrených osôb.
Pre analýzu mikropolymorfizmu PSMB-oblasti sme sa rozhodli z viacerých dôvodov.
Distribúcia alel PSMB9 v našej populácii ešte nebola sledovaná. Populačno-genetické štúdie sú
jedným z prostriedkov skúmania evolučného a funkčného významu genetického polymorfizmu. Ďalej,
vzhľadom na biologickú funkciu produktov PSMB-génov, môžeme predpokladať ich vplyv vo vzťahu
98
k autoimunitných chorobám. Variabilita, prejavujúca sa zámenou histidínu za arginín v podjednotke
proteazómu, môže teoreticky ovplyvňovať štiepenie peptidov (napr. veľkosť výsledných fragmentov)
a tým aj celú prezentáciu antigénu. Môžeme tiež uvažovať tak, že keďže sú gény PSMB lokalizované
v oblasti HLA triedy II, dá sa predpokladať ich synergetické pôsobenie s klasickými HLA-génmi
(Djilali-Saiah at al. 1996).
Otázku funkčného významu variability génov PSMB, resp. TAP je možné skúmať aj na úrovni
ich produktov - pomocou analýzy spektra generovaných, (resp. transportovaných a prezentovaných)
peptidov. Napríklad podľa Quadriho a Singala (1998) polymorfizmus génu TAP1 ovplyvňuje selekciu
peptidov v ľudských lymfoblastoidných a nádorových líniách. V ostatných rokoch vzniklo niekoľko
prác skúmajúcich vzťah PSMB, resp. TAP génov k autoimunitným chorobám. Prvé publikácie
poukazovali na ich asociáciu s viacerými autoimunitnými chorobami (napr. s diabetes mellitus I. typu
a reumatoidnou artritídou) (Caillat-Zucman et al. 1993, Deng et al. 1995). Vzápätí niektorí kritici
poukazovali na to, že rozdielne frekvencie TAP, resp. PSMB alel v súboroch pacientov oproti zdravej
populácii často vyplývajú z väzbovej nerovnováhy s klasickými HLA lokusmi, primárne
asociovanými so sledovanou chorobou (Chauffert et al. 1997, Heward et al. 1999). Dokazujú to štúdie,
v ktorých autori pri interpretácii výsledkov zohľadnili existenciu silnej väzbovej nerovnováhy medzi
niektorými lokusmi HLA oblasti triedy II (Djilali-Saiah et al. 1996). Sia (2005) novšie publikoval
prácu vychádzajúcu z viacerých nezávislých štúdií, v ktorej dokazuje nezávislý vplyv TAP a PSMB
génov na vznik autoimunitného diabetu. PSMB-gény zohrávajú úlohu aj v patogenéze ankylozujúcej
spondylitídy. Polymorfizmus génu PSMB9 pravdepodobne ovplyvňuje fenotyp choroby a to nezávisle
na polymorfizme iných HLA-lokusov (Maksymowych et al. 2000). Vznikli aj ďalšie zaujímavé práce
nasvedčujúce tomu, že variabilita v TAP a PSMB oblasti ovplyvňuje protilátkovú odpoveď po
vakcinácii, či priebeh HIV-1 infekcie (Hayney et al. 1997, Kaslow et al. 1996).
Závery
Populačná genetika umožňuje skúmanie evolučného a funkčného významu genetického
polymorfizmu. Diverzita génov PSMB a TAP, ktorých produkty sa zúčastňujú v imunitnej odpovedi
na opracovaní proteínov prezentovaných HLA-molekulami triedy I, zatiaľ nebola v rôznych
populáciách dostatočne preskúmaná. V práci prezentujeme alelové frekvencie jedného z tejto skupiny
génov - génu PSMB9 určené v slovenskej populácii. Štúdiu plánujeme rozšíriť o analýzu
polymorfizmu génov PSMB8, TAP1 a TAP2 a to predovšetkým vo vzťahu k niektorým
autoimunitným chorobám.
Použitá literatúra
1. Beck, S., Kelly, A., Radley, E., Kurshid, F., Alderton, R.P., Trowsdalw, J.: DNA sequence analysis of 66 kb
of human MHC class II region encoding a cluster of genes for antigen processing. J Mol Biol. 228: 433, 1992.
2. Caillat-Zucman, S., Bertin, E., Timsit, J., Boitard, C., Assan, R., Bach, J. F.: Protection from insulin
dependent diabetes mellitus is linked to a peptide transporter gene. Eur J Immunol. 23: 1784–1788, 1993.
3. Čechová, E., Fazekašová, H., Ferenčík, S., Shawkatová, I., Buc, M.: HLA-DRB1, -DQB1 and -DPB1
polymorphism in the Slovak population. Tissue Antigens. 51: 574–576, 1998.
4. Deng, G.Y., Muir, A., MacLaren, N.K., She, J.X.: Association of LMP2 and LMP7 genes within the major
histocompatibility complex with insulin-dependent diabetes mellitus: population and family studies. Am J
Hum Gen. 56: 528, 1995.
5. Djilali-Saiah, I., Benini, V., Daniel, S., Assan, R., Bach, J. F., Caillat-Zucman, S.: Linkage disequilibrium
between HLA class II (DR, DQ, DP) and antigen processing (LMP, TAP, DM) genes of the major
histocompatibility complex. Tissue Antigens 48: 87–92, 1996.
6. Hayney, M.S., Poland, G.A., Dimanling, P., Schaid, D.J., Jacobson, R.M., Lipsky, J.J.: Polymorphisms of the
TAP2 gene may influence antibody response to measles vaccine virus. Vaccine. 15: 3–7, 1997.
7. Chauffert, M., Cisse, A., Chevenne, D., You, J.F., Michel, S., Trivin, F.: Susceptibility to type 1 diabetes in
Senegalese population is linked to HLA-DQ and not TAP and LMP genes. Diabetes Care 20: 1299–1303,
1997.
8. Heward, J.M., Allahabadia, A., Sheppard M.C., Barnett A.H., Franklyn J.A., Gough, S.C.: Association of
large multifunctional proteasome (LMP2) gene with Graves´ disease is a result of linkage disequilibrium with
the HLA haplotype DRB1*0304-DQB1*02-DQA1*0501. Clin Endocrinol. 51: 115–118, 1999.
9. Kaslow, R.A., Carrington, M., Apple, R., Park, L., Munoz, A., Goedert, J.J., Winkler, C., Rinaldo, C., Detels,
R., Blattner, W., Phair, J., Erlich, H., Mann, D.L.: Influence of combinations of human major
histocompatibility complex genes on the course of HIV-1 infection. Nature Medicine. 2: 405–410, 1996.
99
10. Maksymowych, W.P., Tao, S., Vaile, J., Suarez-Almazor, M., Ramos-Remus C., Russell, A.S.: PSMB9
polymorphism is associated with extraspinal disease in HLA-B27 negative Caucasian and Mexican Mestizo
patients with ankylosing spondylitis. J Rheumatol. 27: 183–189, 2000.
11. Miller, S.A., Dykes, D.D., Polesky, H.F.: A simple salting out procedure for extracting DNA from human
nucleated cells. Nucl Acids Res. 16: 1215, 1988.
12. Powis, S.H., Teisserence, H.: TAP, LMP and HLA-DM typing protocols. In: HLA 1997, Vol.1 (ed. by K.
Tsuji, M. Aizawa, T. Sasazuki), Oxford University Press, Oxford, s. 226, 1997.
13. Quadri, S.A., Singal, D.P.: Peptide transport in human lymphoblastoid and tumor cells: effect of transporter
associated with antigen presentation (TAP) polymorpism. Immunol Letters. 61: 25, 1998.
14. Rueda Faucz, F., Macagnan Probst, C., Petzl-Erler, M.L.: Polymorphism of LMP2, TAP1, LPM7 and TAP2
in Brazilian Amerindians and Caucasoids: implications for the evolution of allelic and haplotypic diversity.
Eur J Immunogen. 27: 5–16, 2000.
15. Sia, C., Weinem, M.: Genetic susceptibility to type 1 diabetes in the intracellular pathway of antigen
processing – a subject review and cross-study comparison. Rev Diabet Stud. 2(1): 40–52, 2005.
100
Výsledky interdisciplinárneho výskumu olova v placente indikujú hyperkinetický
syndróm u detí
Michal Šimera1,2, Viktor Foltin2, Ivana Lettrichová1,3, Zuzana Grolmusová1,2,
Marcela Morvová3, Eva Neu4, Janka Foltinová1
1
Ústav Histológie a embryológie, Lekárska fakulta, Univerzita Komenského, Bratislava, Sasinkova 4, 81108
Bratislava; 2Katedra experimentálnej Fyziky – oddelenie fyziky plazmy, Fakulta matematiky, fyziky a informatiky,
Univerzita Komenského, Bratislava; 3Katedra astronómie, fyzika zeme a meteorológie – oddelenie fyziky
životného prostredia, Fakulta matematiky, fyziky a informatiky, Univerzita Komenského, Bratislava, Slovensko;
4
Umweltmedizin Institut, Feucht bei Nurnberg, Germany, [email protected]
Abstrakt
Pre každé zdravo vyvíjajúce sa dieťa je nevyhnutná zdravá placenta. Tak ako kruhy na
pni zrezaného stromu nám povedia históriu stromu, tak aj placenta nám odhalí históriu
tehotenstva. Vplyv znečistenia životného prostredia môže zanechať zmeny na mikroskopickej
štruktúre placenty. Ešte neuplynula dlhá doba od vtedy, čo sa prestal používať olovnatý
benzín, a tak sa dnes prejavuje kumulácia olova a jeho následky u generácií detí matiek 25 až
30 ročných. Sú to dievčatá, ktoré žili v čase keď ešte nebol v plnom rozsahu používaný
bezolovnatý benzín. Pre ťažké kovy je charakteristické, že sa z organizmu vylučujú veľmi
pomaly. Nález olova v klkoch placenty je pre dnešnú dobu potrebné konzultovať na
interdisciplinárnej úrovni. Toto viedlo autorov k myšlienke: previesť histochemický dôkaz Pb
v placente a analýzu tohoto neurotoxického kovu v pupočníkovej krvi pomocou infračervenej
spektroskopie (IR). V článku uvádzame priebežné výsledky, ktoré sú súčasťou formujúcich sa
prác. Zameriavame sa na adekvátne lokality na území Slovenskej Republiky s vysokou
prítomnosťou olova v životnom prostredí a s rastúcim výskytom hyperkinetického syndrómu
(ADHD) u detí. V práci sme preštudovali výskyt ADHD u detí z okolia Bratislavy za obdobie
od rokov 2003 až 2006.
Úvod
Posledné štúdie ukazujú, že placenta nie je účinnou bariérou pre ťažké kovy ako Cd a Pb.
Predpokladá sa, že tieto látky prechádzajú cez transplacentárnu barieru viacerými transportnými
mechanizmami ako sú jednoduchá difúzia pre malé molekuly, aktívny transport pre molekuly
s molekulovou hmotnosťou menšou ako 400 000 a pinocytóza pre makromolekuly (Goyer, 1990).
V poslednom čase sa ukazuje, že vplyv Pb na organizmus nie je zanedbateľný a môže spôsobovať
vznik ADHD u detí. Do organizmu sa Pb dostáva inhaláciou, orálnou cestou a výnimočne aj
rezorpciou cez porušenú kožu. Olovo má schopnosť prenikať do telových tkanív v závislosti od dávok,
koncentrácie, veku a tiež cesty expozície. Dospelý jedinec môže prijať v potrave približne 10–15%
olova a u detí to predstavuje viac ako 50% olova, vzhľadom na hmotnosť jedinca.
Olovo sa po rezorpcii distribuuje krvou do tkanív, svalov, CNS (najmä striatum). V krvi sa
viaže na bielkoviny plazmy a vstupuje do erytrocytov. Najväčšie zásoby olova v tele sú v kostnom
tkanive a v zuboch. V mozgu sa koncentruje v sivej hmote a v niektorých jadrách. Olovo sa vylučuje z
tela dlhodobo. Karcinogénne účinky olova u človeka sa zatiaľ jednoznačne nepotvrdili, ale ani
nevylúčili (Goyer, 1990). Olovo prechádza pupočníkovou krvou k plodu už v treťom mesiaci
tehotenstva a samotný plod je vystavený vysokej expozícii (Reichrtová a kol., 1998, Foltinová a kol.,
2006).
Najnovšie štúdia ukazuje, že vznik ADHD má biologickú vývojovú podstatu (Drtílková, Šerý
a kol., 2007). Aká neurologická, alebo biochemická skutočnosť špecifické poruchy správania vyvoláva,
nie je celkom jasné. Niektorí autori uvádzajú genetické vplyvy, iní oneskorené neurologické
dozrievanie, poškodenie plodu pred narodením, či počas komplikácii pri pôrode a po narodení, vplyv
rádioaktivity a ťažkých kovov, niektorých liekov prípadne konzervačných látok a farbív. Hypotéza o
vplyve konzervačných látok a farbív v potravinách ako o potenciálnom riziku vzniku ADHD u detí
bola veľmi populárna v 80. rokoch minulého storočia, avšak pre nedostatok dôkazov sa od nej upustilo.
Najnovšie štúdie potvrdzujú, že najmä placenta nie je účinnou bariérou pre niektoré rizikové látky,
101
ktoré priamo ohrozujú vyvíjajúci sa plod. Napríklad expozícia olovom behom intrauterinného alebo
postnatálneho vývoja môže spôsobiť neurokognitívne poškodenie a teda aj vznik ADHD.
Štúdie ukazujú, že hodnota Pb v placente u donosených detí je 0,29 ± 0,9 µg/g hodnota Pb
v placente u predčasne narodených detí je 0,45 ± 0,32 µg/g (Goyer, 1990). Najmä bazálne gangliá sú
veľmi citlivé na hypoxiu a zmenu metabolizmu, čo má významnú úlohu v patofyziológii
hyperkinetickej poruchy. Predpokladá sa, že olovo, ktoré je transportované cez transplacentárnu
barieru do plodu, okrem iného atakuje aj dopamínové dráhy v strednom mozgu (napr. striatum).
Dopamínové neuróny v strednom mozgu regulujú motorickú kontrolu a emócie a sú zapojené
do kognitívnych procesov a rôznych foriem pamäti. V lokalite striatum dopamín zodpovedá za
správnu koordináciu pohybov končatín. Degenerácia dopamínových dráh a následná deplécia
dopamínu, ktoré môžu byť spôsobené expozíciou neurotoxického jedu Pb, vedú k hypokinéze.
Dopamín je dôležitý pri ovplyvňovaní psychomotoriky a pozornosti, čo je dysfunkčné u ADHD.
Jedinci s ADHD majú hypoaktivitu kortikálneho dopamínového systému a hyperaktivitu striatového
dopamínového systému (Drtílková, Šerý a kol., 2007).
Materiál a metódy
V našej práci sme pozorovali a vyhodnotili 104 excízií z placent, ktoré boli odobraté ihneď po
pôrode. Z anamnestických údajov sme do úvahy brali:
1.
2.
3.
4.
bydlisko matky od narodenia a počas tehotenstva;
vek matky;
počet tehotenstiev a ich priebeh;
fajčenie, užívanie psychotropných látok a iné.
Excízie z placent boli fixované v AFO – alkohol:formol:kyselina octová v pomere 12:6:1 a vo
formole 1:9. Na 7 µm hrubých parafínových rezoch sme previedli nasledujúce farbiace metódy:
1. hematoxylin – eozín
2. Parker a Mallory hematoxylín, pozitivita olova je zobrazená tyrkysovo zelenou farbou.
Preparáty boli študované v svetelnom mikroskope Nikon Labophot 2, (Japonsko) pri
zväčšeniach 100 – 400x. Dokumentáciu sme previedli vstavaným fotoaparátom Olympus Camedia
C707.
Vzorky pupočníkovej krvi na IR spektroskopiu boli spracované KBr tabletovacou technikou.
Do práškového bromidu draselného sme pridali asi 3 kvapky pupočníkovej krvi (v pomere krv:KBr
asi 1-5 mg:300-1000 mg), takto vytvorenú zmes sme zhomogenizovali.
Vzniknutý homogenát sme naplnili do foriem na lisovanie tabliet a zlisovali pomocou lisu
firmy Carl Zeiss na priesvitnú kompaktnú tabletku pri postupne sa zvyšujúcom tlaku až na hodnotu
220 atmosfér. Pri meraniach pomocou infračervenej spektroskopie je mimoriadne dôležité zbaviť
vzorku vody, ktorá by prekryla pásy vzorky, čo sme realizovali jednak dôsledným homogenizovaním
a vysúšaním v IR lampe a tiež počas lisovania použitím rotačnej vývevy, ktorá zbavuje tabletku
zbytkových vodných pár. Spektrum vzorky (pozri graf 1) sme analyzovali spektrometrom Perkin
Elmer Spectrum BX USA.
Ďalej sme vyhodnotili chorobopisy 120 detí s ADHD hospitalizovaných na Klinike detskej
psychiatrie Detskej Fakultnej nemocnice Kramáre v Bratislave v rokoch 2003 až 2006.
Výsledky a diskusia
Predpokladá sa, že syncytiotrofoblast, syntetizuje špecifický proteín metalothionenin, ktorý
prednostne viaže ťažké kovy ako Cd a Pb (Goyer, 1990). V našej práci sa zameriavame na štúdium
prítomnosti Pb v mikroskopických štruktúrach placenty. Je známe, že syncytiotrofoblast fagocytuje
tieto látky (Reichrtová a kol., 1998, Foltinová a kol., 2006, Vráblová a kol., 2006). Presná väzba a
mechanika samotného transportu zatiaľ nie sú známe. Naše histologické nálezy potvrdzujú pozitívny
výskyt Pb v krvi matky a následný transport cez transplacentárnu bariéru do fetálnej krvi. Zaznamenali
sme prítomnosť Pb v erytrocytoch matky v intervilóznych priestoroch placenty a v erytrocytoch
fetálnej krvi v cievach placentárnych klkov pozri obr. 1.
102
Výsledná pozitivita na Pb je tyrkysovo zelené sfarbenie. Na obr. 1 vidíme prítomnosť Pb
v histologickom preparáte placenty matky. Graf 1 zobrazuje spektrum ťažkých kovov v pupočníkovej
krvi.
Obr. 1. Prítomnosť Pb v erytrocyte matky ◀ (v ľavo) a v erytrocyte plodu ◀ (v pravo), zväčšenie
400x.
Graf 1. Infračervené spektrum z pupočníkovej krvi. Prítomnosť Pb3O4 singlet 670 cm-1.
V nameranom spektre sme zistili aj prítomnosť arzénu As2O3 (dublet pri 330 až 350 cm-1) a
prítomnosť olova vo forme Pb3O4 (singlet 670 cm-1).
V štúdii sme sa ďalej zamerali na vzorku 120 detských pacientov vo veku od 2 do 18 rokov,
ktorí boli v rokoch 2003 až 2006 hospitalizovaný na Klinike detskej psychiatrie Detskej fakultnej
nemocnice s poliklinikou v Bratislave.
Takmer u polovice detí s ADHD sa v chorobopise uvádza rizikový priebeh tehotenstva (pozri
graf 2), ktorý bol spôsobený napr. predčasným odlupovaní placenty, zlou polohou
plodu, nedostatočnosťou fetoplacentárnej jednotky alebo zlou životosprávou matky počas tehotenstva
(fajčenie, užívanie psychotropných látok a iné).
Takmer väčšina pacientov s diagnózou ADHD sú chlapci, avšak tvrdenie, že ochorenie sa
výhradne týka len chlapcov je nesprávne. V danej populácii sa vyskytuje aj nezanedbateľný počet
dievčat (pozri graf 3). Táto významná skutočnosť podporuje teóriu o vzájomnom vzťahu metabolizmu
mužských pohlavných hormónov a olova.
Hyperaktivita sa vyskytuje u detí v rôznom veku. Najčastejšie sa jedná o deti od 6 roku života
až po obdobie puberty . Nie je jednoduché presne určiť začiatok ochorenia nakoľko deti sú
hospitalizované až vtedy, keď príznaky presiahnu únosnú mieru tolerancie správania pre ich rodičov a
okolie.
103
diagnózou ADHD
40%
priebeh tehotenstva
tehotenstva
60%
Graf 2. Priebeh tehotenstva u 120 žien, ktorých deti boli hospitalizované pre ADHD.
Pohlavie detí s diagnózou ADHD
10%
Chlapci
90%
Graf 3. Pohlavie 120 detí s diagnózou ADHD.
Závery
V našej práci sme lokalizovali kumuláciu olova v placente. Počas tehotenstva hormonálne
zmeny vedú k uvoľneniu Pb z kostných depozitov. Pomocou IR spektroskopie sme dokázali výskyt Pb
v pupočníkovej krvi vo forme Pb3O4. Vyhodnotili sme chorobopisy 120 detí s ADHD
hospitalizovaných na Klinike detskej psychiatrie Detskej Fakultnej nemocnice Kramáre v Bratislave
v rokoch 2003 až 2006. Predpokladáme, že olovo ako neurotoxický jed, môže spolu s inými faktormi
spôsobovať vznik hyperkinetického syndrómu u detí, ktorý má v dnešnej dobe nezanedbateľný výskyt
v populácii. Výskyt tohoto ochorenia má stúpajúcu tendenciu vo svete.
Poďakovanie
Touto cestou chceme poďakovať prednostovi Kliniky detskej psychiatrie Detskej fakultnej
nemocnice s poliklinikou v Bratislave doc. MUDr. Igorovi Škodáčkovi, CSc. za cenné rady pri štúdiu
ADHD, prednostovi Ústavu histológie a embryológie LFUK doc. MUDr. Štefanovi Polákovi, PhD. za
možnosť realizovať a ďalej rozvíjať túto prácu na jeho ústave a Vierke Haraslínovej za pomoc pri
príprave histologických preparátov.
Použitá literatúra
1. Foltinová, J.: Histológia pre poslucháčov biomedicínskej fyziky. Vysokoškolská učebnica. Univerzita
Komenského Bratislava. 242, 2003.
2. Foltinová, J., Morvová M., Foltin V., et al.: Lead-dangerous metal for the developing fetus. Interdisciplinary
study. Programme and Abstract Book of the 41st International Congress of Slovak Anatomical Society.
Bratislava. 39, 2007.
3. Foltinová, J., Morvová, M., Foltin, V., Neu, E.: Placenta. Umbilical blood and polluted enviroment. In:
Proceedings of International Congress on Enviromental Health. Hanover. Germany. Fraunhofer. ITA. 80, 2000.
4. Foltinová, J., Foltin, V., Šimera, M., et al.: Lead in placenta-hazardous prognosis for postnatal development of
the child. Int J Prenatal Perinatal Psychology and Medicine. 18: 19–26, 2006.
104
5. Pounds, J.G., Long, G.J., Rosen, J.F.: Cellular and molecular toxicity of lead in bone. Environ Health Persp.
91: 17–32, 1991.
6. Goyer, R.A.: Transplacental transport of lead. Environ Health Persp. 89: 101–105, 1990.
7. Reichrtová, E., Doročiak, P., Palkovičová, L.: Sites of lead and nickel accumulation in the placental tissue.
Hum Exp Toxical. 176–181, 1998.
8. Ross, M.H., Pawlina W.: Histology a text and atlas with correlated cell molecular biology. Lippincott
Williams & Wilkins, Baltimore. 906, 2006.
9. Simons, T.J.B.: Passive transport and binding of lead by human red blood cells. J Physiol Great Britain. 387:
267–286, 1986.
10. Vráblová, V., Šimera, M., Seidenbusch, W.: Interdisciplinary approach to study of placenta. Morfológia
v Súčasnosti. Zborník. Univerzita Komenského v Bratislave Lekárska Fakulta. 90–94, 2006.
105
Identifikácia proteínu PCNA v normálnom endometriu
Vladimír Šišovský1, Ľudovít Danihel1, Michal Palkovič1, Beata Bučeková1, Vanda Repiská2,
Ľuboš Danišovič2, Andrea Ševčovičová3, Svetoslav Štvrtina1, Dimitris Hatzibougias4, Roman
Moravčík5, Marek Bučko6, Michal Korman7, Lívia Hlavačková1
1
Ústav patologickej anatómie; 2Ústav lekárskej biológie a genetiky; 7Ústav telesnej výchovy a športu, Lekárska
fakulta, Univerzita Komenského v Bratislave; 3Katedra genetiky, Prírodovedecká fakulta, Univerzita
Komenského v Bratislave; 4Department of Pathology, Medical School, Aristotle University, Thessaloniki, Greece;
5
Prírodovedecká fakulta, Univerzita Komenského v Bratislave, Slovenská republika; 6Oddelenie
glykobiotechnológie, Chemický ústav, Centrum glykomiky, Slovenská akadémia vied, Bratislava, Slovenská
republika, [email protected]
Abstrakt
Endometrium je špecializované tkanivo, ktorého morfologický vzhľad ako aj prítomnosť
mnohých proteínov v ňom sa neustále mení v priebehu biologického veku ženy aj počas
menštruačného cyklu. Spolu 30 vo formalíne fixovaných a do parafínu zaliatych bioptických
tkanivových vzoriek s proliferujúcim (PE, 10), sekrečným (SE, 10) a atrofickým (AE, 10)
endometriom sme vyšetrili imunohistochemicky (IHC) na expresiu proteínu PCNA v jadrách
epitelových buniek žliazok endometria. Expresia PCNA bola vysoká v PE, s výrazným poklesom v SE.
V AE sme expresiu PCNA nezistili. Súhrnne možno konštatovať, že proteín PCNA je výborným
znakom proliferujúcich buniek PE. Jeho hodnotenie pomocou IHC je pomerne lacnou a jednoduchou
metódou s implikáciou pre klinickú prax.
Úvod
Endometrium je špecializované tkanivo, ktorého morfologický vzhľad ako aj prítomnosť
mnohých proteínov v ňom sa neustále mení (Mutter a Ferenczy 2002). Mení sa v priebehu
biologického veku ženy aj počas menštruačného cyklu (Mutter a Ferenczy 2002). Expresia niektorých
proteínov môže byť prvotriednym indikátorom bunkovej diferenciácie a proliferácie.
Antigén jadier proliferujúcich buniek (PCNA) je proteín o molekulovej hmotnosti 36 kDa
(Zuber et al. 1989). Je spojený s proliferáciou buniek. Vzniká v neskorej G1 fáze, s vrcholom v S
a zotrváva v G2 a M fáze bunkového cyklu (BC) (Kallakury et al. 1998). Má veľmi dlhý polčas
životnosti, v bunke pretrváva i neskôr. Je kofaktorom DNA polymerázy δ (Lee a Hurwitz 1990),
kľúčový v syntéze DNA v S fáze BC, počas reparácie DNA (Shivji et al. 1992), v replikácii DNA a
v regulovaní progresie BC (Rao et al. 1991).
Cieľom prezentovanej práce je identifikácia zmien expresie proteínu PCNA v epitelových
bunkách žliazok imunohistochemickými (IHC) metódami, v korelácii s morfologickým nálezom,
pri normálnom endometriu.
Materiál a metódy
Spolu 30 archívnych bioptických vzoriek endometria (z Ústavu patologickej anatómie
Lekárskej fakulty Univerzity Komenského v Bratislave, r. 1997-2007) z materníc po kyretovaní alebo
hysterektómii (pre krvácanie z maternice alebo nádor zistený sonografiou či výsledok predchádzajúcej
biopsie) boli zahrnuté v tejto štúdii. Vo formalíne fixované a do parafínu zaliate tkanivové vzorky s
proliferujúcim (PE, 10x), sekrečným (SE, 10x) (ženy vo veku 26-45 r.) a pomenopauzovým
atrofickým (AE, 10x) (60-86 r.) endometriom sme vyšetrili IHC. Expresiu PCNA v jadrách
epitelových buniek žliazok endometria sme detegovali monoklonovou myšou protilátkou
(DakoCytomation, Glostrup, Denmark). Nepriamu metódu s komplexom streptavidínu a biotínu
s chrenovou peroxidázou (ABC-Px) a s 3,3´-diaminobenzidínom (DakoCytomation, Glostrup,
Denmark) ako chromogénu sme použili na vizualizovanie reakčného produktu (DakoCytomation 2004,
Azumi a Czernobilsky 2002). Nálezy sme hodnotili svetelným mikroskopom (Nikon Coolpix 990,
Tokyo, Japonsko) semikvantitatívne ako: „-“ negatívne, „+/-“ nepravidelne slabo pozitívne (do 5%
buniek), „+“ pravidelne slabo pozitívne (> 5% a < 25% buniek), „++“ pravidelne stredne silne
pozitívne (25% až 50% buniek), „+++“ pravidelne silne pozitívne (> 50% buniek). Použité postupy
(výber materiálu do súboru) zodpovedali príslušným národným a medzinárodným etickým štandardom
(rev. Helsinskej deklarácie z r. 2002) a pravidlám príslušných etických komisií o právach pacienta
(Jakubovský 2003).
106
Výsledky a diskusia
Výsledky hodnotenia expresie PCNA sú zhrnuté v tabuľke 1. Expresia PCNA bola vysoká
v PE (obr. 1), s výrazným poklesom v SE (obr. 2). V AE sme expresiu PCNA nezistili (obr. 3).
Stav endometria
Reakcia protilátky proti
PCNA
+++
+/- až -
Proliferujúce endometrium
Sekrečné endometrium
Atrofické endometrium
Tab. 1. Prehľad reakcií protilátky proti PCNA s jadrami epitelových buniek žliazok endometria ľudí.
Reakcia: − negatívna, +/− nepravidelne slabo pozitívna, + pravidelne slabo pozitívna, ++ pravidelne
stredne silne pozitívna, +++ pravidelne silne pozitívna.
Obr. 1. Pravidelná silne pozitívna expresia PCNA v PE. Komplex streptavidínu a biotínu s
peroxidázou (ABC-Px), 120x.
Obr. 2. Neprítomnosť expresie PCNA v SE. ABC-Px, 120x.
Obr. 3. Neprítomnosť expresie PCNA v cystickom AE (po menopauze). ABC-Px, 100x.
107
Naše výsledky ukazujú dobrú koreláciu expresie PCNA so stavom endometria a sú v zhode s
inými publikovanými prácami. PCNA je proteín jadier buniek spojený s proliferáciou buniek (Azumi
a Czernobilsky 2002). Endometrium pred ovuláciou charakterizuje proliferácia buniek žliaz, strómy
a endotelu ciev, maximálny počet buniek endometria syntetizujúcich jadrovú DNA s maximálnou
aktivitou mitóz (Aronica a Katzenellenbogen 1991). Hareyama (1994) opisuje v neskorej fáze PE
signifikantne vyšší index PCNA (% jadier s obsahom PCNA) než v skorej fáze PE a než skorej
a strednej fáze SE. Tieto nálezy sú podobné s našimi zisteniami, kde expresia PCNA v PE bola vysoká,
ale v SE došlo k výraznému poklesu expresie PCNA. Skoré a neskoré fázy PE, resp. SE sme
samostatne nehodnotili. Naše zistenia podporujú výsledky Budaja a Bučekovej (2007a,b), ktorí
hodnotili expresiu PCNA v PE, SE aj v AE. Ich výsledky ukázali pravidelne silne pozitívnu expresiu
PCNA v PE, nepravidelne slabo pozitívnu expresiu v SE a žiadnu expresiu PCNA v AE.
Závery
Súhrnne možno konštatovať, že proteín PCNA je výborným markerom proliferujúcich buniek
endometria proliferujúcej fázy. Jeho hodnotenie pomocou IHC je pomerne lacnou a jednoduchou
metódou s implikáciou pre klinickú prax.
Poďakovanie
Štúdia realizovaná s podporou (finančným príspevkom) Lions Club International LC
Bamberg-Mischelsberg a LC Kremnica a čiastočne grantom UK/36/2007. Autori ďakujú za technickú
spoluprácu laborantke p. I. Uhnavej. Prvý autor ďakuje za podporu Guvernérovi 2006-2007 Lions
Club International District D-122 Česká republika a Slovenská republika p. Dipl. Ing. T. Bučekovi.
Použitá literatúra
1. Aronica, S.M., Katzenellenbogen, B.S.: Progesterone receptor regulation in uterine cells: stimulation by
estrogen, cyclic adenosine 3´,5´-mono-phosphate and insulin-like growth factor I and suppression by
antiestrogens and protein kinase. Endocrinology. 128: 2045–2052, 1991.
2. Azumi, N., Czernobilsky, B.: Immunohistochemistry. In: Kurman, R.J. (ed) Blaustein´s pathology of the
female genital tract. 5th Edn. Springer – Verlag, New York. 1251–76, 2002.
3. Budaj, M., Bučeková, B., Šišovský, V., Danihel, Ľ.: Identifikácia markerov proliferačnej aktivity v karcinóme
endometria. 46. fakultná konferencia ŠVOČ. Zborník prác, Bratislava: LF UK a Slovak Academic Press. 22–
25, 2007.
4. Budaj, M., Bučeková, B., Šišovský, V., et al.: Identification of proliferation markers in correlation with p53
gene mutation in endometrial carcinoma. Vědecká konference studentů českých a slovenských lékařských
fakult. Program a abstrakta prednášek. 3. lékařská fakulta Univerzity Karlovy v Praze. 2007.
5. DakoCytomation: DakoCytomation 2004/05 Catalog. Denmark: Glostrup. 359, 2004.
6. Hareyama, H: Proliferative activity of normal endometrial cells, endometrial hyperplasia cells and endometrial
cancer cells using the monoclonal antibody to PCNA. Hokkaido Igaku Zasshi. 69(6): 1427–31, 1994.
7. Jakubovský, J.: Nekorektnosť vo vedeckom bádaní. In: Hulín, I. (Ed): Základy vedeckej práce. Slovak
Academic Press, Bratislava. 424–442, 2003.
8. Kallakury, B.V., Ambros, R.A., Hayner-Buchan, A.M., et al.: Cell proliferation-associated proteins in
endometrial carcinomas, including papillary serous and endometrioid subtypes. Int J Gynecol Pathol. 17: 320–
326, 1998.
9. Lee, S.H., Hurwitz, J.: Mechanism of elongation of primed DNA by DNA polymerase delta, proliferating cell
nuclear antigen, and activator 1. Proc Natl Acad Sci USA. 87: 5672–5676, 1990.
10. Mutter, G.L., Ferenczy, A.: Anatomy and histology of the uterine corpus. In: Kurman, R.J. (Ed): Blaustein´s
Pathology of the Female Genital Tract. Springer-Verlag, New York. 383–419, 2002.
11. Rao, V.V., Schnittger, S., Hansmann, I.: Chromosomal localization of the human proliferating cell nuclear
antigen (PCNA) gene to or close to 20p12 by in situ hybridization. Cytogenet Cell Genet. 56: 169–170, 1991.
12. Shivji, K.K., Kenny, M.K., Wood, R.D.: Proliferating cell nuclear antigen is required for DNA excision
repair. Cell. 69: 367–374, 1992.
13. Zuber, M., Yasui, W., Tan, E.M., Ryoji, M.: Quantitation and subcellular localization of proliferating cell
nuclear antigen (PCNA/cyclin) in oocytes and eggs of Xenopus lae laevis. Exp Cell Res. 182: 384–393, 1989.
108
Ki-67 je vynikajúcim znakom malígnej premeny buniek endometria po menopauze
Vladimír Šišovský1, Ľudovít Danihel1, Michal Palkovič1, Pavel Babál1, Beata Bučeková1,
Dimitris Hatzibougias2, Martin Wawruch3, Dalibor Hojsík4, Michal Korman5, Zuzana
Kováčiková6, Bohuslav Uher7,8, Roman Moravčík9
1
Ústav patologickej anatómie; 3Farmakologický ústav; 4Ústav súdneho lekárstva; 5Ústav telesnej výchovy a
športu, Lekárska fakulta, Univerzita Komenského v Bratislave; 2Department of Pathology, Medical School,
Aristotle University, Thessaloniki, Greece; 6Katedra živočíšnej fyziológie a etológie; 7Katedra botaniky,
Prírodovedecká fakulta, Univerzita Komenského v Bratislave, 8Ústav botaniky a zoologie, Přírodovědecká
fakulta, Masarykova Univerzita v Brne, Česká republika; 9Prírodovedecká fakulta, Univerzita Komenského
v Bratislave, Slovenská republika, vladimir.sis[email protected]
Abstrakt
Endometrium je špecializované tkanivo, ktorého morfologický vzhľad ako aj
prítomnosť mnohých proteínov v ňom sa neustále mení v priebehu biologického veku ženy,
počas menštruačného cyklu a výrazne v nádorových procesoch. Spolu 70 vo formalíne
fixovaných a do parafínu zaliatych bioptických tkanivových vzoriek s proliferujúcim (PE,
10), sekrečným (SE, 10) a atrofickým (AE, 10) endometriom, endometrioidným G1 (ECG1,
10) a G3 (ECG3, 10), seróznym (SC, 10) a svetlobunkovým (SvC, 10) karcinómom
endometria (CaE) sme vyšetrili imunohistochemicky (IHC) na expresiu proteínu Ki-67
v jadrách epitelových buniek žliazok endometria. Expresia Ki-67 bola vysoká v PE, s
výrazným poklesom v SE. V CaE expresia Ki-67 bola vysoká a zásadne sa nelíšila od
expresie v PE a v jednotlivých histologických podtypoch a stupňoch CaE, pričom najvyššia
expresia Ki-67 bola u agresívnych (najmä SC a ECG3, menej SvC) typov CaE. V AE sme
expresiu Ki-67 nezistili. Súhrnne možno konštatovať, že Ki-67 je výborným markerom
malígnej premeny buniek endometria po menopauze. Jeho hodnotenie pomocou IHC je
pomerne lacnou a jednoduchou metódou pre klinickú prax.
Úvod
Výrazne stúpajúci výskyt zhubných nádorov tela maternice žien (American Cancer Society
2000; Jemal et al. 2005; Pleško et al. 1994; Pleško et al. 2003; Redecha et al. 2004) je predmetom
záujmu mnohých odborníkov z rôznych vedných odborov. Sú to onkológovia, gynekológovia
(Redecha et al. 1996; 2004; 2005; Šuška a Holomáň 1997; Šuška 2003), molekuloví biológovia
a genetici (Weismanová et al. 2002; Repiská et al. 2003; Molnárová et al. 2006), patológovia
(Deligdisch a Cohen 1985; Robboy et al. 1988; 2002; Breitenecker a Lax 1994; Danihel et al. 1995;
2002; 2003; 2005; Danihel a Breitenecker 1997; Silverberg et al. 2003; Šišovský et al. 2004; 2006a,
2006b; 2006c; 2006d; 2006e; 2007a; 2007b; 2007c; 2007d; Šišovský 2005; Gomolčák et al. 2005;
Budaj a Bučeková 2007a,b). K rozšíreniu poznatkov o tejto malignite výrazne prispievajú patológovia,
najmä z hľadiska stanovenia presnej diagnózy.
Karcinóm endometria (CaE) je najčastejšia invázna neoplázia ženského pohlavného traktu, 5.
najčastejší karcinóm u žien (American Cancer Society 2000; Ronnett et al. 2002; Jemal et al. 2005)
a má výrazne stúpajúci výskyt. Vrátane Slovenskej republiky, kde ich počet vzrástol podľa Národného
onkologického registra SR za posledných 20 rokov (1980 až 2000) takmer o tretinu (Pleško et al.
1994; 2003). CaE sa na Slovensku dotýka každoročne asi 700 žien, pričom asi 200 ich končí fatálne.
Imnunohistochemická (IHC) analýza je veľakrát jedným z rozhodujúcich faktorov stanovenia
diagnózy a prognózy nádorovej choroby a výrazne ovplyvňuje jej liečbu (Danihel a Porubský 1991;
Danihel et al. 1995; Azumi a Czernobilsky 2002).
Endometrium je špecializované tkanivo, ktorého morfologický vzhľad ako aj prítomnosť
mnohých proteínov v ňom sa neustále mení (Mutter a Ferenczy 2002). Mení sa v priebehu
biologického veku ženy, počas menštruačného cyklu (Mutter a Ferenczy 2002) a výrazne v
nádorových procesoch (Ronnett et al. 2002). Expresia niektorých proteínov môže byť prvotriednym
indikátorom bunkovej diferenciácie, proliferácie a skorým znakom ich malígnej premeny.
Antigén Ki-67 združený s proliferáciou buniek (Ki-67) je proteín jadra bunky. Súvisí
s aktivitou mitóz (Aronica a Katzenellenbogen 1991) a s proliferovaním buniek. Ki-67 je preferenčne
109
tvorený počas aktívnych fáz bunkového cyklu (G1, S, G2 a M), najmä v S a M fáze. Antigén je rýchlo
ničený ak bunka vstupuje do neproliferujúceho stavu (Scholzen a Gerdes 2000). Chýba v pokojových
bunkách, či v neaktívnej (G0) fáze (Gerdes et al. 1984).
Cieľom prezentovanej práce je identifikácia zmien expresie Ki-67 v epitelových bunkách
žliazok IHC metódami, v korelácii s morfologickým a klinickým nálezom, pri CaE.
Materiál a metódy
Spolu 70 archívnych bioptických vzoriek endometria (z Ústavu patologickej anatómie
Lekárskej fakulty Univerzity Komenského v Bratislave, r. 1997-2007) z materníc získaných
kyretovaním alebo hysterektómiou (pre krvácanie z maternice alebo nádor zistený sonografiou či
výsledok predchádzajúcej biopsie) boli zahrnuté v tejto štúdii. Vo formalíne fixované a do parafínu
zaliate tkanivové vzorky s proliferujúcim (PE, 10x) a sekrečným (SE, 10x) (ženy vo veku 26-45 r.)
a atrofickým (pomenopauzovým) (AE, 10x) (60-86 r.) endometriom, endometrioidným (EC) G1
(ECG1, 10x) a G3 (ECG3, 10x) (31-61 r.), seróznym (SC, 10x) (39-86 r.) a svetlobunkovým (SvC,
10x) (60-86 r.) histologickým podtypom CaE sme vyšetrili IHC. Expresiu Ki-67 v jadrách epitelových
buniek žliazok endometria sme detegovali monoklonovou myšou protilátkou (DakoCytomation,
Glostrup, Denmark). Nepriamu metódu s komplexom streptavidínu a biotínu s chrenovou peroxidázou
(ABC-Px) a s 3,3´-diaminobenzidínom (DakoCytomation, Glostrup, Denmark) ako chromogénu sme
použili na vizualizovanie reakčného produktu (DakoCytomation 2004, Azumi a Czernobilsky 2002).
Nálezy sme hodnotili svetelným mikroskopom (Nikon Coolpix 990, Tokyo, Japonsko)
semikvantitatívne ako: „-“ negatívne, „+/-“ nepravidelne slabo pozitívne (do 5% buniek),
„+“ pravidelne slabo pozitívne (> 5% a < 25% buniek), „++“ pravidelne stredne silne pozitívne (25%
až 50% buniek), „+++“ pravidelne silne pozitívne (> 50% buniek). Iba reakčnú pozitivitu jadier
buniek sme považovali za špecifickú. Rezy inkubované s obyčajným pufrom namiesto primárnej
protilátky sme stanovili ako negatívnu kontrolu. Použité postupy (výber materiálu do súboru)
zodpovedali príslušným národným a medzinárodným etickým štandardom (Helsinská deklarácia r.
2002) a pravidlám príslušných etických komisií o právach pacienta (Jakubovský 2003).
Výsledky a diskusia
Výsledky hodnotenia expresie Ki-67 sú zhrnuté v tabuľke 1. Expresia Ki-67 bola vysoká v PE
(obr. 1) s výrazným poklesom v SE (obr. 2). V CaE expresia Ki-67 bola vysoká a zásadne sa nelíšila
od expresie Ki-67 v PE a v jednotlivých histologických podtypoch CaE, pričom najvyššia miera
expresie Ki-67 súvisela s agresívnym (najmä SC a ECG3, menej SvC) typom CaE (obr. 4, 3). V AE
sme expresiu Ki-67 nezistili (obr. 5).
Stav endometria
Reakcia protilátky proti Ki-67
Proliferujúce endometrium
Sekrečné endometrium
Atrofické endometrium
Endometrioidný karcinóm endometria, G1
Endometrioidný karcinóm endometria, G3
Serózny karcinóm endometria
Svetlobunkový karcinóm endometria
++ až +++
- až +/++
++ až +++
+++
++
Tab. 1. Prehľad reakcií protilátky proti Ki-67 s jadrami epitelových buniek žliazok endometria ľudí.
Reakcia: − negatívna, +/− nepravidelne slabo pozitívna, + pravidelne slabo pozitívna, ++ pravidelne
stredne silne pozitívna, +++ pravidelne silne pozitívna.
110
Obr. 2. Neprítomnosť expresie Ki-67 v SE. ABC-Px, 100x.
Obr. 3. Detekcia Ki-67 v ECG3. ABC-Px, 150x.
Obr. 4. Pravidelná silne pozitívna expresia Ki-67 v SC. ABC-Px, 100x.
Obr. 5. Pravidelná silne pozitívna expresia Ki-67 v CaE (hrubá šípka). Neprítomnosť expresie Ki-67
v cystickom (pomenopauzovom) AE (tenká šípka). ABC-Px, 100x.
111
Naše výsledky ukazujú dobrú koreláciu expresie proteínu Ki-67 s histologickým podtypom a
stupňom diferencovania a sú v zhode s inými publikovanými prácami, ktoré hodnotili validitu tohto
znaku.
Ki-67 je proteín jadier buniek spojený s proliferáciou buniek (Azumi a Czernobilsky 2002).
Endometrium pred ovuláciou charakterizuje proliferácia buniek žliaz, strómy a endotelu ciev,
maximálny počet buniek endometria syntetizujúcich jadrovú DNA, čo korešponduje s maximálnou
aktivitou mitóz (Aronica a Katzenellenbogen 1991) a s expresiou Ki-67 (Tabibzadeh 1990).
Výsledky Ito et al. (1997) ukázali, že v SE je expresia Ki-67 signifikantne nižšia než v PE a
než v EC. Ich zistenia našli podporu v našich nálezoch, ktoré ukazujú vysokú expresiu Ki-67 v PE
a výrazný jej pokles v SE, kde bola výrazne nižšia než v ostatných nami sledovaných stavoch. Naše
zistenia podporujú aj výsledky Budaja a Bučekovej (2007a,b), ktorí zistili vysokú expresiu Ki-67 v PE
a výrazný jej pokles v SE.
Ito et al. (1997) ďalej zistili v EC signifikantne vyššiu expresiu Ki-67 než v PE. Tieto nálezy
naše zistenia potvrdili len čiastočne; v PE bola expresia Ki-67 rovnaká ako v EC.
Výsledky Budaja a Bučekovej (2007a,b) ukázali, že expresia Ki-67 v PE, ECG1, ECG3, SC a
SvC je vysoká a zásadne sa v týchto stavoch endometria neodlišuje. Ich zistenia našli podporu
v našich nálezoch. Budaj a Bučeková (2007a,b) ďalej tvrdia, že AE Ki-67 netvorí. Tieto nálezy naše
zistenia potvrdili; v AE sme expresiu Ki-67 nezistili.
Lax et al. (1998) sa domnievajú, že SC a SvC nezávisia od estrogénov a majú vysoký index
Ki-67 (% jadier obsahujúcich Ki-67). Na rozdiel od SC, vo SvC zriedkavejšie dochádza k výraznej
expresii p53. Preto usudzujú, že patogenéza SvC sa líši od patogenézy EC a SC. Tieto nálezy našli
podporu v našich výsledkoch, ktoré ukázali v ECG3 a v SC najvyššiu expresiu Ki-67, ale v ECG1 a v
SvC expresia Ki-67 bola mierne nižšia. Naše výsledky podporujú výsledky Salvesena et al. (1998),
ktorí hovoria, že v CaE expresia Ki-67 koreluje s jeho histologickým podtypom a s FIGO
(International Federation of Gynecology and Obstetrics, FIGO) štádiom, a že expresia Ki-67 a štádium
anatomického rozsahu sú významným faktorom prognózy vývoja CaE.
Závery
Súhrnne možno konštatovať, že proteín Ki-67 je výborným znakom malígnej premeny buniek
endometria po menopauze, ktoré za normálnych okolností Ki-67 netvorí. Jeho hodnotenie pomocou
IHC je pomerne lacnou a jednoduchou metódou s implikáciou pre klinickú prax.
Poďakovanie
Táto štúdia bola realizovaná s podporou (finančným príspevkom) Lions Club International LC
Bamberg-Mischelsberg a LC Kremnica a čiastočne grantom UK/36/2007. Autori ďakujú za technickú
spoluprácu laborantke p. I. Uhnavej. Prvý autor ďakuje za podporu Guvernérovi 2006-2007 Lions
Club International District D-122 Česká republika a Slovenská republika, p. Dipl. Ing. T. Bučekovi.
Použitá literatúra
1. American Cancer Society: 2000 cancer statistics. CA Cancer J Clin. 50(1): 1–64, 2000.
2. Aronica, S.M., Katzenellenbogen, B.S.: Progesterone receptor regulation in uterine cells: stimulation by
estrogen, cyclic adenosine 3´,5´-mono-phosphate and insulin-like growth factor I and suppression by
antiestrogens and protein kinase. Endocrinology. 128: 2045–2052, 1991.
3. Azumi, N., Czernobilsky, B.: Immunohistochemistry. In: Kurman,R.J. (Ed). Blaustein´s Pathology of the
Female Genital Tract. 5th Edn. Springer – Verlag, New York. 1251–1276, 2002.
4. Breitenecker, G., Lax, S.: Tumoren des Corpus uteri einschliesslich der Plazenta. In: Histologische Tumor
Klassifikation. Springer – Verlag, Wien, New York. 97–102, 1994.
5. Budaj, M., Bučeková, B., Šišovský, V., Danihel, Ľ.: Identifikácia markerov proliferačnej aktivity v karcinóme
endometria. 46. fakultná konferencia ŠVOČ. Zborník prác, Bratislava: LF UK a Slovak Academic Press. 22–
25, 2007a.
6. Budaj, M., Bučeková, B., Šišovský, V., et al.: Identification of proliferation markers in correlation with p53
gene mutation in endometrial carcinoma. Vědecká konference studentů českých a slovenských lékařských
fakult. Program a abstrakta prednášek. 3. lékařská fakulta Univerzity Karlovy v Praze, 2007b.
7. DakoCytomation: DakoCytomation 2004/05 Catalog. Denmark: Glostrup, 359, 2004..
8. Danihel, Ľ., Porubský, J.: Prínos monoklonálnych protilátok v bioptickej diagnostike nádorov. Bratisl lek
Listy. 92(9): 460–466, 1991.
112
9. Danihel, Ľ., Breitenecker, G.: Histologická diagnostika nenádorových a nádorových zmien endometria v peria postmenopauze. In: Šuška, P., Holomáň, K. (Eds): Endometrium v peri- a postmenopauze. Slovak Academic
Press, Bratislava. 14–41, 1997.
10. Danihel, Ľ., Babál, P., Porubský, J., et al.: Imunohistochemické markery v diagnostike nádorov maternice.
Bratisl lek Listy. 96(7): 353–360, 1995.
11. Danihel, Ľ., Gomolčák, P., Korbeľ, M., et al.: Expression of proliferation and apoptotic markers in human
placenta during pregnancy. Acta Histochem. 104(4): 335–338, 2002.
12. Danihel, Ľ., Horváth, R., Breitenecker, G., Hatzibugias, I.: Súčasná klasifikácia a charakteristika nádorov
endometria. Slov gynek por. 10(Suppl 1): 14–17, 2003.
13. Danihel, Ľ., Šišovský, V., Palkovič, M., et al.: Karcinóm endometria – histopatologická klasifikácia a
charakteristika. Gynekol prax. 3(1): 9–12, 2005.
14. Deligdisch, L., Cohen, C.J.: Histologic correlates and virulence implications of endometrial carcinoma
associated with adenomatous hyperplasia. Cancer. 56(6): 1452–1455, 1985.
15. Gerdes, J., Lemke, H., Baisch, H., et al.: Cell cycle analysis of a cell proliferation-associated human nuclear
antigen defined by the monoclonal antibody Ki-67. J Immunol. 133(4): 1710–1715, 1984.
16. Gomolčák, P., Danihel, Ľ., Šišovský, V.: E-cadherin, a-inhibin a calponin – biologicky aktívne látky
v štruktúrach trofoblastu. Lojdov histochemický deň. Slovenská histochemická spoločnosť, Ústav patologickej
anatómie LF UK, Výskumný ústav srdca SAV, Bratislava. 8, 2005.
17. Ito, K., Sasano, H., Yabuki, N., et al.: Immunohistochemical study of Ki-67 and DNA topoisomerase II in
human endometrium. Mod Pathol. 10(4): 289–294, 1997.
18. Jakubovský, J.: Nekorektnosť vo vedeckom bádaní. In: Hulín, I. (Ed): Základy vedeckej práce. Slovak
Academic Press, Bratislava. 424–442, 2003.
19. Jemal A, Murray T, Ward E, Samuels A, Tiwari RC, Ghafoor A, Feuer EJ, Thun MJ: Cancer statistics, 2005.
CA Cancer J Clin, 55, 2005, 1, 10-30. Erratum in: CA Cancer J Clin, 55, 2005, 4, 259.
20. Lax, S.F., Pizer, E.S., Ronnett, B.M., Kurman, R.J.: Clear cell carcinoma of the endometrium is
characterized by a distinctive profile of p53, Ki-67, estrogen, and progesterone receptor expression. Hum
Pathol. 29: 551–558, 1998.
21. Molnárová, A., Kováčová, E., Majtán, J., et al.: Chlamydia and mycoplasma infections during pregnancy and
their relationships to orofacial cleft. Biologia. 61(6): 719–723, 2006.
22. Mutter, G.L., Ferenczy, A.: Anatomy and histology of the uterine corpus. In: Kurman, R.J. (Ed): Blaustein´s
Pathology of the Female Genital Tract. Springer–Verlag, New York. 383–419, 2002..
23. Pleško, I., et al: Incidencia zhubných nádorov v Slovenskej republike v roku 1990. Aktual klin Onkol. 115,
1994.
24. Pleško, I., et al: Incidencia zhubných nádorov v Slovenskej republike 2000. Národný onkologický ústav,
Ústav experimentálnej onkológie SAV, Národný onkologický register Slovenskej republiky, Bratislava. 207,
2003.
25. Redecha, M., Korbeľ, M., Sasko, A.: Histologické nálezy endometria pri krvácaní v klimaktériu a séniu.
Prakt Gynek. 3: 61–64, 1996.
26. Redecha, M., Nižňanská, Z., Korbeľ, M.: Klinická charakteristika karcinómu endometria. Gynekol prax. 3(4):
13–16, 2005.
27. Redecha, M., Nižňanská, Z., Korbeľ, M.: Výskyt zhubných nádorov tela maternice na Slovensku v rokoch
1990–2000. Gynekol prax. 2(4): 194–199, 2004.
28. Repiská V, Zummerová A, Miklóši M, et al.: Využitie metódy RT-PCR pri detekcii cirkulujúcich
mikrometastáz. Rozhledy v chirurgii. 82(2): 95–102, 2003.
29. Robboy, S.J., Anderson, M.C., Russell, P.: Pathology of the Female reproductive tract. Churchill Livingstone,
London – Edinburg – New York – Philadelphia. 929, 2002.
30. Robboy, S.J., Duggan, M.A., Kurman, R.J.: Gynecologic Pathology. In: Rubin, R., Farber. J.L. (Eds):
Pathology. J. B. Lippincott Company, Philadelphia. 942–989, 1988.
31. Ronnett, B.M., Zaino, R.J., Ellenson, L.H., et al.: Endometrial Carcinoma. In: Kurman, R.J. (Ed): Blaustein´s
Pathology of the Female Genital Tract. Springer Verlag, New York. 501–559, 2002.
32. Salvesen, H.B., Iversen, O.E., Akslen, L.A.: Identification of high-risk patients by assessment of nuclear Ki67 expression in a prospective study of endometrial carcinomas. Clin Cancer Res. 4: 2779–2785, 1998.
33. Scholzen, T., Gerdes, J.: The Ki-67 protein: from the known and the unknown. J Cell Physiol. 182(3): 311–
322, 2000.
34. Silverberg, S.G., Kurman, R.J., Nogales, F., et al.: Epithelial tumors and related lesions. In: Tavassoli, F.A.,
Devilee, P. (Eds): WHO classification of tumours, pathology and genetics, tumours of the breast and female
genital organs. Tumours of the uterine corpus. IARC Press, Lyon. 432, 2003
35. Šišovský, V.: Imunohistochemická analýza endometria za fyziologických a patologických stavov. Dizertačná
práca. Univerzita Komenského, Bratislava. 144, 2005.
36. Šišovský, V., Danihel, Ľ., Babál, P., et al.: Expresia kyseliny sialovej v endometriu za fyziologických stavov,
v hyperplázii endometria a v karcinóme endometria. XIV. vedecká konferencia slovenských a českých
patológov s medzinárodnou účasťou. Zborník vedeckých prác, Mojmírovce. 2006c.
113
37. Šišovský, V., Danihel, Ľ., Babál, P., et al.: Imunohistochemická analýza expresie vybraných proteínov
v endometriu za fyziologických stavov, v hyperplázii endometria a v karcinóme endometria. XIV. vedecká
konferencia slovenských a českých patológov s medzinárodnou účasťou. Zborník vedeckých prác,
Mojmírovce. 2006b.
38. Šišovský, V., Danihel, Ľ., Jakubovský, J. et al.: The identification of sialic acid in normal endometrium and
in endometrial carcinoma (85). In: Tribulová, N., Okruhlicová, Ľ. (Eds): Potential therapeutic targets in
cardiovascular and other diseases. VEDA, Bratislava. 88, 2006e.
39. Šišovský, V., Danihel, Ľ., Štvrtina, S., et al.: Angiogenéza v endometriu za fyziologických stavov,
v hyperplázii endometria a v karcinóme endometria. XIV. vedecká konferencia slovenských a českých
patológov s medzinárodnou účasťou. Zborník vedeckých prác, Mojmírovce. 2006a.
40. Šišovský, V., Palkovič, M., Babál, P., et al.: The expresion of the selected proteins in endometrial carcinoma
(79-84). In: Tribulová, N., Okruhlicová, Ľ. (Eds): Potential therapeutic targets in cardiovascular and other
diseases. VEDA, Bratislava. 88, 2006d.
41. Šišovský, V., Palkovič, M., Zeljenková, D., et al.: Pôsobenie derivátov organofosfátov na reprodukčné
orgány samíc potkanov Wistar. 12. kongres Slovenskej a Českej spoločnosti patológov s medzinárodnou
účasťou. Zborník vedeckých prác, Bratislava. 48, 2004.
42. Šišovský, V., Palkovič, M., Janega, P., et al.: Expression of the estrogen alpha and progesterone receptor in I.
and II. type of endometrial carcinoma. Morphology 2007 - 41st International Congress of Slovak Anatomical
Society and 44th Lojda Symposium on Histochemistry “Progress in Basic, Applied and Diagnostic
Histochemistry”. Programme and Abstracts, Bratislava. 94, 2007.
43. Šišovský, V., Palkovič, M., Janega, P., et al.: Correlation of the proliferation markers expression with the
estrogen alpha receptor in endometrial carcinoma. Morphology 2007 - 41st International Congress of Slovak
Anatomical Society and 44th Lojda Symposium on Histochemistry “Progress in Basic, Applied and Diagnostic
Histochemistry”. Programme and Abstracts, Bratislava. 94, 2007.
44. Šišovský, V., Babál, P., Danihel, Ľ.: Sialylated glycoconjugates as prognostic indicator in clear cell
endometrial carcinoma? Morphology 2007 - 41st International Congress of Slovak Anatomical Society and
44th Lojda Symposium on Histochemistry “Progress in Basic, Applied and Diagnostic Histochemistry”.
Programme and Astracts, Bratislava. 95, 2007.
45. Šišovský, V., Danihel, Ľ., Babál, P., et al.: Identifikácia markerov proliferačnej aktivity v karcinóme
endometria. Prakt Gynek. 14(3): 112–120, 2007.
46. Šuška, P.: Nádory maternice. In: Šuška, P. (Ed): Vybrané kapitoly z gynekológie. Univerzita Komenského.
254, 2003.
47. Šuška, P., Holomáň, K.: Endometrium v peri- a postmenopauze. Slovak Academic Press. Bratislava. 186,
1997.
48. Tabibzadeh, S.: Immunoreactivity of human endometrium: correlation with endometrial dating. Fertil Steril.
54: 624–631, 1990.
49. Weismanová, E., Weismann, P., Vizváryová, M., et al.: New approach to human high-risk papillomavirus
(HR-HPV) genotyping. Neoplasma. 49(4): 217–224, 2002.
114
Identification of protein p53 in correlation with TP53 gene mutation
in endometrial carcinoma
Vladimír Šišovský1, Beata Bučeková1,2, Miroslav Budaj1,2, Ľudovít Danihel1, Vanda Repiská2
1
Department of Pathology, 2Institute of Medical Biology and Genetics, Faculty of Medicine, Comenius
University in Bratislava, Slovak Republic, [email protected]
Abstract
Endometrium is a specialized tissue characterized by intravital changes of its
morphological appearance as well as of the expression of different proteins. It undergoes
changes throughout the productive life of females, during menstrual period and significantly
in neoplastic transformation. A total of 50 archival formalin-fixed and paraffin-embedded
biopsy hysterectomy and curettage tissue specimens with proliferative endometrium (PE),
endometrioid G1 (ECG1) and G3 (ECG3), serous (SC) and clear cell (CCC) ECa were
evaluated immunohistochemically (IHC) for the expression of the protein p53 in nuclei of
endometrial epithelial cells. Tissue specimens with the mentioned endometrial states were
analyzed for the DNA polymorphism of codon 72 of TP53 gene by polymerase chain reaction
using specific primers; product was restricted by restriction endonuclease BstU I (palindrome
CGCG) and detected by agar gel electrophoresis. The expression of p53 was related only to
aggressive (SC and ECG3; less CCC) types of ECa and to the worse clinical behavior of the
tumor. The DNA polymorphism of codon 72 of TP53 was identified in SC. In conclusion, the
increased expression of protein p53 is important prognostic markers of ECa. Evaluation of
this protein by IHC is a relatively inexpensive and simple method with implications for
clinical practice. In SC the expression of the mentioned protein is the highest and correlates
with the TP53 gene alterations, with aggressive phenotype and the worse clinical behavior of
the tumor.
Introduction
The increasing incidence of malignant tumors of the uterine corpus (American Cancer Society
2000, Jemal et al. 2005, Pleško et al. 1994, Pleško et al. 2003, Redecha et al. 2004) is becoming the
subject of interests of various experts from different science disciplines. There are oncologists,
gynecologists (Redecha et al. 1996, 2004, 2005, Šuška a Holomáň 1997, Šuška 2003), molecular
biologists and genetics (Repiská et al. 2003) and pathologists (Breitenecker & Lax 1994, Danihel
& Breitenecker 1997, Robboy et al. 2002, Danihel et al. 1995, 2003, 2005, Silverberg et al. 2003,
Šišovský et al. 2004, 2006a,b,c,d,e, 2007a,b,c,d, Šišovský 2005, Budaj & Bučeková 2007a,b).
Endometrial carcinoma (ECa) is the most common invasive neoplasm of the female genital
tract, the 4th most frequently diagnosed cancer in the United States and worldwide the 5th most
common cancer in women (American Cancer Society 2000, Ronnett et al. 2002, Jemal et al. 2005) and
having an increasing incidence in the Slovak Republic (Pleško et al. 1994, 2003).
Immunohistochemical (IHC) analysis is frequently one of the determining factor of diagnosis and
prognosis of oncological illnesses with implications on their cure (Danihel a Porubský 1991, Danihel
et al. 1995, Azumi a Czernobilsky 2002).
Endometrium is a specialized tissue characterized by intravital changes of its morphological
appearance as well as of the expression of different proteins (Mutter a Ferenczy 2002). It undergoes
changes throughout the productive life of females, during menstrual period (Mutter a Ferenczy 2002)
and significantly in neoplastic transformation (Ronnett et al. 2002). Expression of some proteins may
be the first indicator of cell differentiation grade, proliferation and malignant change, as well as of
clinical behavior of ECa.
The TP53 is a tumor suppressor gene located on chromosome 17 (17p13.1) (Isobe et al. 1986,
Kirsch a Kastan 1998) encoding a DNA-binding phosphoprotein p53 (Sekido et al. 2003) that is
involved in the regulation of the CC (at the G1 checkpoint); has an inhibitory effect on cell
proliferation and transformation and an activating effect on DNA repair and apoptosis (Kirsch
a Kastan 1998, Sekido et al. 2003).
115
Mutation of the TP53 results in a mutant p53 with a longer half-life that accumulates in the
cells (Kerns et al. 1992, Lodish et al. 2004) and lack of the above presented functions (Blagosklonny
2002, Ronnett et al. 2002).
TP53 genetic alterations are associated with accelerated cell proliferation and aggressive
phenotype of tumors (Kirsch a Kastan 1998) in a variety of human malignancies (Saffari et al. 2005).
Molecular genetic studies have shown allelic deletion of chromosome 17p resulting in a mutated p53
in many malignant tumors including ECa (Okamoto et al. 1991).
To evaluate IHC changes of expression of the protein p53 in correlation with the presence of
TP53 codon 72 polymorphism with morphological appearance and clinical findings of ECa.
Materials and methods
A total of 50 endometrial biopsies (from the archives of Department of Pathology, Faculty of
Medicine, Comenius University in Bratislava, during in years 1997-2007), that were obtained from
endometrial curettage and hysterectomy specimens were included in this study. Formalin-fixed and
paraffin-embedded tissue samples, classified by light microscopy, with proliferative endometrium (PE)
(from woman 26-45 years of the age), endometrioid (EC) G1 (ECG1) (31-61 y.) and G3 (ECG3) (3161 y.), serous (SC) (39-86 y.) and clear cell (CCC) (60-86 y.) histological subsets of ECa were
evaluated by IHC. The expression of the protein p53 in nuclei of endometrial epithelial cells was
detected with monoclonal mouse antibody anti human p53 (DakoCytomation, Glostrup, Denmark).
The indirect streptavidin-biotin – horseradish peroxidase complex (ABC-Px) technique with 3,3´diaminobenzidine (DakoCytomation, Glostrup, Denmark) as chromogen was used to visualize the
reaction product (DakoCytomation 2004, Azumi a Czernobilsky 2002). Findings (the protein
expression / antibody reaction) were evaluated by light microscopy (Nikon Coolpix 990, Tokyo, Japan)
semiquantitatively by scoring: negative – „-“, irregular weak positivity (up to 5% cells) – „+/-“,
regular weak positivity (> 5% and < 25% cells) – „+“, regular moderate positivity (25% to 50% cells)
– „++“, regular strong positivity (> 50% cells) – „+++“. Only nuclear staining was considered specific.
Slides incubated with plain buffer instead of primary antibody were considered as negative control
(NC).
Tissue specimens with the mentioned endometrial states were analyzed for the DNA
polymorphism of codon 72 (exon 4, presents the arginine (Arg) or proline (Pro) allelotypes) in the
TP53 gene (17p13.1). DNA was isolated from formalin-fixed and paraffin-embedded tissue samples
by the solting-out procedure (Qiagen GmBH, Hilden; Invitrogen, USA) and amplified by polymerase
chain reaction (PCR) using specific primers for codon 72 of the TP53 (Genecraft, Germany). PCR
product (size 296 bp) was restricted by restriction endonuclease BstU I (palindrome CGCG) (New
England Biolabs, USA) and detected by agar gel electrophoresis (Amresco, USA).
Used methods/techniques corresponded to national and international ethical standards
(Helsinki declaration in year 2002) (Jakubovský 2003).
Results and discussion
The expression of p53 was related only to aggressive (mainly SC and ECG3; less CCC) types
of ECa (Fig. 3, 4, 5) and to the worse clinical behavior of the tumor. No expression of p53 was
detected in PE and ECG1 (Fig. 1 a 2) (Tab. 1). The DNA polymorphism of codon 72 of TP53 was
identified only in SC (70%), and correlated with the strong p53 immunoreactivity. The same
polymorphism was not found in PE, ECG1, ECG3 and CCC (wild type allelotype) (Fig. 6).
Endometrial status
anti p53 antibody reaction
Proliferative endometrium
Endometrioid endometrial carcinoma, G1
Endometrioid endometrial carcinoma, G3
Serous endometrial carcinoma
Clear cell endometrial carcinoma
++
+++
+
Tab. 1. View of the anti p53 antibody reactions with nuclei of human endometrial glandular epithelial
cells.
Reaction: − negative, +/− irregular weak positivity, + regular weak positivity, ++ regular moderate positivity,
+++ regular strong positivity
116
Fig. 1. Note the absence of p53 in PE. Avidin-biotin – peroxidase complex (ABC-Px), 100x.
Fig. 2. Note the absence of p53 in ECG1. ABC-Px, 100x.
Fig. 3. p53 detection in ECG3. ABC-Px, 200x.
Fig. 4. Regular intense expression of p53 in SC. ABC-Px, 100x.
Fig. 5. Regular weak expression of p53 in CCC. ABC-Px, 120x.
117
Fig. 6. The DNA polymorphism of codon 72 of TP53 detection in SC (side rail). Line (DNA
restriction): known allelotypes (1-3): Pro/Pro (1), Arg/Arg (2), Arg/Pro (3); ECa (4-7), PE (8), NC (9),
weight marker (mw) 100 bp ladder.
Our results show a good correlation of expression of the protein p53 with histological grade of
differentiation and are in agreement with other published works. To our best knowledge this is the first
study evaluating the action of the protein p53 in correlation with the presence of TP53 codon 72
polymorphism in the endometrial glandular epithelial cells. Mutation of the p53 gene results in a
mutant protein with a longer half-life that accumulates in the cell, and does not have the suppressor
function for cell proliferation and transformation (Ronnett et al. 2002). Mutations in p53 are found in
approximately 10% of all EC (Okamoto et al. 1991), and in approximately 50% of ECG3, and have
not been identified in ECG1 (Parazzini et al. 1995), which was found as increased expression of p53 in
ECG3 and no expression of p53 in ECG1 and PE in our material.
In SC, the TP53 was shown to be altered in a significant number, with mutation identified in
almost 90% of cases. Furthermore, approximately 75% of endometrial intraepithelial carcinomas, the
putative precursor of SC, have mutations in TP53 (p53) (Tashiro et al. 1997). These findings suggest
that in SC TP53 (p53) mutations occur relatively early and are central to the development of this
tumor type. This is in contrast to EC, in which TP53 (p53) mutations are relatively uncommon and
when they do occur, they are largely confined to ECG3 (Parazzini et al. 1995, Tashiro et al. 1997).
This sentence found support in our results; in SC there was the highest increase of p53 expression,
slightly lower expression was in ECG3. Thus, it is possible that the mutation of p53 early in the
pathogenesis of SC is an important factor that accounts for its aggressive behavior (Soong et al. 1996).
Malignant potencial of SC is similar to CCC (Danihel a Breitenecker 1997) when compared to EC
(Sakuragi et al. 2000). Nonetheless, CCC is probably distinct from SC (and also EC) based on the
significantly lower expression of p53 detected by IHC (Lax et al. 1998). This change corresponds to
the result of our analysis, in which CCC demonstrated lower expression of p53 then SC. Results of
Elhafey et al. (2001) showed, that expression of p53 was higher in the poor prognostic categories (SC
and CCC) than in EC; in EC, p53 expression correlated with grade. The expression of p53 has a
prognostic value in ECa (Hamel et al. 1996), and is an independent prognostic indicator in human ECa
(Soong et al. 1996). Mutation or overexpression of p53 protein in ECa has been generally related to
higher FIGO (International Federation of Gynecology and Obstetrics) stage, aggressive cell types
(particularly SC), increased histological grade and depth of myometrial invasion (napr. Khalifa et al.
1994, Tashiro et al. 1997, Geisler et al. 1996, Lax et al. 1998).
Saffari et al. (2005) examined p53 for genetic alterations (p53 mutations in exons 2-11 and
p53 codon 72 single nucleotide polymorphisms (SNP) with an Arg/Pro allelotype) in 59 EC; twelve
mutations (20.3%) and seven of the nine polymorphisms in codon 72 SNP with an Arg/Pro allelotype
were identified. This finding do not corresponds to the result of our analysis, in which the same
polymorphism of codon 72 of TP53 was not found in EC. Results of Saffari et al. (2005) showed, that
the women with p53 genetic alterations (p53 mutation or p53 codon 72 SNP) had a lower overall
survival rate than women whose tumors lacked alterations in the p53 gene. Among women with p53
alterations, adjuvant radiotherapy substantially increased survival.
Conclusions
The findings support the importance of IHC in detection of p53 protein in endometrium and
possibilities in classification of various histological subsets and grades of ECa. The expression of p53
is related only to aggressive (SC and ECG3; less CCC) types of ECa. In SC the expression of the
mentioned protein is the highest and correlates with the TP53 alterations, with aggressive phenotype
and the worse clinical behavior of the tumor. In conclusion, the increased expression of protein p53 is
118
important prognostic markers of ECa. Evaluation of this protein by IHC is a relatively inexpensive and
simple method with implications for clinical practice – on oncological illness cure.
Acknowledgements
This work was supported by grant of Lions Club International LC Bamberg-Mischelsberg
and LC Kremnica and by UK/36/2007. Authors thank for the kind technical support to Mrs. I. Uhnavá.
The first author wish to acknowledge District Governor 2006-2007 of Lions Club International
District D-122 Czech Republic and Slovak Republic Mr. Dipl. Ing. Tibor Buček for his kind support.
References
1. American Cancer Society: 2000 cancer statistics. CA Cancer J Clin. 50(1): 1–64, 2000.
2. Azumi, N., Czernobilsky, B.: Immunohistochemistry. In: Kurman, R.J. (Ed): Blaustein´s Pathology of the
Female Genital Tract. 5th Edn. Springer – Verlag, New York. 1251–1276, 2002.
3. Blagosklonny, M.V.: P53: An ubiquitous target of anticancer drugs. Int J Cancer. 98: 161–166, 2002.
4. Breitenecker, G., Lax, S.: Tumoren des Corpus uteri einschliesslich der Plazenta (97-102). In: Histologische
Tumor Klassifikation. Springer-Verlag, Wien, New York. 432, 1994.
5. Budaj, M., et al.: Identifikácia markerov proliferačnej aktivity v karcinóme endometria. 46. fakultná
konferencia ŠVOČ. Zborník prác. LF UK a Slovak Academic Press, Bratislava. 22–25, 2007a.
6. Budaj M, et al.: Identification of proliferation markers in correlation with p53 gene mutation in endometrial
carcinoma. Vědecká konference studentů českých a slovenských lékařských fakult. Program a abstrakta
prednášek, 3. lékařská fakulta Univerzity Karlovy v Praze. 2007b.
7. DakoCytomation: DakoCytomation 2004/05 Catalog. Denmark: Glostrup. 359, 2004.
8. Danihel Ľ, Breitenecker G: Histologická diagnostika nenádorových a nádorových zmien endometria v peria postmenopauze. In: Šuška, P., Holomáň, K. (Eds): Endometrium v peri- a postmenopauze. Slovak Academic
Press, Bratislava. 14–41, 1997.
9. Danihel, Ľ., Porubský, J.: Prínos monoklonálnych protilátok v bioptickej diagnostike nádorov. Bratisl lek
Listy. 92: 460–466, 1991.
10. Danihel, Ľ., et al.: Imunohistochemické markery v diagnostike nádorov maternice. Bratisl lek Listy. 96: 353–
360, 1995.
11. Danihel, Ľ., Horváth, R., Breitenecker, G., Hatzibugias, I.: Súčasná klasifikácia a charakteristika nádorov
endometria. Slov gynek por. 10(Suppl): 14–17, 2003.
12. Danihel, Ľ., Šišovský, V., Palkovič, M., et al.: Karcinóm endometria – histopatologická klasifikácia a
charakteristika. Gynekol prax. 3: 9–12, 2005.
13. Elhafey, A.S., et al: Computerized image analysis of p53 and proliferating cell nuclear antigen expression in
benign, hyperplastic, and malignant endometrium. Arch Pathol Lab Med. 125: 872–879, 2001.
14. Geisler, J.P., et al: p53 as a prognostic indicator in endometrial cancer. Gynecol Oncol. 61: 245–248, 1996.
15. Hamel, N.W., Sebo, T.J., Wilson, T.O., et al.: Prognostic value of p53 and proliferating cell nuclear antigen
expression in endometrial carcinoma. Gynecol Oncol. 62: 192–198, 1996.
16. Isobe, M., Emanuel, B.S., Givol, D., et al.: Localization of gene for human p53 tumour antigen to band
17p13. Nature. 320: 84–85, 1986.
17. Jakubovský, J.: Nekorektnosť vo vedeckom bádaní. In: Hulín, I. (Ed): Základy vedeckej práce. Slovak
Academic Press, Bratislava. 424–442, 2003.
18. Jemal, A., Murray, T., Ward, E., et al.: Cancer statistics. CA Cancer J Clin. 55: 10–30, 2005.
19. Kerns, B.J., Jordan, P.A., Moore, M.B., et al.: p53 overexpression in formalin-fixed, paraffin-embedded
tissue detected by immunohistochemistry. J Histochem Cytochem. 40: 1047–1051, 1992.
20. Khalifa, M.A., Mannel, R.S., Haraway, S.D., et al.: Expression of EGFR, HER-2/neu, P53, and PCNA in
endometrioid, serous papillary, and clear cell endometrial adenocarcinomas. Gynecol Oncol. 53: 84–92, 1994.
21. Kirsch, D.G., Kastan, M.B.: Tumor-suppressor p53: implications for tumor development and prognosis. J
Clin Oncol. 16: 3158–3168, 1998.
22. Lax, S.F., et al.: Clear cell carcinoma of the endometrium is characterized by a distinctive profile of p53, Ki67, estrogen, and progesterone receptor expression. Hum Pathol. 29: 551–558, 1998.
23. Lodish, H., et al.: Molecular cell biology. W.H. Freeman and company, New York. 2004.
24. Mutter, G.L., Ferenczy, A: Anatomy and histology of the uterine corpus. In: Kurman, R.J. (Ed): Blaustein´s
Pathology of the Female Genital Tract. 5th Edn. Springer-Verlag, New York. 383–419, 2002.
25. Okamoto, A., Sameshima, Y., Yamada, Y., et al.: Allelic loss on chromosome 17p and p53 mutations in
human endometrial carcinoma of the uterus. Cancer Res. 51: 5632–5635, 1991.
26. Parazzini, F., La Vecchia, C., Negri, E.: Smoking and risk of endometrial cancer: results from an Italian casecontrol study. Gynecol Oncol. 56: 195–199, 1995.
27. Pleško, I., et al.: Incidencia zhubných nádorov v Slovenskej republike v roku 1990. Aktual klin Onkol. 115,
1994.
119
28. Pleško, I., et al.: Incidencia zhubných nádorov v Slovenskej republike 2000. Národný onkologický ústav,
Ústav experimentálnej onkológie SAV, Národný onkologický register SR, Bratislava. 207, 2003.
29. Redecha, M., Korbeľ, M., Sasko, A.: Histologické nálezy endometria pri krvácaní v klimaktériu a séniu.
Prakt Gynek. 3: 61–64, 1996.
30. Redecha, M., et al.: Klinická charakteristika karcinómu endometria. Gynekol prax. 3: 13–16, 2005.
31. Redecha, M., Nižňanská, Z., Korbeľ, M.: Výskyt zhubných nádorov tela maternice na Slovensku v rokoch
1990-2000. Gynekol prax. 2: 194–199, 2004.
32. Repiská, V., Zummerová, A., Miklóši, M., et al.: Využitie metódy RT-PCR pri detekcii cirkulujúcich
mikrometastáz. Rozhledy v chirurgii. 82: 95–102, 2003.
33. Robboy, S.J., Anderson, M.C., Russell, P.: Pathology of the Female reproductive tract. Churchill Livingstone,
London, Edinburg, New York, Philadelphia. 929, 2002.
34. Ronnett, B.M., Zaino, R.J., Ellenson, L.H., Kurman, R.J.: Endometrial Carcinoma. In: Kurman R.J. (Ed):
Blaustein´s Pathology of the Female Genital Tract. 5th Edn. Springer Verlag, New York. 501–559, 2002.
35. Saffari, B., Bernstein, L., Hong, D.C., et al.: Association of p53 mutations and a codon 72 single nucleotide
polymorphism with lower overall survival and responsiveness to adjuvant radiotherapy in endometrioid
endometrial carcinomas. Int J Gynecol Cancer. 15: 952–963, 2005.
36. Sakuragi, N., Hareyama, H., Todo, Y., et al.: Prognostic significance of serous and Clar cell adenocarcinoma
in surgically staged endometrial carcinoma. Acta Obstet Gynecol Scand. 79: 311–316, 2000.
37. Sekido, Y., Fong, K.M., Minna, J.D.: Molecular genetics of lung cancer. Annu Rev Med. 54: 73–87, 2003.
38. Silverberg, S.G., Kurman, R.J., Nogales, F., et al.: Epithelial tumors and related lesions. In: Tavassoli, F.A.,
Devilee, P. (Eds): WHO classification of Tumours, Pathology and Genetics, Tumours of the Breast and
Female Genital Organs. Tumours of the Uterine Corpus. IARC Press, Lyon. 432, 2003.
39. Soong, R., Knowles, S., Williams, K.E., et al.: Overexpression of p53 protein is an independent prognostic
indicator in human endometrial carcinoma. Br J Cancer. 74: 562–567, 1996.
40. Šišovský, V.: Imunohistochemická analýza endometria za fyziologických a patologických stavov. Dizertačná
práca. Univerzita Komenského, Bratislava. 144, 2005.
41. Šišovský, V., Danihel, Ľ., Babál, P., et al.: Expresia kyseliny sialovej v endometriu za fyziologických stavov,
v hyperplázii endometria a v karcinóme endometria. XIV. vedecká konferencia slovenských a českých
patológov s medzinárodnou účasťou. Zborník vedeckých prác. Mojmírovce. 2006c.
42. Šišovský, V., et al.: Imunohistochemická analýza expresie vybraných proteínov v endometriu za
fyziologických stavov, v hyperplázii endometria a v karcinóme endometria. XIV. vedecká konferencia
slovenských a českých patológov s medzinárodnou účasťou. Zborník vedeckých prác, Mojmírovce. 2006b.
43. Šišovský, V., Danihel, Ľ., Jakubovský, J., et al.: The identification of sialic acid in normal endometrium and
in endometrial carcinoma (85). In: N. Tribulová, Ľ. Okruhlicová (Eds) Potential therapeutic targets in
cardiovascular and other diseases. VEDA, Bratislava. 88, 2006e.
44. Šišovský, V., Danihel, Ľ., Štvrtina, S., et al.: Angiogenéza v endometriu za fyziologických stavov,
v hyperplázii endometria a v karcinóme endometria. XIV. vedecká konferencia slovenských a českých
patológov s medzinárodnou účasťou. Zborník vedeckých prác, Mojmírovce. 2006a.
45. Šišovský, V., Palkovič, M., Babál, P., et al.: The expresion of the selected proteins in endometrial carcinoma
In: Tribulová, N., Okruhlicová, Ľ. (Eds): Potential therapeutic targets in cardiovascular and other diseases.
VEDA, Bratislava. 79–84, 2006d.
46. Šišovský, V., Palkovič, M., Zeljenková, D., et al.: Pôsobenie derivátov organofosfátov na reprodukčné
orgány samíc potkanov Wistar. 12. kongres Slovenskej a Českej spoločnosti patológov s medzinárodnou
účasťou. Zborník vedeckých prác, Bratislava. 48, 2004.
47. Šišovský, V., Palkovič, M., Janega, P., et al.: Expression of the estrogen alpha and progesterone receptor in I.
and II. type of endometrial carcinoma. Morphology 2007 - 41st International Congress of Slovak Anatomical
Society and 44th Lojda Symposium on Histochemistry “Progress in Basic, Applied and Diagnostic
Histochemistry”. Programme and Abstracts, Bratislava. 94, 2007.
48. Šišovský, V., Palkovič, M., Janega, P., et al.: Correlation of the proliferation markers expression with the
estrogen alpha receptor in endometrial carcinoma. Morphology 2007 - 41st International Congress of Slovak
Anatomical Society and 44th Lojda Symposium on Histochemistry “Progress in Basic, Applied and Diagnostic
Histochemistry”. Programme and Abstracts, Bratislava. 94, 2007.
49. Šišovský, V., Babál, P., Danihel, Ľ., et al.: Sialylated glycoconjugates as prognostic indicator in clear cell
endometrial carcinoma? Morphology 2007 - 41st International Congress of Slovak Anatomical Society and
44th Lojda Symposium on Histochemistry “Progress in Basic, Applied and Diagnostic Histochemistry”.
Programme and Astracts, Bratislava. 95, 2007.
50. Šišovský, V., Danihel, Ľ., Babál, P., et al.: Identifikácia markerov proliferačnej aktivity v karcinóme
endometria. Prakt Gynek. 14: 112–120, 2007.
51. Šuška, P.: Nádory maternice. In: Šuška, P. (Ed): Vybrané kapitoly z gynekológie. Univerzita Komenského,
Bratislava. 182–200, 2003.
52. Šuška, P., Holomáň, K.: Endometrium v peri- a postmenopauze. SAP, Bratislava. 186, 1997.
53. Tashiro, H., Isacson, C., Levine, R.,e t al.: p53 gene mutations are common in uterine serous carcinoma and
occur early in their pathogenesis. Am J Pathol. 150: 177–185, 1997.
120
Detekcia mikrodelécií Y chromozómu u mužov s poruchami plodnosti
Ľubica Strháková, Regína Behulová, Robert Petrovič, Katarína Kolejáková, Danka Maceková,
Mária Fischerová, Jozef Adámať, Pavol Ipóth, Ján Chandoga
Centrum lekárskej genetiky FNsP Bratislava, Slovenska Republika, [email protected]
Abstrakt
Y chromozóm je najmenší z ľudských chromozómov. Na dlhom ramienku Y
chromozómu sa nachádza AZF oblasť (azoospermia factors). Delécie v tejto oblasti spôsobujú
poruchy spermatogenézy a pacienti trpia rôznymi poruchami plodnosti. AZF oblasť je
rozdelená na tri podoblasti: AZFa, AZFb a AZFc. Na základe Európskych guidelines pri
poruchách fertility sa odporúča vyšetrovať šesť sekvencií sY 84, sY 86, sY 127, sY 134, sY
254, sY 255, ktoré sa nachádzajú v jednotlivých podoblastiach a SRY gén (tzv. TDF - testes
determing factor), ktorý sa nachádza na krátkom ramienku Y chromozómu. Na identifikáciu
AZF delécii sme použili PCR metódu. V sledovanom súbore 822 pacientov sme delécie AZF
oblasti zaznamenali u 38 pacientov, čo predstavuje 4,62%.
Úvod
Príčiny porúch plodnosti sú založené buď na biologickom podklade alebo sú spôsobené
vplyvom vonkajších podmienok. Z vonkajších faktorov je to najmä fajčenie, alkohol, toxické látky.
Z biologických sú to rôzne druhy infekcií, produkcia antispermatických protilátok, varikokela, tumory
testes. K vývojovým a štrukturálnym vadám patria kryptorchizmus, Klinefelterov syndróm XXY,
mikrodelécie v AZF lokuse (13% azoospemických mužov, 1-7 %oligospermických mužov), „sex
reversal“ syndróm- 46,XX s mužským fenotypom s výskytom 1:20000 chlapcov, SCO (Sertoli cell
only) syndróm a chromozómové abnormality (trizómia).
Mikrodelécie Y chromozómu sú druhou najčastejšou genetickou príčinou porúch
spermatogenézy u mužov s poruchami plodnosti. Molekulárna diagnostika týchto mikrodelécií sa stala
dôležitým diagnostickým krokom laboratórneho vyšetrenia mužov s poruchou plodnosti (Vogt a kol.,
1996).
Y chromozóm má dĺžku 60Mb (Brdička a kol., 1995). Gény ležiace na tomto chromozóme
majú esenciálnu úlohu v determinácii mužského pohlavia. 95 % Y chromozómu tvorí mužský
špecifický región (MSY), ktorý je ohraničený pseudoautozomálnymi oblasťami.
V MSY regióne sa nachádzajú 3 AZF oblasti : AZFa, AZFb, AZFc (Vogt a kol., 1996) (obr.1).
Tiepollo a Zuffardi lokalizovali AZF oblasť do regiónu Yq11.23 (Tiepollo, Zuffardi, 1976).
Mikrodelécie sú relatívne časté u pacientov s poruchami plodnosti, hoci ich incidencia môže značne
varírovať v závislosti na selekčných kritériách, podľa ktorých sú pacienti vyberaný. Azoospermici
majú vyšší výskyt mikrodelécií ako oligospermici, a preto sa frekvencia delécií pri vyšetrení v rôznych
laboratóriách pohybuje v pomerne širokom rozpätí 2-10 % ( Krausz a McElreavey, 1999, Krausz
a kol., 2001).
Obr. 1. Schematické znázornenie AZF oblasti a jej 3 podoblastí AZFa, AZFb, AZFc.
121
Materiál a metódy
Do Centra lekárskej genetiky FNsP Bratislava bolo od roku 1998 do roku 2006 zaslaných 822
pacientov s požiadavkou vyšetrenia mikrodelécií AZF oblasti Y chromozómu v dôsledku rôznych
porúch mužskej neplodnosti. Klinickým materiálom zaslaným z iných pracovísk na vyšetrenie je
periférna krv v roztoku EDTA (výsledná koncentrácia 5 mmol), prípadne už naizolovaná DNA. DNA
sme izolovali klasickou vysoľovacou metódou, resp. použitím komerčného setu FlexiGene DNA Kit.
Na detekciu mikrodelécií v AZF sme použili metódu polymerázovej reťazovej reakcie (PCR):
denaturácia 94 ° C/5min, (denaturácia 94° C/ 1 min, annealing primerov 61° C/ 1min, polymerizácia
72° C/ 1 min) 30 cyklov, záverečná dlhá polymerizácia 72° C/5 min. Ako pozitívnu kontrolu sme
použili DNA zdravého muža, ako negatívnu kontrolu DNA zdravej ženy, ako internú kontrolu
sekvencie ZFY/ZFX a PABX. PCR produkty sme elektroforeticky separovali v 2% agarózovom géli pri
laboratórnej teplote, v TBE tlmivom roztoku pri 200 mA. DNA sme vizualizovali pomocou EtBr
(etídium bromid), ktorý sme pridali priamo do gélu s presvietením na UV transluminátore.
Výsledky a diskusia
Diagnózy zaslaných pacientov do CLG FNsP sme rozdelili do 4 skupín: azoospermia,
oligospermia, oligoasthenospermia a iné. Do skupiny iné sme zaradili diagnózy s nízkym zastúpením
u pacientov (oligoasthenoteratospermia, teratospermia, nekrospermia a patologický karyotyp).
V sledovanom súbore 822 pacientov bolo 349 pacientov s azoospermiou (42%), 92 pacientov
s oligospermiou (11%), 196 pacientov s oligoasthenospermiou (24%) a 185 pacientov sme zaradili do
skupiny iné (23%), ktorá zahŕňa málopočetné diagnózy. Priemerný vek pacientov bol 31,74.
Z každej z troch definovaných AZF podoblastí- AZFa, AZFb a AZFc sme vybrali sekvencie,
ktoré sme použili na zistenie mikrodelécií.
Z AZFa podoblasti sú to sekvencie sY 85, sY 84, sY 86, z AZFb podoblasti sY 129, sY 164,
sY 139, sY 143, sY 127, sY 134 a z AZFc podoblasti sekvencie sY 147, sY 158, sY 243, sY 273, sY
220, sY 277, sY 283, sY 254, sY 255. Spolu to predstavovalo 18 sekvencií, ktoré sa nachádzajú na
dlhom ramienku Y chromozómu v AZF oblasti.
V súbore pacientov sme zachytili 38 pacientov s deléciou, čo predstavuje 4,62%. 24
pacientov s deléciou je v súbore pacientov s azoospermiou, čo predstavuje 6,88%, 4 pacienti sú
v súbore s oligospermiou (4,35%), 9 pacientov je v súbore oligoasthenospermiou (4,59%) a jeden
pacient je zo súboru iné (0,54%). V súbore pacientov s azoospermiou a oligospermiou sme zistili 28
pacientov s deléciou (6,35%).
Najvyššie zastúpenie delécií je z podoblasti AZFc (52%), z podoblasti AZFb je to 29%
a najnižšie zastúpenie má podoblasť AZFa (19%). Percentuálne zastúpenie delécií z oblasti AZFbc je
80,7%.
Najčastejšie deletovanou sekvenciou bola sekvencia sY 283, ktorá nebola diagnostikovaná v
72% pacientov so zistenou deléciou. Delécia sekvencie sY 243 nebola diagnostikovaná ani v jednom
prípade. Obe sekvencie sa nachádzajú v AZFc podoblasti.
Z celkového počtu 822 pacientov s požiadavkou na vyšetrenie mikrodelécií AZF oblasti sme
delécie zaznamenali v 38 prípadoch (4,62%). Literárne zdroje uvádzajú, že 10-15% pacientov
s azoospermiou a 5-10% pacientov s oligospermiou má mikrodelécie v AZF oblasti (Cram a kol., 2000,
McElvearey, Krausz, 1999). Naša hodnota 4,62% je pod udávanou frekvenciou pacientov
s oligospermiou. Jedným z dôvodom veľkého rozpätia intervalu frekvencií delécií je etnické zloženie
študovaných pacientov (Krausz a kol., 2001, Maurer a kol., 2001).
Zo sledovaného súboru 822 pacientov sme delécie AZF oblasti zistili v 38 prípadoch (4,62%),
24 pacientov pochádza zo súboru pacientov s azoospermiou (6,88%), 4 pacienti s deléciami mali
diagnostikovanú oligospermiu (4,35%), 9 pacientov s deléciami oligoasthenospermiu (4,59%) a jeden
pacient je zo súboru iné s presne neurčenou gonozómovou anomáliou. Brandell a kol. a Martinez a kol.
uvádzajú, že mikrodelécie Y chromozómu majú zastúpenie v 6-18% pacientov s azoospermiou a
oligospermiou (Brandell a kol., 1998, Martinez a kol., 2000). V našom súbore pacientov sme zistili
6,3% zastúpenie pacientov s mikrodeléciami AZF oblasti u pacientov s azoospermiou a oligospermiou,
čo zapadá do uvedeného intervalu.
Závery
PCR metóda sa ukázala ako dostatočne spoľahlivá, rýchla a citlivá metóda na zistenie
mikrodelécií AZF oblasti.
122
V budúcnosti doporučujeme zamerať sa j na iné gény, ktoré zohrávajú dôležitú úlohu
v determinácii pohlavia (DAX1 gén) a ich identifikáciu pomocou časovo a finančne nenáročných
metód, napríklad real time PCR.
Použitá literatúra
1. Brdička, R., Siegelova, Z.: Lidský genom - Y chromozom. Časopis Lékařu českých. 134: 798–800, 1995.
2. Brandell, R.A., Mielnik, A., Liotta, D., et al.: AZFb deletions predict the absence of spermatozoa with
testicular sperm extraction: preliminary report of a prognostic genetic test. Hum Reprod. 13: 2812–2815, 1998.
3. Cram, D.S., Ma, K., Bhasin, S., et al.: Y chromosome analysis of infertile men and their sons conceived
through intracytoplasmic sperm injectin: vertical transmission of deletions and rarity of the de novo deletions.
Fertil. Steril. 74(5): 909–915, 2000.
4. Krausz, C., McElreavey, K.: Y chromosome and male infertility. Frontiers in Bioscience. 4: E1–8., 1999.
5. Krausz, C., Rajpert - De Meyts, E., Larsen, L.F., et al.: Double blind screening for microdeletions Y
chromosome genes in infertile and fertile/normospermic danish men. J Clin Endocrinol Metabolism. 86:
2638–2642, 2001.
6. Martinez, M.C., Bernabe, M.J., Gomez, E., et al.: Screening for AZF deletion in a large series of severely
impaired spermatogenesis patients. J Androl. 21: 651–655, 2000.
7. Maurer, B., Gromoll, J., Simoni, M., Nieschlag, E.: Prevalence of Y chromosome microdeletions in infertile
men who consulted a tertiary care medical centre: the Munster experience. Andrologia. 33: 27–33, 2001.
8. Tiepolo, L., Zuffardi, O.: Localization of factors controlling spermatogenesis in the nonfluorescent portion of
the human Ychromosome long arm. Hum Genet. 34: 119–124, 1976.
9. Vogt, P.H., Edelmann, A., Kirsch, S.: Human Y chromosome azoospermia factors (AZF) mapped to different
subregions in Yq11. Hum Mol Genet. 5: 933–43, 1996.
123
Štúdium biokompatibility biomateriálov na báze prírodných polymérov : mikrokapsule
na báze chitozánu a ľudská amniová membrána
Marica Theiszová1, Soňa Jantová1, Jana Dragúňová2, Lucia Kalinovská3
1
Ústav biochémie, výživy a ochrany zdravia, Fakulta chemickej a potravinárskej technológie STU,
Bratislava; 2Centrálna tkanivová banka, Klinika popálenín, FNsP Ružinov, Bratislava; 3Ústav polymérnych
materiálov, Fakulta chemickej a potravinárskej technológie STU, Bratislava, Slovenská Republika
Abstrakt
Štúdium biokompatibility biomateriálov predpisujú toxikologické smernice ISO.
V tejto práci sa študovala cytotoxicita štyroch typov mikrokapsúl na báze chitozánu na NIH3T3 bunkách sledovaním množstva uvoľneného LDH a vhodnosť použitia ľudskej amniovej
membrány na kultiváciu a liečbu deficiencie limbálnych kmeňových buniek. Testy
cytotoxicity potvrdili netoxický charakter všetkých typov mikrokapsúl a vhodnosť použitia
amniovej membrány pri reepitalizácii rohovky.
Úvod
V súčasnosti sa biomateriály používajú pri obnovení alebo zlepšení funkcií ľudského tela ako
umelé bedrové kĺby, umelé srdcové chlopne, umelé šlachy a cievy, ale čoraz častejšie nachádzajú
svoje uplatnenie aj v maxilofaciálnej a plastickej chirurgii.
Mikrokapsule na báze chitozánu predstavujú polymérny typ biomateriálu, ktorého základ tvorí
lineárny polysacharid pozostávajúci z (1-4)-2-amino-2-deoxy-β-D-glukopyranózy. Chitozán má
v medicíne široké uplatnenie (ortopédia, oftalmológia, farmácia). Mikrokapsule na báze chitozánu boli
pripravené s cieľom ich medicínskeho využitia ako nosičov pre antibiotiká.
Amniová membrána-vnútorná membrána fetálnej membrány predstavuje prírodný biomateriál,
ktorý má výborné biologické vlastnosti (antibakteriálne, chráni pred poranením, mierni bolesť, potláča
fibrózu, napomáha epitelizácii rohovky). Pre tieto vlastnosti sa využíva v rôznych odvetviach
medicíny (transplantácia kože, obväz na otvorené rany, oftalmológia). V oftamológii sa používa pri
rekonštrukciách a epitelizácii rohovky u pacientov s čiastočnou alebo úplnou deficienciou limbálnych
kmeňových buniek (http://www.dcmsonline.org/jax-medecine/2002journals/augsept2002/amniotic.
html; Schwab et al. 2000; Tsai et al. 2000). Nami pripravená amniová membrána obsahujúca epitelovú
vrstvu sa použila na kultiváciu limbálnych kmeňových buniek.
Biomateriály môžu pre človeka predstavovať nízke, stredné alebo vysoké potencionálne riziko
zdravotnej bezpečnosti v závislosti od typu rozsahu biomateriálu s pacientovým telom. Jedným
z kritérií hodnotenia je štúdium cytotoxicity – škodlivosti až jedovasti biomateriálu pre bunkový
systém. V tejto práci sme študovali cytotoxický účinok štyroch typov mikrokapsúl na báze chitozánu
na fibroblastových myšacích NIH-3T3 bunkách a ľudskej amniovej membrány na limbálnych
kmeňových bunkách.
Materiál a metódy
Mikrokapsule štyroch typov sa pripravili jednokrokovým kontinuálnym spôsobom vo
viacslučkovom reaktore. Prvý a druhý typ mikrokapsúl neobsahovali vo vnútri antibiotikum ofloxacín,
tretí a štvrtý typ obsahovali antibiotikum ofloxacín.
Amniová membrána sa získala po cisárskom reze z plodového obalu zdravej rodičky. Potom
transporte do Centrálnej tkanivovej banky FNsP v Ružinove sa do 1 h za sterilných podmienok
membrána preniesla do roztoku antibiotík (antimykotiká : 50 µg/ml penicilín, 50 µg/ml streptomycín a
2,5 µg/ml amfotericín B) a lavážovala sa 24 hodín pri 4°C. Potom sa premyla sterilným fyziologickým
roztokom, oddelil sa amnion od chorionu a od krvi očistená amniová membrána sa zabalila do
špecialného obalu a uskladnila v kryokonzervačnom médiu pri teplote -80°C. Amniová membrána sa
pred testovaním rozmrazila vo vode (37°C). Kryokonzervačné médium sa odstránilo
niekoľkonásobným premytím amniovej membrány v sterilnom fyziologickom roztoku.
Myšacie adherentné fibroblastové bunky NIH-3T3 izolované z embrya švajčiarskeho
myšacieho albína sa kultivovali v DMEM médiu, ktoré bolo obohatené penicilínom (100 µg/ml),
124
streptomycínom (100 µg/ml) a 10 % FS, v termostate pri 37°C a vlhčenej atmosfére obsahujúcej 5 %
CO2.
Adherentné ľudské limbálne bunky sa izolovali z limbusu ľudskej rohovky. Na kultiváciu
primokultúry sa použilo kultivačné médium DMEM/ HAM F12 obohatené 10 % ITS a rastovým
faktorom EGF (10 ng/ml). Primokultúra sa kultivovala v termostate pri 37°C a vlhčenej atmosfére
obsahujúcej 5 % CO2.
Morfológia buniek sa pozorovala v svetelnom mikroskope. Sledovali sa zmeny v tvare,
veľkosti a bunkovej adherencii. Viabilita buniek sa hodnotila vitálnym testom farbením roztokom
neutrálnej červenej. Morfológia sa pozorovala mikroskopom Carl Zeiss Axion Imager.
Množstvo uvoľnenej LDH sa stanovilo podľa Bergmeiera [1970]. Oxidácia NADH sa merala
na spektrofotometri PU 8759 UV/VIS značky PHILIPS pri vlnovej dĺžke λ= 340 nm.
Limbálne bunky (fixované metanolom na krycom sklíčku) sa 60 min. inkubovali s primárnou
protilátkou (α -enoláza značená FITC, cytokeratín 12) pri teplote 37°C, potom sa premývali 4x10 min.
0,2 % Tweenom 20 v PBS. Takto pripravené bunky sa 60 min. inkubovali s fluorescenčne značenou
sekundárnou protilátkou pri 37°C. Po inkubácii sa 4x10 min. premývali roztokom PBS a takto
pripravené preparáty sa analyzovali a fotografovali pomocou fluorescenčného mikroskopu Carl Zeiss
Axion Imager (FITC-protilátka : excitačná vlnová dĺžka 493 nm, emisná vlnová dĺžka 517 nm).
Výsledky a diskusia
Rast buniek NIH-3T3 na povrchu mikrokapsúl sa hodnotil po 72, 120 a 168 h kultivácii meraním
množstva uvoľneného enzýmu laktátdehydrogenázy (obr. 1) a viability buniek detekovanej neutrálnou
červenou. Ako kontrola, voči ktorej sa účinok mikrokapsúl porovnával, sa použili NIH-3T3 bunky
kultivované v sterilných skúmavkách bez prítomnosti mikrokapsúl. Ako vyplýva z obrázku 1,
množstvo uvoľneného enzýmu LDH z NIH-3T3 buniek kultivovaných na povrchu mikrokapsúl
všetkých typov s časom kultivácie klesalo a po 168 h kultivácie bolo oproti kontrole 3,3 – 2,2 – krát
nižšie. Testovaná koncentrácia ofloxacínu (2,76.10-5 mol/L) v mikrokapsuliach typu 3 a 4 nevyvolala
na NIH-3T3 bunkách cytotoxický účinok. Výsledky zo sledovanie viability NIH-3T3 buniek v/ bez
prítomnosti mikrokapsúl potvrdili výsledky z merania hladiny uvoľneného enzýmu LDH. Bunky
kultivované na povrchu mikrokaspúl sa fabili počas celého experimentu neutrálnou červenou a boli
živé (obrázky neuvádzame). Z uvedeného možno konštatovať, že mikrokapsule všetkých testovaných
typov zlepšili oproti kontrole proliferáciu buniek, pretože s časom kultivácie sa zvyšovala neuvoľnená
bunková hladina laktátdehydrogenázy NIH-3T3 buniek.
množstvo uvoľnenej LDH (%)
70
K
Typ1
Typ2
Typ3
Typ4
60
50
40
30
20
10
0
120
72
72
čas (h)
168
172
Obr. 1. Množstvo uvoľneného enzýmu LDH po 72, 120 a 168 h kultivácii NIH-3T3 buniek na vrstve
mikrokapsúl. K = kontrola, Typ 1 = chitozán/tripolyfosfát, Typ 2 = chitozán/(tripolyfosfát a
chondroitínsulfát), Typ 3 = (chitozán+ofloxacín)/ tripolyfosfát, Typ 4 = (chitozán a ofloxacín)/
(tripolyfosfát a chondroitínsulfát).
Na identifikáciu limbálnych kmeňových buniek rastúcich v primokultúre odobratej od
pacienta a ich diferencovaných typov buniek sa používajú rôzne charakteristické proteíny ako napr. α-
125
enoláza pre limbálne kmeňové bunky a cytokeratín 12 pre diferencované bunky. Ako vidieť z obr. 2 (a)
v cytoplazme limbálnych buniek bola lokalizovaná α-enoláza (svietiaca zelená farba), čo možno
považovať za dôkaz prítomnosti limbálnych kmeňových buniek v kultúre. Zároveň sa zisťovalo, či sa
tieto bunky v priebehu 7-dňovej kultivácie v Petriho miske diferencovali na epiteliálne bunky rohovky.
Na identifikáciu sa použila protilátka cytokeratín 12. Prítomnosť cytokeratínu 12 sme nedokázali
(žiadne zeleno sfarbené bunky) a teda cytokeratín 12 nebol vhodný na identifikáciu limbálnych
kmeňových buniek rastúcich v primokultúre. Limbálne bunky po preočkovaní z Petriho misky na
povrch amniovej membrány rástli a po 14. dňoch kultivácie vytvorili konfluentnú vrstvu (obr. 2b). Pri
experimentoch sme použili amniovú membránu, na ktorej bola zachovaná epiteliálna vrstva amnionu.
Pomocou MTT testu sme zistili, že epiteliálne bunky boli vitálne (farbili sa na modro), ale
neproliferovali (bunky amniovej membrány netvorili ani po 14. dňoch orgánovú kultúru). Toto bolo
pravdepodobne príčinou dobrej proliferácie limbálnych kmeňových buniek na povrchu amniovej
membrány bez toho, aby sa pridali do kultivačného média rastové faktory alebo mitomycínom
ovplyvnené myšacie NIH-3T3 bunky. Použitie amniovej membrány s epiteliálnou vrstvou je jedinečné
z hľadiska pacienta, kde nedochádza k nevhodnej imunitnej reakcii na myšací antigén prítomný v
NIH-3T3 bunkách.
a
b
a
b
Obr. 2. Fluorescenčná mikroskopia limbálnych kmeňových buniek. (a) identifikácia limbálnych
buniek pomocou protilátky α-enoláza a (b) 14. dňový rast limbálnych kmeňových buniek na
povrchu amniovej membrány. Zväčšenie 200x (a) a 100x (b).
Závery
Na základe uvedených výsledkov možno konštatovať, že testované mikrokapsule nevyvolali
na NIH-3T3 bunkách cytotoxický účinok. Bunky rastúce na povrchu všetkých typov mikrokapsúl boli
živé (farbili sa neutrálnou červenou) a proliferovali. Použitie amniovej membrány ako povrchu pre
kultiváciu limbálnych buniek je veľmi vhodným modelom pri liečbe deficiencie limbálnych buniek.
Poďakovanie
Práca bola podporená Agentúrou pre výskum a vývoj SR, projekt APVV 20-015904.
Použitá literatúra
1. Bergmeier, H.U.: Methoden der enzymatischen Analyse. 2nd ed.. Akademie Verlag, Berlin. 1970.
2. http://www.dcmsonline.org/jax-medecine/2002journals/augsept2002/amniotic.html
3. Schwab, I.R., Reyes, M., Isseroff, R.R.: Successful transplantation of bioengineered tissue replacements in
patients with ocular surface disease. Bornea. 19: 421– 426, 2000.
4. Tsai, R.J.F., Li, L.M., Chen, J.K.N.: Reconstruction of damaged corneas by transplantation of autologous
limbal epithelial cells. Engl J Med 343: 86–93, 2000.
126
Biologická charakteristika a potenciál kmeňových buniek
Marcela Uličná, Ján Vojtaššák
Univerzita Komenského v Bratislave, Lekárska fakulta, Ústav lekárskej biológie a genetiky, Bratislava,
Slovenská Republika, [email protected]
Abstrakt
Kmeňové bunky, vzhľadom na svoje biologické vlastnosti, predstavujú unikátny
„nástroj“ pre regeneračnú medicínu. V predkladanom článku prehľadne opisujeme
charakteristiky a potenciál mezenchýmových kmeňových buniek.
Úvod
Kmeňové bunky (KB) sú vo všeobecnosti definované ako klonogénne, nediferencované bunky
schopné sebaobnovy z ktorých môže vzniknúť jeden alebo viac typov diferencovaných buniek
(Jakubovský et al., 2007). Dodnes boli izolované a charakterizované z embryonálneho, fetálneho
a dospelého tkaniva. Embryonálne kmeňové bunky (EKB) sú pluripotentné, schopné vytvoriť bunky
všetkých troch zárodočných listov a sú schopné neobmedzenej proliferácie v nediferencovanom stave
(Thomson et al., 1998). Fetálne kmeňové bunky izolované z veľkého množstva vyvíjajúcich sa
orgánov majú značný proliferačný potenciál a schopnosť diferenciácie. Sú prostriedkom medzi EKB,
ktoré sú úplne nezadané a potrebujú diferenciačný stimul aby sa stali diferencovaným tkanivom,
a dospelými progenitorovými alebo kmeňovými bunkami ktoré sú zadané, ale môžu vyžadovať určité
stimuly (Olivier et al., 2004; Svendsen, 2002). Postnatálne KB, známe ako dospelé KB boli izolované
a charakterizované z množstva tkanív (kostná dreň, tukové tkanivo, kostrový sval, koža, cievy a srdce,
tráviaci systém, pečeň, pankreas, obličky, pľúca a nervový systém). Ich diferenciačný potenciál
odzrkadľuje ich lokálne prostredie – membránové komponenty, difundabilné faktory, molekuly
extracelulárnej matrix (Petersen et al.,1999; Despars et al., 2004; Gordon, 1988; Gordon et al., 1988;
Quesenberry et al., 2004). Dospelé KB majú obmedzený vývin na určité špecifické bunkové línie
v závislosti od toho, v ktorom tkanive sa nachádzajú ale takisto majú schopnosť transdiferenciácie –
plasticity. Plasticita umožňuje určitým tkanivovo špecifickým kmeňovým bunkám produkovať nielen
fixné typy potomstva ale pri umiestnení v novej niche vytvárať nové špecializované skupiny buniek
(Alison et al., 2000; Azizi et al., 1998; Bjornson et al., 1999; Filip et al., 2004; Lagasse et al., 2000).
Mezenchýmové kmeňové bunky
Mezenchýmové kmeňové bunky (MKB) sú multipotentné bunky dávajúce vznik tkanivám
mezenchýmového pôvodu (kosť, chrupka, tuk, šľachy a svaly). Sú schopné sebaobnovy a môžu
produkovať diferencované bunky (Weissman et al., 2001; Smith, 2001). Na rozdiel od
hematopoetických KB sú MKB relatívne slabo molekulárne charakterizované. MKB sú momentálne
definované kombináciou morfologických, fenotypických a funkčných vlastností, mnohé z nich sú ale
spochybniteľné a biologicky nerelevantné (Javazon et al., 2004). Dnes najviac používaným zdrojom
MKB je kostná dreň (KD) a najviac charakterizovanými MKB sú práve KB izolované z kostnej drene.
KD je najbohatším a najprístupnejším zdrojom, izolácia je jednoduchá, po denzitno-gradientovej
centrifugácii nasleduje priamy výsev. MKB ale predstavujú iba 0,001% až 0,01% z celkovej populácie
jadrových buniek v kostnej dreni (Shanti et al., 2007). Okrem MKB a množstva iných buniek sa
v kostnej dreni nachádzajú aj hematopoetické kmeňové bunky (HKB). MKB predstavujú mechanickú
podporu pre diferencujúce sa HKB a produkujú pozitívne bunkovo signalizujúce hematopoetické
molekuly ktoré prispievajú k maturácii krvných buniek (Taichman et al., 1998). Okrem toho MKB
zohrávajú dôležitú úlohu pri obnove poškodených alebo zničených tkanív v organizme. To je
zabezpečené lokalizáciou KB a to, že sú umiestnené v perivaskulárnych niche, čo poskytuje ľahký
prístup k poškodeným orgánom alebo tkanivám. Je možné, že migrácia kmeňových buniek kostnej
drene v tele pôsobí v podstate ako podporný systém schopný v extrémnej situácii zväčšiť vnútornú
regeneračnú kapacitu orgánu.
Za vhodných podmienok majú MKB schopnosť intenzívnej ale obmedzenej proliferácie. Je to
dôležitá vlastnosť, ktorá môže eliminovať potenciálnu tumorogenicitu buniek po transplantáciách in
vivo. Klinické použitie je ale skôr limitované ich imunologickými vlastnosťami. Vo všeobecnosti sú
127
MKB považované za neimunogénne, podľa HLA I+, HLA II-, CD40-, CD80- a CD86- fenotypu
(Javazon et al., 2004; Le Blanc et al., 2003).
Najlepšie známym MKB markerom je Stro-1 (stromal derived factor-1). Stro-1 negatívne
bunky nie sú schopné formovať kolónie CFU-F (colony-forming unit-fibroblast) (Petersen et al.,1999).
Stro-1 pozitívne bunky môžu diferencovať na podporné fibroblasty pre HKB, osteoblasty,
chondroblasty, adipocyty a bunky hladkej svaloviny (Landsdorp, 1995). Napriek tomu je Stro-1
nespoľahlivým všeobecným markerom pre MKB a to z troch dôvodov. Neexistuje myší náprotivok
ľudského Stro-1, expresia Stro-1 nie je jedinečná pre MKB a expresia na MKB sa počas kultivácie
postupne stráca. Použitie Stro-1 je teda limitované na izoláciu alebo skoré pasáže. Nakoľko presná
funkcia Stro-1 antigénu nie je známa, nie je ani jasné či strata expresie má vplyv na kmeňovosť
buniek.
Znak CD160 alebo VCM-1 (vascular cell adhesion molecule-1) je exprimovaný na
endotelových bunkách ciev, je pravdepodobné, že CD160 je funkčným markerom MKB pretože má
vplyv na bunkovú adhéziu, chemotaxiu a signálnu transdukciu (Carter et al., 2001; Kolf et al., 2007).
Kombinácia znakov Stro-1 a CD160 predstavuje dobrý marker pre MKB, pretože Stro-1+ a CD160+
bunky vykazujú všetky charakteristiky kmeňovej bunky ako sú multilíniový potenciál, expresia
telomerázy a vysoká proliferácia in vitro (Gronthos, 2003).
Znak CD73 (lymphocyte-vascular adhesion protein 2) je 5´-nukleozidáza. Hoci je tiež
exprimovaný na mnohých iných bunkách, dve monoklonálne protilátky proti CD73 (SH-3 a SH-4)
boli vyvinuté špecificky pre bunky odvodené z mezenchýmového tkaniva (Haynesworth et al., 1992).
Tieto protilátky sa neviažu na HKB, osteoblasty, osteocyty a ani na žiadne bunky, ktoré by potenciálne
mohli kontaminovať adherentné bunky. Podľa viacerých publikácií sú ale najpoužívanejšími markermi
kombinácia znakov Stro-1, CD73 a CD160 hoci ich funkcia nie je stále presne určená (Honczarenko et
al., 2006; Kolf et al., 2007).
Cytometrické analýzy tiež dokázali, že CFU-F prekurzory sú pozitívne aj na Thy-1 (CD90),
rodinu integrínov CD29/CD49, CD10, CD13 a receptory pre PDGF, EGF, IGF-1 a NGF. MKB ešte
exprimujú množstvo receptorov pre bunkovú adhéziu s HKB a extracelulárnou matrix ako napríklad
ICAM (CD50, CD54, CD120) - integrínová rodina zodpovedná za väzbu fibronektínu, laminínu alebo
kolagénu; VCAM – CD106 (vascular cell adhesion molecule); NCAM – CD56 (neural cell adhesion
molecule), L-selectin (CD62).
MKB neexprimujú znaky CD11b (marker imunitných buniek), CD45 (marker všetkých
hematopoetických línií) alebo glycophorin-A (marker erytroidnej línie). Negatívna selekcia proti
glycophorin-A spolu s pozitívnou na Stro-1 obohacujú bunky z kostnej drene na CFU-U až 10násobne (Gronthos, 2003). CD34 je marker primitívnych hematopoetických buniek a zriedkavo je
exprimovaný aj na MKB, u myší je pozitívny. CD31 (PECAM-1) exprimovaný na endotelových
a hemotopoetických bunkách a CD117 hematopoetických kmeňových a progenitorových bunkách je
takmer vždy neprítomný u ľudí aj u myší. CD40 má afinitu ku hyaluronovej kyseline, fibronektínu
a sialomucínom ako CD34 a CD43.
Multilíniový diferenciačný potenciál
MKB sú za vhodných podmienok schopné diferencovať sa na bunky mezenchymálneho
pôvodu a to osteoblasty, chondroblasty, adipocyty, myoblasty a tendonálne bunky (Pittenger et al.,
1999; Wakitani et al., 1995; Altman et al., 2002; Danišovič et al., 2006). Hoci molekulárny
mechanizmus riadiaci diferenciáciu MKB nie je úplne známy, je ale dokázané, že diferenciáciu
v mezenchymálnej línii riadi množstvo rastových faktorov ako BMP (bone morphogenetic protein),
FGF (fibroblast growth factor) a Wnts - rodina protoonkogénov (Sekiya et a., 2005; Luo et a., 2004;
Boland et a., 2004). Myslelo sa, že diferenciačný potenciál MKB je obmedzený iba na mezenchýmovú
líniu ale niektoré publikácie dokazujú, že za vhodných podmienok môžu MKB transdiferencovať na
bunky ktoré vykazujú morfologické a biochemické vlastnosti neurálneho tkaniva ektodermálneho
pôvodu (Azizi et al., 1998; Kopen et al., 1999).
Osteogenézu silno podporuje skupina proteínov BMP (Chen et al., 2004; Friedman et al.,
2006). BMP-2 indukuje p-300 acetyláciu Runx2 čo je hlavný osteogenický gén čím zlepšuje jeho
transaktivačnú schopnosť. Cytokín TNF-α (tumor necrosis factor-α), ktorý je zapojený do zápalomsprostredkovanej kostnej degradácie dereguluje Runx2. Wnts má v osteogenéze dôležitú modelačnú
funkciu, vysoké hladiny ju umožňujú, zatiaľ čo nízke hladiny osteogenézu inhibujú (Gaspar et al.,
2004). Vďaka týmto zisteniam sa tkanivové inžinierstvo zamerané na obnovu kosti za pomoci MKB,
orientuje na BMP, Runx2 a histónové deacetyltransferázy. TNF-α by sa mohol využiť v imunoterapii
128
kostných ochorení (Kaneki et al., 2004; Gaspar et al., 2004). Ďalší výskum zameraný na transkripčné
mechanizmy zabezpečujúce rovnováhu medzi formáciou a degradáciou kosti, najmä hlavný
osteogenický gén Runx2 a špecifické osteogenické homeoboxy, ktoré sú považované za dva
najsilnejšie regulátory transkripcie v osteogenéze, prinesie nové poznatky v osteogénnej diferenciačnej
línii.
Chondrogénna diferenciácia in vitro plne napodobňuje vývoj chrupiek in vivo.
U chondrocytov odvodených z MKB boli pozitívne charakterizované mnohé markery ako transkripčné
faktory (sox-9, scleraxis), gény extracelulárnej matrix (kolagén typ II a IX, agrekán, biglykán, dekorín
a chrupkový oligomerický matrixový proteín) (Tuan et al., 2003; Baksh et al., 2004; Danišovič et al.,
2007). Napriek tomu signalizačné dráhy , ktoré indukujú expresiu týchto chondrogenických génov
ostávajú neznáme. Molekulárno genetické štúdie u prirodzene sa vyskytujúcich mutácií identifikovali
niektoré signálne molekuly ako TGF-β (transforming growth factor-β), BMP (bone morphogenetic
protein), GDF (growth and differentiation factor) a Wnt ligandy (Massague et al., 2000; Chen et al.,
2004; Hartman et al., 2006). Rekombinantné proteíny a/alebo adenovírusové infekcie MKB s TGF-β1
a TGF-β3, BMP-2, BMP-4, BMP-6, BMP-12, BMP-13 a GDF-5 dokázali rapídnu indukciu
chondrogenézy u mezodermálneho tkaniva z rôznych zdrojov (Boskey et al., 2002; Gooch et al., 2002;
Nochiet al., 2004).
Najviac prác ohľadom myogenézy MKB je založených na malej polpulácii KB odvodených
od kostrových svalov alebo od satelitných buniek. Nedávne práce zase poukazujú vysokú úspešnosť
indukcie myogenézy u dospelých KB po transfekcii aktivovaným Notch 1, ale mechanizmus ostáva
neznámy (Dezawa et al., 2005). Pri kardiomyogenéze sa zistila dôležitosť bunkových kontaktov pri
koklutivácii MKB a kardiomyocytov, ktoré stimulujú kardiomyogenézu u týchto MKB na potkaňom
modeli (Li et al., 2006).
Kritický regulátor adipogenézy je jadrový receptor pre hormón PRARγ (peroxisome
proliferator-activated receptor γ), u MKB sprostredkuje adipogenézu zatiaľ čo potláča osteogenézu
(Nuttall et al., 2004). To dokazuje, že z jednej MKB môžu byť odvodené obe línie.
Vytváranie šliach in vivo umožňuje GDF, člen TGF-β superrodiny (Wolfman et al., 1997).
Študovanie vývoja šliach in vitro je obtiažne, pretože okrem špeciálneho média a kultivačných
podmienok je potrebné aj mechanické navíjanie, ktoré je kritické pri vytváraní vláken (Altman et al.,
2002).
Závery
Ďalšia analýza bunkovej migrácie, cytoskeletálnej odozvy, membránových proteínov,
signalizačných a stimulačných ciest je dôležitá pre lepšie pochopenie diferenciačných procesov. Tiež
aj identifikácia špecifických signálnych sietí a „hlavného“ regulačného génu ktorý riadi diferenciačné
línie zostáva výzvou. Schopnosť ovplyvniť biologické efektory aby udržiavali zvolený diferenciačný
program MKB, alebo naopak možnosť predísť neželanej diferenciácii je nevyhnutné pre efektívnu
klinickú aplikáciu, tkanivové inžinierstvo a regeneráciu tkanív.
Poďakovanie
Práca bola podporená grantovou úlohou UK/326/2007.
Použitá literatúra
1. Alison, M.R., Poulsom, R., Jeffery, R., et al.: Hepatocytes from non-hepatic adult stem cells. Nature. 406:
257, 2000.
2. Altman, G.H., Horan, R.L., Martin, I., et al.: Cell differentiation by mechanical stress. FASEB J. 16: 270–272,
2002.
3. Azizi, S.A., Stokes, D., Augelli, B.J., et al.: Engraftment and migration of human bone marrow stromal cells
implanted in the brains of albino rats - similarities to astrocyte grafts. Proc Natl Acad Sci U S A. 95: 3908–
3913, 1998.
4. Baksh, D., Song, L., Tuan, R.S.: Adult mesenchymal stem cells: characterization, differentiation, and
application in cell and gene therapy. J Cell Mol Med. 8: 301–316, 2004.
5. Bjornson, C.R., Rietze, R.L., Reynolds, B.A., et al.: Turning brain into blood: A hematopoietic fate adopted
by adult neural stem cells in vivo. Science. 283: 534–537, 1999.
6. Boland, G.M., Perkins, G., Hall, D.J., et al.: Wnt 3a promotes proliferation and suppresses osteogenic
differentiation of adult human mesenchymal stem cells. J Cell Biochem. 93: 1210–30, 2004.
7. Boskey, A.L., Paschalis, E.P., Binderman, I., Doty, S.B.: BMP-6 accelerates both chondrogenesis and mineral
maturation in differentiating chick limb-bud mesenchymal cell cultures. J Cell Biochem. 84: 509–519, 2002.
129
8. Carter, R.A., Wicks, I.P.: Vascular cell adhesion molecule 1 (CD106): a multifaceted regulator of joint
inflammation. Arthritis Rheum. 44: 985–994, 2001.
9. Chen, D., Zhao, M., Mundy, G.R.: Bone morphogenetic proteins. Growth Factors. 22: 233–241, 2004.
10. Danišovič, Ľ., Lesný, P., Jendelová, P., et al.: Chondrogenic potential of human bone marrow mesenchymal
stem cells and adipose-derived mesenchymal stem cells. Cytotherapy. 8(Suppl.1): 191, 2006.
11. Danišovič, Ľ., Lesný, P., Havlas, V., et al.: Chondrogenic differentiation of human bone marrow and adipose
tissue-derived mesenchymal stem cells. J Appl Biomed. 5: 139–150, 2007.
12. Despars, G., O´Neill, H.C.: A role niches in the development of multiplicity of dendritic cell subsets. Exp
Hematol. 32: 235–243, 2004.
13. Dezawa, M., Ishikawa, H., Itokazu, Y., et al.: Bone marrow stromal cells generate muscle cells and repair
muscle degeneration. Science. 309: 314–317, 2005.
14. Filip, S., English, D., Mokrý, J.: Issues stem cell plasticity. J Cell Mol Med. 8: 572–577, 2004.
15. Friedman, M.S., Long, M.W., Hankenson, K.D.: Osteogenic differentiation of human mesenchymal stem
cells is regulated by bone morphogenetic protein-6. J Cell Biochem. 98: 538–554, 2006.
16. Gaspar, C., Fodde, R.: APC dosage effects in tumorigenesis and stem cell differentiation. Int J Dev Biol. 48:
377–386, 2004.
17. Gooch, K.J., Blunk, T., Courter, D.L., et al.: Bone morphogenetic proteins-2, -12, and -13 modulate in vitro
development of engineered cartilage. Tissue Eng. 8: 591–601, 2002.
18. Gordon, M.Y.: Adhesive properties of haematopoietic stem cells. Br J Haematol. 68: 149–151, 1998.
19. Gordon, M.Y., Dowding, C.R., Riley, G.P., et al.: Altered adhesive properties of haematopoietic progenitor
cells in chronic myeloid leukemia. Nature Lond., 328, 342–344, 1987.
20. Gronthos, S., Zannettino, A.C., Hay, S.J., et al. Molecular and cellular characterisation of highly purified
stromal stem cells derived from human bone marrow. J Cell Sci. 116: 1827–1835, 2003.
21. Hartmann, C.: A Wnt canon orchestrating osteoblastogenesis. Trends Cell Biol. 16: 151–158, 2006.
22. Haynesworth, S.E., Baber, M.A., Caplan, A.I.: Cell surface antigens on human marrow-derived
mesenchymal cells are detected by monoclonal antibodies. Bone. 13: 69–80, 1992.
23. Honczarenko, M., Le, Y., Swierkowski, M., Ghiran, I., Glodek, A.M., Silberstein, L.E.: Human bone marrow
stromal cells express a distinct set of biologically functional chemokine receptors. Stem Cells. 24: 1030–1041,
2006.
24. Jakubovský, J., Novotný, J., Michalka, P., et al.: Knowledge concerning regeneration. I. New view of old
problem. Kontakt. 2: 373–377, 2007.
25. Javazon, E.H., Beggs, K.J., Flake A.W.: Mesenchymal stem cells: Paradoxes of passaging. Exp Hematol. 32:
414–425, 2004.
26. Kaneki, H., Guo, R., Chen, D., et al.: Tumor necrosis factor promotes Runx2 degradation through upregulation of Smurf1 and Smurf2 in osteoblasts. J Biol Chem. 281: 4326–4333, 2006.
27. Kolf, C.M., Cho, E., Tuan, R.S.: Mesenchymal stromal cells. Biology of adult mesenchymal stem cells:
regulation of niche, self-renewal and differentiation. Arthritis Res and Ther. 9: 204, 2007.
28. Kopen, G.C., Prockop, D.J., Phinney, D.G.: Marrow stromal cells migrate throughout forebrain and
cerebellum, and they differentiate into astrocytes after injection into neonatal mouse brains. Proc Natl Acad
Sci USA. 96: 10711–6, 1999.
29. Lagasse, E., Connors, H., Al-Dhalimy, M., et al.: Purified hematopoietic stem cells can differentiate into
hepatocytes in vivo. Nat Med. 6: 1229–34, 2000.
30. Lansdorp, P.M.: Developmental changes in the function of hematopoietic stem cells. Exp Hematol. 23: 187–
91, 1995.
31. Le Blanc, K., Tammik, C., Rosendahl, K., et al: HLA expression and immunologic properties of
differentiated and undifferentiated mesenchymal stem cells. Exp Hematol. 31: 890–6, 2003.
32. Li, H., Yu, B., Zhang, Y., et al.: Jagged1 protein enhances the differentiation of mesenchymal stem cells into
cardiomyocytes. Biochem Biophys Res Commun. 341: 320–325, 2006.
33. Luo, Q., Kang, Q., Si, W., et al.: Connective tissue growth factor (CTGF) is regulated by Wnt and bone
morphogenetic proteins signaling in osteoblast differentiation of mesenchymal stem cells. J Biol Chem. 27:
55958–9, 2004.
34. Massague, J., Blain, S.W., Lo, R.S.: TGFβ signaling in growth control, cancer, and heritable disorders. Cell.
103: 295–309, 2000.
35. Mastrogiacomo, M., Cancedda, R., Quarto, R.: Effect of different growth factors on the chondrogenic
potential of human bone marrow stromal cells. Osteoarthritis Cartilage. 9, 36–40, 2001.
36. Nochi, H., Sung, J.H., Lou, J., et al.: Adenovirus mediated BMP-13 gene transfer induces chondro-genic
differentiation of murine mesenchymal progenitor cells. J Bone Miner Res. 19: 111–122, 2004.
37. Nuttall, M.E., Gimble, J.M.: Controlling the balance between osteoblastogenesis and adipogenesis and the
consequent therapeutic implications. Curr Opin Pharmacol. 4: 290–294, 2004.
38. Olivier, V., Faucheux, N., Hardouin, P.: Biomaterial challenges and approaches to stem cell use in bone
reconstructive surgery. Drug Discov Today. 9: 803–11, 2004.
39. Petersen, B.E., Bowen, W.C., Patrene, K.D., et al.: Bone marrow as a potential source of hepatic oval cells.
Science. 284: 1168, 1999.
130
40. Pittenger, M.F., Mackay, A.M., Beck, S.C., et al.: Multilineage potential of adult human mesenchymal stem
cells. Science, 284, 143–7, 1999.
41. Shanti, R.M., Li, W., Nesti, L.J., et al.: Adult mesenchymal stem cells: Biological properties, characteristics,
and applications in maxillofacial surgery. J Oral Maxillofac Surg. 65: 1640–1647, 2007.
42. Quesenberry, P.J., Abedi, M., Aliotta, J. et al.: Stem cell plasticity: an owerview. Blood Cell Mol Dis. 32: 1–
4, 2004.
43. Sekiya, I., Larson, B.L., Vuoristo, J.T., et al.: Comparison of effect of BMP-2, −4, and −6 on in vitro
cartilage formation of human adult stem cells from bone marrow stroma. Cell Tissue Res. 320: 269–76, 2005.
44. Svendsen, C.: Stem cells: Hype or hope? Drug Discov Today. 7: 455–456, 2002.
45. Taichman, R.S., Emerson, S.G.: The role of osteoblasts in the hematopoietic microenvironment. Stem Cells.
16: 7–15, 1998.
46. Thomson, J.A., Itskovitz-Eldor, J., Shapiro, S.S., et al.: Embryonic stem cell lines derived from human
blastocysts [published erratum appears in Science 282:1827, 1998]. Science. 282: 1145–47, 1998.
47. Tuan, R.S., Boland G, Tuli R: Adult mesenchymal stem cells and cell-based tissue engineering. Arthritis Res
Ther, 5:32-45, 2003.
48. Wakitani, S., Saito, T., Caplan, A.I.: Myogenic cells derived from rat bone marrow mesenchymal stem cells
exposed to 5-azacytidine. Muscle Nerve. 18: 1417–26, 1995.
49. Wolfman, N.M., Hattersley, G., Cox, K., et al.: Ectopic induction of tendon and ligament in rats by growth
and differentiation factors 5, 6, and 7, members of the TGF-β gene family. J Clin Incest. 100: 321–330, 1997.
131
Analýza železa v ľudskej slezine
Horst Urban1, Martin Kopáni1, Martin Weis2, Július Dekan3
1
Univerzita Komenského v Bratislave, Lekárska fakulta,Ústav patologickej anatómie; Slovenská technická
univerzita, Fakulta elektrotechniky a informatiky, 2Katedra fyziky, 3Katedra jadrovej fyziky, Bratislava,
Slovenská Republika, [email protected]
Abstrakt
Železo v tkanive mozgu zohráva dôležitú úlohu pri vzniku neurodegeneračných
chorôb a v procese starnutia. Je jedným z biogénnych prvkov, ktorého nadmerné množstvo je
induktorom oxidačného stresu. Cieľom práce je určiť štruktúru železa v tkanive ľudskej
sleziny a jeho oxidačný stav. Pomocou MS sme v každej vzorke tkaniva sleziny zistili
prítomnosť dvoch odlišných fáz paramagnetického železa. Obe fázy boli zložené z Fe3+. Vo
vzorkách sme identifikovali 4 rôzne fázy oxidov železa. Vyšetrenia svetelným mikroskopom
tkanív ľudskej sleziny farbenej Perlsovou reakciou sme zistili výraznú akumuláciu železa vo
vzorkách s diagnózou hemochromatózy a hereditárnej sférocytózy. V tretej vzorke bola rekcia
negatívna. EDX mikroanalýza vzoriek ukázala mnohoprvkové zloženie častíc železa.
Prítomnosť iných prvkov výrazne ovplyvňuje štruktúru, chemické zloženie a stechiometriu
oxidov železa. Predpokladáme, že pH a rôznorodé prvkové zloženie môžu výrazným
spôsobom ovplyvňovať biomineralizáciu železa v ľudskom tkanive.
Úvod
Železo v tkanive zohráva dôležitú úlohu pri vzniku neurodegeneračných chorôb a v procese
starnutia.. Je jedným z biogénnych prvkov, ktorého nadmerné množstvo je induktorom oxidačného
stresu. Doterajšie znalosti o prítomnosti železa v mozgu pochádzajú hlavne z výsledkov merania
nukleárnou magnetickou rezonanciou (NMR, Weir et al., 1984). Nevýhodou získaných výsledkov sú
iba kvalitatívne informácie o železe vo vyšetrovanom tkanive. Histochemické metódy majú vyššiu
citlivosť a vyššiu mieru špecificity ako NMR. Neposkytujú však informácie o fyzikálno-chemických
vlastnostiach železa a jeho zlúčenín vo vyšetrovanom tkanive. Ďalšou nevýhodou histochemických
metód je neschopnosť zobrazenia zlúčenín železa, ak ich rozmer či množstvo je pod hranicou
rozlišovacej schopnosti svetelného mikroskopu. Keďže je železo v organizme prítomné v dvoch
oxidačných stavoch (Fe2+, Fe3+) je dôležitá identifikácia a rozlíšenie jeho oxidačných stavov.
Železo sa v ľudskom tele nachádza predovšetkým v podobe feritínu (Quintana et al., 2004).
Tento proteín tvorí sférický útvar veľkosti 12 nm. Jadro feritínu je veľké 8 nm a pozostáva
z ferihydritu – 5Fe2O3.9H2O. Železo sa v ňom nachádza v podobe iónov Fe3+. Úlohou
polypeptidového obalu feritínu (Ft-H forma) je katalýza oxidácie iónov Fe2+ na ióny Fe3+. Ft-L forma
polypeptidového obalu napomáha k mineralizácii železa.
Cieľom práce je určiť štruktúru železa v tkanive ľudskej sleziny a jeho oxidačný stav.
Materiál a metódy
Histologické rezy sleziny sme pripravili pre vyšetrenie vo svetelnom mikroskope a farbili
Perlsovou reakciou na prítomnosť železitých iónov Fe3+. Energo–disperznú analýzu (EDX) sme
vykonali rastrovacom elektrónovom mikroskope JEOL 840 XA (Jeol, Japonsko) na 3 vzorkách
tkaniva ľudskej sleziny. 57Fe Mössbauerova spektroskopiu (MS) sme vykonali na 3 práškových
vzorkách sleziny pri izbovej teplote aj pri teplote kvapalného dusíka v transmisnej geometrii so
zdrojom 57Co(Rh).
Výsledky a diskusia
Vyšetrenia svetelným mikroskopom tkanív ľudskej sleziny farbenej Perlsovou reakciou sme
zistili výraznú akumuláciu železa vo vzorkách s diagnózou hemochromatózy a hereditárnej
sférocytózy (obr. 1). V tretej vzorke bola rekcia negatívna.
132
Obr. 1. Ľudská slezina, hereditárna sférocytóza, svetelný mikroskop (vľavo). Elektrónogram z REM
zobrazuje častice obsahujúce horčík, fosfor, vápnik a železo.
Pomocou MS sme v každej vzorke tkaniva sleziny (tab. 1a, 1b, 1c) zistili prítomnosť dvoch
odlišných fáz paramagnetického železa. Obe fázy boli zložené z Fe3+. Vo vzorkách sme identifikovali
4 rôzne fázy oxidov železa (Tab. 1d, Cornell et Schwertmann, 2003).
Zložka
Izomérny posun
[mm/s]
quadrupólové
rozštiepenie [mm/s]
Podiel
[%]
1
2
0,37
0,4
0,68
0,4
67
33
Tab. 1a. Výsledky izomerného posunu a quadrupólového rozštiepenia vzorky sleziny s diagnózou
hemochromatózy. EDX analýza ukázala prítomnosť spektrálnych čiar Mg, Al, P, Si, S, Ca, K, Zn a Fe.
Zložka
1
2
Izomerný posun
[mm/s]
0,36
0,37
Quadrupólové
rozštiepenie [mm/s]
0,8
0,46
Podiel
[%]
50
50
Tab. 1b. Výsledky izomerného posunu a quadrupólového rozštiepenia vzorky sleziny po splenektómii
bez známok hromadenia železa. EDX analýza ukázala prítomnosť spektrálnych čiar Mg, Al, P, Si, S,
Ca, K, Zn a Fe.
Zložka
1
2
Izomérny posun
[mm/s]
0,32
0,31
Quadrupólové
rozštiepenie [mm/s]
0,60
0,34
Podiel
[%]
40
60
Tab. 1c. Výsledky izomerného posunu a quadrupólového rozštiepenia vzorky sleziny s diagnózou
hereditárnej sférocytózy. EDX analýza ukázala prítomnosť spektrálnych čiar Mg, P, Ca a Fe.
Fáza oxidu železa
Lepidokrokit
γ-FeO(OH)
Feroxyhyt
δ-FeO(OH)
Ferihydrit
5 Fe2O3 · 9 H20
FePO4
Izomérny posun
[mm/s]
Quadrupólové rozštiepenie
[mm/s]
0.37
0.53
0.36
0.69
0.35
0.71
0.38
0.80
Tab. 1d. Zoznam štyroch rôznych fáz oxidov železa nachádzajúcich sa vo vyšetrovaných vzorkách
tkaniva sleziny.
133
EDX mikroanalýza vzoriek ukázala mnohoprvkové zloženie častíc železa. V normálnom
tkanive sa feritín nachádza v podobe ferihydritu - 5Fe2O3.9H2O s rôznym množstvom fosforu.
Výsledky izomerného posunu a quadrupólového rozštiepenia vzorky sleziny po splenektómii bez
známok poškodenia sleziny môžu ukazovať prítomnosť ferihydritu (tab. 1b, 1d). Ióny kovov hrajú
dôležitú úlohu v transformácii biogénneho železa prítomného v organizme na abiogénne formy, ktoré
sú pre organizmus toxické. Fosforečnany značne ovplyvňujú morfológiu oxidov železa, keď ich
prekurzorom je ferihydrit. Množstvo fosforu v oxidoch železa ovplyvňuje oxidáciu železa. Jurado et al.
(2003) predpokladajú, že fosfor viazaný na železo spôsobuje jeho pravdepodobne abiogénny charakter.
Naviac stopové množstvá iných prvkov výrazne ovplyvňujú štruktúru, chemické zloženie
a stechiometriu oxidov železa (Borch et al., 2007). Fosfor výrazne ovplyvňuje morfológiu železa a
jeho oxidáciu (Cumplido et al., 2000). Interakcia železa Fe2+ s ferihydritom vedie k precipitátom
goethitu, lepidokrokitu a magnetitu (Hansel et al., 2005, Liu et al., 2007). Magnetit a goethit sú v
patologických tkanivách zložkou hemosiderínu (Meyrick et al., 2002). V našom prípade sme ani
magnetit a goethit nepozorovali (tab. 1a,b,c,d). Predpokladáme, že pH a rôznorodé prvkové zloženie
môžu výrazným spôsobom ovplyvňovať biomineralizáciu železa v ľudskom tkanive.
Závery
Pomocou MS sme v každej vzorke tkaniva sleziny zistili prítomnosť dvoch odlišných fáz
paramagnetického železa. Obe fázy boli zložené z Fe3+. Vo vzorkách sme identifikovali 4 rôzne fázy
oxidov železa. EDX mikroanalýza vzoriek ukázala mnohoprvkové zloženie častíc železa. Prítomnosť
iných prvkov výrazne ovplyvňuje štruktúru, chemické zloženie a stechiometriu oxidov železa.
Predpokladáme, že pH a rôznorodé prvkové zloženie môžu výrazným spôsobom ovplyvňovať
biomineralizáciu železa v ľudskom tkanive.
Použitá literatúra
1. Borch, T., Masue, Y., Kukkadapu, R.K., Fendorf, S.: Phosphate imposed limitations on biological reduction
and alteration of ferrihydrite. Environ Sci Technol. 41: 166–172, 2007.
2. Cornell, M., Schwertmann, U.: The Iron Oxides. Wiley-VCH Verlag, s. 149, 2003.
3. Cumplido, J., Barrón, V., Torrent, J.: Effect of phosphate on the formation of nanophase lepidocrocite from
Fe(II) sulfate. Clays Clay Miner. 48: 503–510, 2000.
4. Hansel, C.M., Benner, S.G., Fendorf, S.: Competing Fe(II)-induced mineralization pathways of ferrihydrite.
Environ Sci Technol. 39: 7147–7153, 2005.
5. Jurado M.J., Barron V., Torrent J.: Can the presence of structural phosphorus help to discriminate between
abiogenic and biogenic magnetites? J Biol Inorg Chem. 8: 810–814, 2003.
6. Liu, H., Li, P., Zhu, M., Wei, Y., Sun, Y.: Fe(II)-induced transformation from ferrihydrite to lepidocrocite and
goethite. J. Solid State Chem. 180: 2121–2128, 2007.
7. Meyrick, D., Webb, J., Cole, C.: Iron and iron proteins found in the genetic disease, hereditary spherocytosis.
Inorg Chim Acta. 339: 481–487, 2002.
8. Quintana, C., Cowley, J.M., Marhic, C.: Electron nanodiffraction and high-resolution electron microscopy
studies of the structure and composition of physiological and pathological ferritin. J Struct Biol. 147: 166–178,
2004.
9. Weir, M.P., Gibson, J.F., Peters, T.J.: Effect of dexamethasone on glutamine-synthetase and glial fibrillary
acidic protein in normal and transformed astrocytes. Biochem J. 223: 31–38, 1984.
134
Faryngová oblasť a neurálna lišta v ontogenéze človeka – ako spolu súvisia vrodené
vývinové chyby týmusu, srdca a prištítnych teliesok?
Ivan Varga1, Viera Pospíšilová1, Kristína Hudecová2, Paulína Gálfiová1,
Katarína Bevízová1, Štefan Polák 1
Univerzita Komenského v Bratislave, Lekárska fakulta, 1Ústav histológie a embryologie; 2Ústav patologickej
fyziológie, Bratislava, Slovenská Republika, [email protected]
Abstrakt
Vo vývine človeka vzniká z epitelu faryngových vačkov časť vnútorného ucha,
podnebná mandľa, týmus, prištítne telieska aj bunky štítnej žľazy produkujúce kalcitonín
(parafolikulárne bunky). S normogenézou faryngovej oblasti súvisí aj vcestovanie
multipotentných buniek z neurálnej lišty, ktoré sa oddelia od vznikajúceho centrálneho
nervového systému a migrujú do celého tela embrya. Bunky neurálnej lišty zohrávajú
kľúčovú úlohu aj v septácii výtokovej časti srdca. Autori poukazujú na súvislosť medzi
vrodenými chybami srdca, týmusu a ďalších orgánov, ktorých normálny vývin je indukovaný
bunkami neurálnej lišty.
Úvod
Faryngová (hltanová, branchiálna, žiabrová) oblasť sa stala klasickou oblasťou, na ktorej bol
dokázaný vzťah medzi ontogenézou a fylogenézou živočíchov. Je to oblasť, v ktorej sa pomerne
konzervatívne rekapituluje vývoj žiabrí (branchiae) v ontogenéze všetkých stavovcov. Faryngová
oblasť prekonala v procese evolúcie výrazné zmeny. Kým u vodných živočíchov zabezpečovala
okysličovanie krvi a reguláciu stálosti vnútorného prostredia, u suchozemských stavovcoch sa musela
prispôsobiť novým funkciám. Keďže oxygenáciu krvi prevzali pľúca a reguláciu iónovej rovnováhy
slinné žľazy ústnej dutiny, z faryngovej oblasti sa u človeka vývíjajú imunitné orgány: týmus
a podnebná mandľa, endokrinné orgány: prištítne telieska a parafolikulárne bunky štítnej žľazy
produkujúce kalcitonín (pôvodne ako samostatné ultimobranchiálne telieska), ako aj časť ucha.
K normogenéze faryngovej oblasti sú však potrebné aj bunky neurálnej lišty, ktoré cez faryngové
oblúky migrujú do srdca. Preto sú často spojené vrodené chyby srdca aj s poruchami imunity (ako
dôsledok nevyvinutia týmusu) alebo s nízkou hladinou vápnika (hypokalciémia, ako dôsledok
nevyvinutia prištítnych teliesok).
Vývin faryngovej oblasti
Embryonálny hltan (tzv. faryngové črevo) má u človeka podobu ventrodorzálne sploštenej
nálevky, značne rozšírenej v rovine frontálnej. Po stranách sa faryngové črevo vychlipuje ako
endodermové faryngové (branchiálne) vačky. Proti nim sa zvonka prehlbujú ektodermou vystlané
faryngové (branchiálne) brázdy, až ektoderm takmer nalieha na endodermu, čím vznikne membrana
obturans. K pretrhnutiu týchto membrán a k vytvoreniu žiabrových štrbín vo vývine človeka
nedochádza, medzi ektodermou a endodermou zostáva tenká vrstvička mezenchýmu. Výnimku tvorí 2.
brázda, kde sa toto spojenie preruší a vačok komunikuje s brázdou rôzne dlhý čas. U ľudských embryí
sa toto spojenie preruší v 5. týždni vývinu (4,5 mm dĺžka temeno-kostrč) (Pospíšilová et Slípka, 1994;
Slípka et Pospíšilová, 1995).
Z epitelu faryngových (branchiálnych) vačkov sa vyvíjajú branchiogénne orgány. Medzi ne
patrí stredná časť ucha, tonsilla palatina, thymus, glandulae parathyroideae a ultimobranchiálne
teliesko (corpusculum ultimobranchiale).
V priebehu 4. týždňa vývinu sa u všetkých stavovcov aj človeka na hlavovom konci embrya po
stranách zjavujú párové poloblúkovité vyvýšeniny – žiabrové oblúky (arcus branchialis). Vznikajú
nahromadením mezenchýmu medzi povrchovou ektodermou a vnútornou endodermou faryngového
čreva. U ľudského embrya sa vytvorí postupne kraniokaudálnym smerom päť párov žiabrových
oblúkov. Medzi nimi sú štyri faryngové vačky (zvnútra) a štyri žiabrové brázdy (zvonku). Žiabrové
oblúky sú vo vývine človeka len prechodnými štruktúrami a ich architektúra sa rýchlo mení počas
formovania sa kraniálnej časti embrya (Kapeller et Pospíšilová, 2001).
135
Mezenchým žiabrových oblúkov pohádza z dvoch zdrojov – má mezoektodermálny pôvod.
Bunky mezenchýmu sa diferencujú z mezodemy v blízkosti faryngovej membrány a z neuroektodermy
neurálnej lišty (ektomezenchým) v okolí základu mozgu (z rombencefala, zo segmentovito
usporiadaných 8 rombomér (R1 – R8) a aj z časti prozencefala).
Z mezenchýmu mezodermového pôvodu sa diferencujú svaly, pochádzajúce z materiálu
oblúkov, z mezenchýmu neuroektodermového pôvodu sa diferencuje najmä spojivo dolných častí
tváre a prednej časti krku (Vacek, 2006).
Vývin faryngovej oblasti a neurálna lišta
Neurálna lišta je zvláštna, párová štruktúra, nakoľko sa objavuje len vo včasnom
embryonálnom vývine a má len krátkodobú existenciu. Jej bunky rýchlo migrujú do celého tela
embrya a menia sa na iné typy buniek (Kirby et Waldo, 1990). Bunky neurálnej (gangliovej) lišty
(neural crest cells) sú nielen významným zdrojom mezenchýmu, ale súčasne sú potrebné aj pre vlastnú
diferenciáciu žiabrových oblúkov (Graham, 2003). Bunky neurálnej lišty vznikajú počas neurulácie
embrya. Neuruláciou sa označuje proces vývinu neurálnej rúry. V prvom kroku notochorda indukuje
nad ňou ležiace bunky embryonálnej ektodermy, aby sa množili a diferencovali na neuroektodermu,
ktorú nazývame neurálna platnička. Vkleslina, vznikajúca pozdĺž stredovej osy neurálnej platničky, sa
nazýva neurálna brázda. Okraje neurálnej platničky po bokoch brázdy sa nadvihujú do neurálnych
valov, ktoré rastú k sebe až ich horné okraje spolu splynú. Vzniká tak neurálna rúra, ktorá predstavuje
prvý základ pre centrálny nervový systém. Vývin neurálnej rúry je viackrokový proces prísne
kontrolovaný génmi, ovplyvniteľný faktormi vonkajšieho prostredia (Pospíšilová et al., 2007; Varga et
al., 2007). Bunky neurálnej lišty môžeme charakterizovať ako populáciu multiponentných
prekurzorových buniek, ktoré sú pomenované podľa miesta ich pôvodu – neurálnej lišty.
V embryonálnom období vývinu tvorí neurálna lišta hranicu medzi neurálnou platničkou (budúci
centrálny nervový systém) a ne-neurálnou ektodermou (budúca pokožka, obr. 1).
Obr. 1. Schematický nákres formovania sa neurálnej rúry aj neurálnej lišty (znázornené tmavo)
a následnej migrácie buniek neurálnej lišty do rôznych častí tela embrya (Sakai et Wakamatsu, 2005).
Neurálna lišta je rozdelená do dvoch veľkých oblastí, zvaných kraniálna a trupová neurálna
lišta (cranial and trunk neural crest). Kraniálna neurálna lišta siaha od stredu diencephala kaudálne až
po 5. somit, trupová neurálna lišta pokračuje od 5. somitu po kaudálny koniec embrya. Z oblasti
neurálnej lišty medzi očnými plakódami až po 3. somit migrujú bunky do výtokovej časti srdca, preto
sa táto oblasť označuje aj ako kardiogénna („srdcová“) neurálna lišta (cardiac neural crest).
136
Na začiatku sú neurálne lišty súčasťou ektodermy, preto majú charakter epitelových buniek.
Následne bunky neurálnej lišty podstúpia komplexný proces, zvaný epitelovo-mezenchýmová
premena (epithelial-mesenchymal transition). Premena zahŕňa génmi riadené zmeny ultraštruktúry
buniek, architektoniky cytoskeletu aj v expresii proteínov. Premenené bunky sa oddelia od
povrchového epitelu a migrujú do tela embrya, kde dajú základ bunkám s rôznym osudom a funkciou
(Kang et Svoboda, 2005). Napríklad neuróny a podporné bunky periférneho nervového systému sú
väčšinou pôvodom z neurálnej lišty, s výnimkou niektorých neurónou pochádzajúcich z neuroplakód.
Bunky neurálnej lišty sa diferencujú aj na melanocyty v koži, chrupku a väzivo hlavy a krku,
chromafinné bunky drene nadobličky a iné (Sakai et Wakamatsu, 2005).
Utváranie žiabrových oblúkov, s výnimkou I. mandibulárneho oblúka, je regulované
homeobox (HOX) génmi. Ich informáciu prinášajú bunky neurálnej lišty, migrujúce do pod nimi
ležiacej mezodermy budúcich žiabrových oblúkov. Expresia HOX génov postupuje segmentovite,
rostrokaudálnym smerom. Podmienkou pre uplatnenie morfogenetického pôsobenia príslušných HOX
génov je interakcia budúceho žiabrového oblúku s neuroektodermovými bunkami prislúchajúcich
rombomérov. Okrem základnej integrácie neuroektodermy s bunkami mezodermy sa uplatňujú pri
vývoji žiabrových oblúkov a z nich pochádzajúcich derivátov aj ďalšie faktory udržujúce a regulujúce
rast a morfologické utváranie (Vacek, 2001).
Mezenchýmové bunky, pochádzajúce z neurálnej lišty indukujú normálny vývin viacerých
orgánov:
1) thymus lymphaticus - podmieňujú atraktívnosť epitelového základu týmusu pre migrujúce
prekurzorové T-bunky z hematopoetických orgánov a sú nevyhnutné pre normálnu histogenézu
a funkciu týmusu,
2) glandulae parathyroideae - podmieňujú normálny vývoj, stavbu a funkciu prištítnych teliesok,
3) glandula thyroidea - vytvárajú spojivo štítnej žľazy,
4) tvár a krk - podieľajú sa na vývoji skeletu, chrupiek, spojivových a niektorých svalových
štruktúr hlavy, tváre a krku,
5) srdce - podieľajú sa na septácii výtokovej časti srdca, oddelení veľkých ciev a komôr srdca.
Vývin týmusu a neurálna lišta
Výskum Bockmana a Kirbyho (1984) na kuracích embryách potvrdili, že experimentálna
eliminácia častí kraniálnej neurálnej lišty (medzi somitmi 1 až 5) výrazne zredukuje veľkosť týmusu,
prípadne spôsobuje až jeho absenciu. Podobne redukované boli aj prištítne telieska a štítna žľaza,
v niektorých prípadoch dokonca telieska chýbali (na jednej strane alebo obojstranne) a objavili sa aj
vývinové chyby srdca. Vývin týmusu teda závisí od priameho spojenia mezenchýmových derivátov
neurálnej lišty s epitelom budúceho faryngu.
Význam neurálnej lišty v normogenéze týmusu je znázornený na Obr. 2. Bunky neurálnej lišty
po epitelovo-mezenchýmovej transformácii cestujú aj do oblasti faryngových vačkov. Tieto bunky
ektomezenchýmu obklopia rozpínajúcu sa masu epitelových buniek – základ týmusu. Následne sa
tento epitelový základ stáva atraktívny pre prekurzorové bunky lymfoidnej rady, ktoré sem migrujú
z okolitých krvných ciev. Epitel vytvorí podpornú sieť pre lymfoidné bunky a interakcie medzi
bunkami epitelu a budúcich lymfocytov dopomáhajú pri dozrievaní imunokompetentných T- buniek.
Z buniek neurálnej lišty vznikajú spojivové puzdro a spojivové septá týmusu (Bockman, 1997).
Vývin srdca a neurálna lišta
Ľudské srdce, ako orgán sa začína vyvíjať v treťom týždni embryonálneho vývinu. V tom čase
sa z pôvodne párového základu vytvorí jednotná, najprv priamo prebiehajúca srdcová rúra. Časť
neurálnej lišty, ktorá sa označuje ako kardiogénna, sa nepodieľa jedine na vývine srdca, ale jej ablácia
je asociovaná aj s nevyvinutím alebo nesprávnym vývinom týmusu, prištítnych teliesok a štítnej žľazy.
Nakoľko vrodené chyby výtokovej časti srdca a hypoplázia týmusu sú súčasťou spektra pri viacerých
klinických stavoch, rýchlo sa objavili dohady, že kardiogénna neurálna lišta je embryonálnym
základom DiGeorgovho syndrómu (Hutson et Kirby, 2003). Bunky kardiogénnej neurálnej lišty
zohrávajú viacero kľúčových úloh v normogenéze srdca - cestujú cez 3., 4., a 6. faryngový oblúk do
vznikajúceho trunkokonálneho septa budúceho srdca a vytvárajú spojivo a hladké svalstvo septa ako aj
parasympatické postganglionové neuróny (Larsen, 2001).
Úloha kardiogénnej neurálnej lišty v normálnej a zmenenej septácii srdcových výtokových
kanálov bola dokázaná pomocou ablácie neurálnej lišty v mnohých experimentoch. Ak sa odstráni
kardiogénna neurálna lišta experimentálnym zvieratám skôr, než jej bunky začnú migrovať,
137
trunkokonálne septum sa vôbec nevyvinie a krv vyteká z komôr srdca cez truncus arteriosus
perzistens. Ablácia časti alebo celej kardiogénnej neurálnej lišty môže zapríčiniť aj iné anomálie, napr.
pootočenie aorty do prava, stenózu trojcípej chlopne, hypopláziu pravého štvrtého aortálneho oblúka,
defekt komorového septa s hypopláziou alebo Fallotovu tetralógiu. Ďalší dôkaz o úlohe poruchy
migrácie buniek neurálnej lišty je časté spojenie uvedených anomálií srdca s poruchou vývinu
faryngových oblúkov a ich derivátov (napr. týmus), cez ktoré normálne bunky kardiogénnej neurálnej
lišty migrujú. Náchylnosť na infekcie s hypopláziou týmusu a prištítnych teliesok aj anomáliami tváre
u detí s vrodenými chybami srdca, známu ako DiGeorgov syndróm, spôsobuje delécia génov na
chromozóme 22. Je to jedno z ochorení označovaných ako CATCH 22: Cardiac defects (srdcové
chyby), Abnormal facial features (abnormálne črty tváre), Thymus hypoplasy (hypoplázia týmusu),
Cleft palate (rázštep podnebia) a Hypocalcemia (hypokalcémia spôsobená nedostatočným vývinom
glandulae parathyroideae) (Chaoui et al., 2002). Súčasne môžu byť prítomné aj ďalšie vrodené
vývinové chyby u orgánov, ktorých normálny vývoj je tiež indukovaný prítomnosťou buniek neurálnej
lišty. Okrem vrodených chýb srdca a týmusu môže byť súčasťou symptomatológie DiGeorgovho
syndrómu aj gastroezofageálny reflux, oneskorený vývoj reči, laryngomalácia, rázštep pery a podnebia,
agenéza obličiek, typické abnormality tváre, hluchota, malformácie očí, ochrnutie nervus facialis
a hypotyroidizmus (Markert et al., 2004). Kraynack et al. (1999) dávajú do súvislosti s deléciou
22q11.2 aj agenézu corpus callosum, ktorú diagnostikovali u 4 ročného dievčaťa s DiGeorgovým
syndrómom. Hemizygotná delécia chromozómu 22q11, ktorá je asociovaná s DiGeorgovým
syndrómom sa vyskytuje u 1 zo 4000 detí. V 8 až 28% je táto choroba zdedená po rodičoch
a prevalencia familiárneho výskytu sa zvyšuje so zlepšujúcou sa starostlivosťou o pacientov
s DiGeorgovým syndrómom a ich prežívaním do reprodukčného veku (Stalmans et al., 2003). Pereira
et al. (2003) porovnávali výskyt mikrodelécií 22q11.2 (metódou vysoko špecifickej PCR) u 149
jedincov z troch rôznych etnických skupín (europoidná a negroidná varieta a mulati). Autori nenašli
signifikantný rozdiel týkajúci sa heterozygozity spomínanej mikrodelécie medzi jednotlivými
subpopuláciami.
Lézie kardiogénnej neurálnej lišty však majú malý morfologický dopad na vývin žíl srdca, ako
napríklad cor triatriatum alebo anomálie venae pulmonales (Philips at al., 1989).
Obr. 2. Schéma jednotlivých krokov vo vývine týmusu (Bockman, 1997).
Závery
Pri vrodených chybách srdca sa často nevenuje dostatočná pozornosť možnému narušenému
vývinu týmusu. Mikušová et al. (2006) sledovali štruktúru týmusu odstráneného pri
kardiochirurgických operáciách srdca detí. Zistili pozitívnu koreláciu medzi zmenou štruktúry týmusu
a vybranými vrodenými chybami srdca (defekt komorového septa, transpozícia veľkých ciev srdca,
perzistujúci truncus arteriosus, hypoplázia ľavej komory) u detí. Autori predpokladajú, že tieto zmeny
sú podmienené génmi, ovplyvňujúcimi bunky neurálnej lišty v ich migrácii do základu srdca a týmusu.
Týmusy detí s vrodenými chybami srdca vykazovali zmeny v štruktúre kôry a drene, aj v pozitivite
na cytokeratín. Najväčšie rozdiely boli v počte, štruktúre a veľkosti Hassallových teliesok drene
týmusu.
138
Navyše deťom s vrodenými chybami srdca sa počas kardiochirurgickej operácie bežne
vykonáva totálna alebo parciálna tymektómia pre lepší prístup k operačnému polu. Zatiaľ existuje
málo údajov o zmenách v bunkovej imunite následkom tymektómie u malých detí. Halnon et al. (2005)
zistili narušenú produkciu a dlhotrvajúce zníženie počtu CD4 a CD8 lymfocytov u tymektizovaných
detí. Môže však byť otázne, či tieto zmeny spôsobila samotná tymektómia pri kardiochirurgickej
operácii alebo narušený prenatálny vývin týmusu.
Poďakovanie
Práca bola podporená Grantom Univerzity Komenského č. UK/349/2007 a grantom VEGA č.
1/4252/07.
Použitá literatúra
1. Bockman, D.E.: Development of the thymus. Microsc Res Tech. 38: 209–215, 1997.
2. Bockman, D.E., Kirby M.L.: Dependence of thymus development on derivates of neural crest. Science. 223:
498–500, 1984.
3. Graham, A.: Development of the pharyngeal arches. Am J Med Genet. 119A(3): 251–256, 2003.
4. Halnon, N.J., Jamieson, B., Plunkett, M. et al.: Thymic function and impaired maintance of peripheral T cell
populations in children with congenital heart disease and surgical thymectomy. Pediatr Res. 57(1): 42–48,
2005.
5. Hutson, M.R., Kirby, M.L.: Neural crest and cardiovascular development: a 20-year perspective. Birth Defects
Res (part C). 69: 2–13, 2003.
6. Chaoui, R., Kalache, K.D., Heling, K.S. et al.: Absent or hypoplastic thymus on ultrasound: a marker for
deletion 22q11.2 in fetal cardiac defects. Ultrasound Obstet Gynecol. 20: 546–552, 2002.
7. Kang, P., Svoboda, K.H.: Epithelial-mesenchymal transformation during craniofacial development. J Dent
Res. 84(4): 678–690, 2005.
8. Kapeller, K., Pospíšilová, V.: Embryológia človeka. Martin: Vydavateľstvo Osveta 371p., 2001.
9. Kirby, M.L., Waldo, K.L.: Role of neural crest in congenital heart disease. Circulation. 82: 332–340, 1990.
10. Kraynack, N.C., Hostoffer, R.W., Robin, N.H.: Agenesis of the corpus callosum associated with DiGeorge –
velocardiofacial syndrome: a case report and review of the literature. J Child Neurol. 14(11): 754–756. 1999.
11. Larsen, W.J.: Human Embryology. Third Edition. New York: Churchill Livingtone 548p., 2001.
12. Markert, M.L., Alexieff, M.J., Li, J. et al.: Complete DiGeorge syndrome: Development of rash,
lymphadenopathy and oligoclonal T cells in 5 cases. J Allergy Clin Immunol. 113 (4): 734–741, 2004.
13. Mikušová, R., Pospíšilová, V., Varga, I. et al.: Retikuloepitelová stróma v normálnom a patologicky
zmenenom týmuse. In: Polák, Š., Pospíšilová, V., Varga, I. (eds): Morfológia v súčasnosti. Bratislava:
Univerzita Komenského, 239–245, 2006.
14. Pereira, A.N., Correa, R.F.R., Mota, G.F. et al.: High specificity PCR screening for 22q11.2 microdeletion in
three different ethnic groups. Braz J Med Biol Res. 36(10): 1359–1365, 2003.
15. Philips, M.T., Waldo, K., Kirby, M.L.: Neural crest ablation does not alter pulmonary vein development in
the chick embryo. Anat Rec. 223(3): 292–298, 1989.
16. Pospíšilová, V., Slípka, J.: Does the thymus develop in the third branchial pouch only? Funct Develop
Morphol. 4: 247–248, 1994.
17. Pospíšilová, V., Mikušová, R., Polák, Š., Varga, I.: Embryológia človeka. Učebnica pre bakalárske
a magisterské odbory. Bratislava: Univerzita Komenského 100p., 2007.
18. Sakai, D., Wakamatsu, Y.: Regulatory mechanisms for neural crest formation. Cell Tis Org. 179: 29–35,
2005.
19. Slípka, J., Pospíšilová, V.: „Thymus secundus“ beim Menschen. Ann Anat. 177: 386, 1995.
20. Stalmans, I., Lambrechts, D., De Smet, F. et al.: VEGF: A modifier of the del 22q11 (DiGeorge) syndrome?
Nature Med. 9(2): 173–182, 2003.
21. Vacek, Z.: Embryologie. Učebnice pro studenty lékařství a oborů všeobecná sestra a porodní asistentka.
Praha: Grada Publishing 255p., 2006.
22. Varga, I., Pospíšilová, V., Rajec, J. et al.: Etiológia, patogenéza a prevencia kongenitálnych defektov
neurálnej rúry. In: XIV. kongres SGPS SLS s medzinárodnou účasťou venovaný pamiatke primára MUDr.
Ladislava Topolského, CSc. Abstrakty. Bratislava: SLS, SGPS. 42–43, 2007.
139
Simultaneous detection of multiple genetic variants associated with hereditary
pancreatitis (Molecular diagnostic assay development and validation)
Patrik Vitazka, M. Lu, MA. Armstrong, Arti Pandya, Andrea Ferreira-Gonzalez
Department of Pathology, Virginia Commonwealth University Medical Center, Richmond, VA
Abstract
Background: Susceptibility to pancreatitis, variability of clinical manifestation and
likelihood of complications such as progression to neoplastic disease results likely from
specific variations in the individual's genomic DNA. Role of genetic polymorphism in disease
development is most evident in the case of hereditary pancreatisis (HP). HP presents as an
autosomal dominant disorder with 80% disease penetrance and is associated with mutations in
cationic trypsinogen gene (PRSS1). Recently another gene has been described the serine
protease inhibitor Kazal type 1 (SPINK1) to be a contributing factor in adult alcoholic and
chronic pancreasitis. Methods: We have developed a single tube DNA genotyping assay
simultaneously detecting four different loci in two genes: PRSS1 and SPINK1 gene. PCR
amplicones are used as templates for extension of unlabeled olifonucleotides with fluorescent
dideoxynucleotides by the AmpliTaq DNA Polymerase. Resulting fluorescently labelled
oligos are analyzed on the ABI 3100 capillary electrophoresis instrument and genotype is
assigned using the GeneScan Software. Conclusion: We have developed an accurate method
for simultaneous detection of the four most common genetic variants associated with
pancreatitis. The design of the assay allows for flexible incorporation of additional genetic
variants and will lead to a better understanding and management of patients with pancreatic
inflammatory disease.
Introduction
Recurrent inflammatory attacks of pancreatic tissue result, in many occasions, into irreversible
structural alteration and functional impairment of the pancreas with life threatening consequences.
Exocrine pancreas produces a variety of proteolytic enzymes necessary for proper chymus
digestion. These enzymes are secreted into pancreatic juice as inactive proenzymes and do not become
activated until they enter the duodenum. Improper pancreatic juice composition, environmental
stimuli, such as chronic exposure to ethanol, distorted local anatomy with altered drainage of bile and
pancreatic juice into the duodenum, and increased sensitivity of the immune system, can all lead to
premature activation of proteolytic enzymes in the pancreatic parenchyma and result in inflammation.
Therefore, inflammation of the pancreatic parenchyma is usually a result of an autodigestive process
rather than infection.
Susceptibility to pancreatitis and variability of clinical manifestation, including progression to a
neoplastic disease, results likely from specific variations in the DNA of an individual. The role of
genetics in pancreatitis development was previously correlated with a particular mutation in the key
proteolytic enzyme, the cationic trypsinogen gene [PRSS1 NM_002769.2: c. 365G>A (p.
Arg122His)]. Dominant pattern of inheritance and the fact that more than 80% of the PRSS1_R122H
mutation carriers develop disease during their lifetime made trypsinogen gene a suitable candidate for
genetic testing. Further studies showed that additional disease contributing mutations can occur
[PRSS1 NM_002769.2: c. 47C>T (p. Ala122Val), PRSS1 NM_002769.2: PRSS1_ c. 86A>T (p.
Gln122Ile)].
Since mutations in PRSS1 gene can explain only a limited number (~2-3%) of familiar or
idiopathic pancreatitis, genetic variations in other genes, hand-in-hand with environmental factors, are
likely to be present. Among these genes, SPINK1 is the most recent candidate [SPINK1
NM_003122.2: c. 101 A>G (p. Gln122Ser)]. Additionally, there has been a clear association with
certain mutations in the CFTR1 gene. Interestingly, the patient’s risk was increased approximately 40fold by having 2 CFTR mutations, 20-fold by having SPINK1 (N34S), and 900-fold by having both.
Genetic testing offers a tool that allows identification of individuals with greater risk for pancreatitis
development and can influence early disease management. It also decreases the number of invasive
procedures what translates into decreased cost for health care providers and the same time benefit
140
patients. Here we describe development of a molecular diagnostic tool for targeted mutation detection
in genes that have been previously correlated with either a high risk of pancreatitis development or
with increased susceptibility to pancreatitis. The chosen assay platform was designed to be easily
updated as additional loci and genes are discovered. As many as 35 single nucleotide variants or
mutations in multiple genes can be simultaneously assessed in a single run.
Materials and methods
Assay platform: The assay was designed as a SNaPshot Multiplex Assay run on the ABI
PRISM® 3100 Genetic Analyzer (Applied Biosystems) to simultaneously interrogate presence of four
different nucleotides in two different genes in a single tube reaction. Primer and probe design: Pairwise DNA alignment shows that PRSS1 gene shares extensive homology with the PRSS2 and
PRRSS3 genes and TRY5, TRY6, and TRY7 pseudogenes (Fig. 1).
PRSS1 gene exon2 alignment (partial sequence):
PRSS1
PRSS3
PRSS2
TRY7
TRY5
TRY6
TTGCTGCCCCCTTTGATGATGATGACAAGATCGTTGGGGGCTACAACTGTGAGGAGAATTCTGTCCCCTACCAGGTGTCCCTGAATTCTGGCTACCACTTCTGTGGTGGCTCCCTCATCAACGAACAGTGGGTGGTATCAGCAGGCCACTGCTACAAGTC
TTGCTGTCCCCTTTGACGATGATGACAAGATTGTTGGGGGCTACACCTGTGAGGAGAATTCTCTCCCCTACCAGGTGTCCCTGAATTCTGGCTCCCACTTCTGCGGTGGCTCCCTCATCAGCGAACAGTGGGTGGTATCAGCAGCTCACTGCTACAAGAC
TTGCTGCCCCCTTTGATGATGATGACAAGATCGTTGGGGGCTACATCTGTGAGGAGAATTCTGTCCCCTACCAGGTGTCCTTGAATTCTGGCTACCACTTCTGCGGTGGCTCCCTCATCAGCGAACAGTGGGTGGTGTCAGCAGGTCACTGCTACAAGTC
TTGGTGTCTCCTTTGATGATGATGACAAGATTGTTGGGGGCTACAACTGTGAGGAGAATTCTGTCCCCTACCAGGTGTCCCTGAATTCTGGCTACCACTTCTGTGTTGGCTCCCTCAACAGGGAATAGTGGGTGGTGTCAGCAGCTCACTGCTACAAGTC
TTGCTTCCCCTTTCGACGACGATGACAACATCATTTAGTGGTATACCTGTGAGGAGAATTCTGTCCCCTACCAGGTGTCCCTGAATTCTGGGTACCACTTCTGCAGTGGCTCCCTCCTCAGCGAACAGTGGGTGGTGTCAGCAGCTCACTGCTACAAGTA
TTGCTGTCCCCTTTGATGATGATGACAAGATTGTTGGGGGCTACACCTGTGAGGAGAATTCTGTCCCCTACCAGGTGTCCTTGAATTCTGGCTCCCACTTCTGTGGTGGCTCCCTCATCAGCGAACAGTGGGTGGTGTCAGCAGGTCACTGCTACAAGCC
*** * * * ** ** ** ******** ** ** * * ** * **************** ***************** ********** * *********
********** ** *** ********** ******* ************
PRSS1
PRSS3
PRSS2
TRY7
TRY5
TRY6
NNNNNNNNCAAGATCATCCGCCACCCCCAATACGACAGGAAGACTCTGAACAATGACATCATGTTAATCAAGCTCTCCTCACGTGCAGTAATCAACGCCCGCGTGTCCACCATCTCTCTGCCCACCGCCCCTCCAGCCACTGGCACGAAGTGNNNNNNNN
NNNNNNNNCAAGATCATCCGCCACCCTAAATACAACAGGGACACTCTGGACAATGACATCATGCTGATCAAACTCTCCTCACCTGCCGTCATCAATGCCCGCGTGTCCACCATCTCTCTGCCCACCACCCCTCCAGCTGCTGGCACTGAGTGNNNNNNNN
NNNNNNNNCAAGATCATCCGCCACCCCAAATACAACAGCCGGACTCTGGACAATGACATCCTGCTGATCAAGCTCTCCTCACCTGCCGTCATCAATTCCCGCGTGTCCGCCATCTCTCTGCCCACTGCCCCTCCAGCTGCTGGCACCGAGTCNNNNNNNN
NNNNNNNNCAAGATCATCCGCCACCCCAAATACAACAGCTGGACTCTGGACAATGACATCCTGCTGATCAAGCTCTCCACACCTGCCATCATCAATGCCCATGTGTCCACCATCTCTCTGCCCACCACCCCTCCAGCTGCTGGCACTGAGTGNNNNNNNN
NNNNNNNNCAAGATCATCCGCCACCCCAAATACAACAGTTGGACTCTGGACAATGACATCCTGCTGATCAAGCTCTCCATGCCTGCTGTCATCAATGCCCACATGTCCACCATCTCTCTACCCACCGCCCCTCCAGCTGCTGGCACCAAGTTNNNNNNNN
NNNNNNNNCAAGATCATCCGCCACCCCAAATACAACAGGATTACTCTGAACAATGACATCATGCTGATCAAGCTCTCCACACCTGCCGTCATCAATGCCCATGTGTCCACGATCTCTCTGCCCACTGCCCCTCCAGCTGCTGGCACCGAGTGNNNNNNNN
****************** ***** ****
****** *********** ** * ***** ******
* *** * ***** ***
***** * ******** ***** ********** ******* ***
PRSS1 gene exon3 alignment (partial sequence):
Fig. 1. Alignment of the trypsinogen gene family.
Three pairs of primers were used in a multiplex PCR reaction to yield three products (Fig. 2):
423bp amplicon of the exon 2 of the PRSS1 gene, 138bp amplicon of the exon 3 of the PRSS1 gene,
and 307bp amplicon of the exon 3 of the SPINK1 gene.
PRSS1_exon2: forward primer: PRSS1_ex2_F(2), reverse primer: PRSS1_ex2_R, probe: PRSS1_ex2_47_F(pA)
Forward strand
AAAAACCCATCTCCACTCCAGTTGCTG
5’- CCCAGGAGAGCTCGGATCCTNNNNNCCCATCTCCACTCCAGTTGCTGCNNNNNCGACTGCAAAGCTCCCGGC -3’
PRSS1_exon2: forward primer: PRSS1_ex2_F(2), reverse primer: PRSS1_ex2_R, probe: PRSS1_ex2_86_R(pA)
Forward strand
5’- CCCAGGAGAGCTCGGATCCTNNNNNACTGTGAGGAGAATTCTGTCCCCTNNNNNCGACTGCAAAGCTCCCGGC -3’
GACACTCCTCTTAAGACAGGGGAAAAAAAAAAA
PRSS1_exon3: forward primer: PRSS1_ex3_F, reverse primer: PRSS1_ex3_R, probe: PRSS1_ex3_365_R
Forward strand
5’- TCATGTTAATCAAGCTCTCCTCACGNNNNNGCGTGTCCACCATCTCTCTGCCCNNNNNGCGAGCTCTGGCGGTGAGT -3’
GCACAGGTGGTAGAGAGACGGG
SPINK1_exon3: forward primer: SPINK1_ex3_F, reverse primer: SPINK1_ex3_R, probe: SPINK1_ex3_101_R
Forward strand
5’- CAATCACAGTTATTCCCCAGAGNNNNNATGAACTTAATGGATGCACCAAGNNNNNTCTCACCCCGAGAAAAGCAAAC -3’
ACTTGAATTACCTACGTGGTTCAAAAAAAAAAAAAAA
Fig. 2. Primers and probes for the hereditary pancreatitis SNaPshot multiplex essay.
PCR assay was optimized with regard to: annealing temperature (55oC-65oC in 1oC
increments), Mg2+ concentration (1.0mM-3.0mM in 0.5mM increments), and primer concentration
(100nM-900nM in 200nM increments). PCR amplicones were used in a common oligo-probe based
single dideoxynucleotide (ddNTP) extension reaction. Genotyping control preparation: PCR amplicon
of the PRSS1 gene encompassing a region with all the variants of interest was cloned into the pCRBluntII-TOPO vector. Genotyping control for the SPINK1 gene was prepared similar way. Site
directed mutagenesis was used to introduce specific base pair changes at the analyzed positions.
Samples: Analyzed clinical samples were divided into three groups: Group 1: Individuals from a large
family diagnosed with hereditary pancreatitis (studied by Pandya at al.), n=21. Group 2: Individuals
with clinical manifestation of pancreatisis, n=142. Group 3: Healthy individuals without apparent
clinical manifestation of pancreatitis - control group, n=157. SNaPshot protocol: Genomic DNA from
whole peripheral human blood was extracted with the MagNa Pure LC Instrument (Roche Diagnostics)
using the DNA I Blood Cells Fast Protocol and the MagNA Pure LC DNA Isolation kit. DNA was
initially amplified in a multiplex PCR (3-plex) reaction using three pairs of primers. Amplified DNA
was subsequently digested with SAP and ExoI enzymes to remove dNTPs and unincorporated primers
and used as templates for four oligonucleotide probes in single dideoxynucleotide (ddNTP) extension
141
reaction. Mixture of four different ddNTPs each labeled with a different fluorophore was used in the
extension reaction (SnapShot Multiplex Reaction Mix, Applied Biosystems). Fluorescently labeled
probes were digested with SAP, mixed with HiDi formamide, heat denatured, and run on the capillary
electrophoresis instrument ABI PRISM® 3100 Genetic Analyzer (Applied Biosystems). ABI
PRISM® 3100 Genetic Analyzer raw data files were analyzed using the GeneScan Software with the
GS120 LIZ Size Standard analysis parameter file.
Results and discussion
Assay design: The assay was designed as a SNaPshot Multiplex Assay run on the ABI
PRISM® 3100 Genetic Analyzer (Applied Biosystems) to simultaneously interrogate presence of four
different nucleotides in two different genes in a single tube reaction.
ANALYTICAL VALIDATION:
Assay inter and intra run variability: After initial assay optimization with regard to primer annealing
temperature, magnesium ion concentration, and primer concentration, nine clinical samples with
genotype previously established by sequencing and positive plasmid controls generated by site
directed mutagenesis were run on three different days in three replicates. For each case, we measured
the coefficient of variation (%CV) and looked at the range of obtained values. Precision and reportable
ranges: To determine assay variability and to establish reportable range criteria, results from 320
samples were analyzed and average peak size values and reportable ranges were calculated.
Background threshold value for peak height was also defined.
PRSS1_47
peak size
peak height
A16(47C)
30.15 +/- 0.25
>400
PRSS1_86
V16(47T)
31.58 +/- 0.25
>400
N29(86A)
35.71 +/- 0.25
>400
PRSS1_365
I29(86T)
35.45 +/- 0.25
>400
R122 (365G)
26.6 +/- 0.25
>400
R122 (365A)
28.3 +/- 0.25
>400
SPINK1_101
N34(101A)
38.47 +/- 0.25
>400
S34(101G)
37.08 +/- 0.25
>400
Assay specificity and sensitivity: To confirm specificity of the SNaPshot Multiplex
Genotyping Assay forty eight clinical samples were subject to bidirectional sequencing or to RLFP
analysis using the AflIII restriction endonuclease. We analyzed n=15 DNA samples from the group 1,
n=20 DNA samples from the group 2, and n=13 samples from the group 3. Bidirectional sequencing
analysis of the PRSS1 gene exon 2 at the position 47 and 86 identified presence of wild type
nucleotides PRSS1_ (47C/C) and PRSS1_ (86A/A) in all 48 analyzed samples. No mutations were
identified either by sequencing or by the SNaPshot Multiplex genotyping
assay. Bidirectional
sequencing analysis of the SPINK1 gene exon 3 at the position 101 identified presence of wild type
nucleotides SPINK1_(101A/A) in
37 individuals, 11 individuals were identified as heterozygotes
with one wild type nucleotide and one genetic variant nucleotide SPINK1_(101A/G). The overall
sensitivity and specificity resulting from the comparison of bidirectional sequencing and the SNaPshot
Multiplex genotyping assay was 100% (Specificity: [TN/(TN+FP)] = 100%, Sensitivity: [TN/(TN+FP)]
= 100%). PCR-RLFP analysis with the AflIII restriction endonuclease of the PRSS1 gene exon 3 at the
position 365 identified presence of wild type nucleotides PRSS1_ (365 G/G) in 37 individuals, 15
individuals were identified as heterozygotes with one mutated nucleotide and one wild type nucleotide
PRSS1_ (365 G/A). The overall sensitivity and specificity resulting from the comparison of the RLFP
analysis and the SnaPshot Multiplexgenotyping assay was 100% (Specificity: [TN/(TN+FP)] = 100%,
Sensitivity: [TN/(TN+FP)] = 100%).
GROUP
PRSS1_47
PRSS1_86
PRSS1_365
SPINK1_101
C/C
C/T
T/T
A/A
A/T
T/T
G/G
G/A
A/A
A/A
A/G
G/G
GROUP 1
(n=21)
21
0
0
21
0
0
7
14
0
21
0
0
142
GROUP 2
(n=142)
142
0
0
142
0
0
141
1
0
135
7
0
GROUP 3
(n=157)
157
0
0
157
0
0
157
0
0
153
4
0
CLINICAL VALIDATION: SNaPshot Multiplex Genotyping Assay identified 14 individuals
out of n=21 to have a mutation in the PRSS1 at the position 365 G>A (PRSS1_R122H) in the group 1.
The assay also identified one individual to have a mutation in the PRSS1 at the position 365 G>A
(PRSS1_R122H) and 7 individuals to have a single nucleotide variant in the SPINK1 gene at the
position 101 A>G (SPINK1_N34S) out of n=142 in the group 2. There were 4 individuals with a
single nucleotide variant in the SPINK1 gene at the position 101 A>G (SPINK1_N34S) out of n=157
in the group 3. Nobody in this group had a mutation in the PRSS1 gene. We did not identify anybody
who would have mutation in both PRSS1 and the SPINK1 genes simultaneously.
PRSS1_ c. 47C>T (p. Ala122Val)
PRSS1_ c. 86A>T (p. Gln122Ile)
0
0
0
0
0
0
0
PRSS1 c. 365 G>A (p. Arg122His)
A/T
T/T
A/A
0
A/A
48
0
0
A/T
C/C
48
sequencing
T/T
0
0
0
T/T
C/T
C/T
sequencing
SNaPshot Assay
C/C
T/T
SNaPshot Assay
0
0
0
SPINK1 c. 101 A>G (p. Gln122Ser)
0
0
0
15
0
0
0
0
A/A
A/G
G/G
A/A
G/G
33
sequencing
A/A
37
0
0
G/G A/G
G/A
G/A
AflIII PCR-RLFP
SNaPshot Assay
G/G
A/A
SNaPshot Assay
0
11
0
0
0
0
Conclusions
We have developed an accurate method for simultaneous detection of the four most common
genetic variants associated with hereditary pancreatitis. The SNaPshot Multiplex Genotyping Assay
platform was chosen for its user friendly format and flexible customization of number of analyzed
single nucleotide variants or mutations in multiple genetic loci. Assessment of multiple genetic
variants simultaneously will lead to a better understanding and management of patients with
pancreatic inflammatory disease.
Acknowledgements
I would like to thank Dr. Vanda Repiska and Dr. Viera Geislerova for their invitation to
participate on the conference “Vrsanskeho den biologov”. Likewise I would like to thank all the
personals at the Molecular Diagnostics Lab at Virginia Commonwealth University for they dedication
to the exciting work they do everyday.
References
1. Ellis, I., Lerch, M.M., Whitcomb, D.C.: Genetic testing for hereditary pancreatitis: guidelines for indications,
counselling, consent and privacy issues. Pancreatology. 1(5): 405–15, 2001.
2. Noone, P.G., Zhou, Z., Silverman, L.M., et al.: Cystic fibrosis gene mutations and pancreatitis risk: relation to
epithelial ion transport and trypsin inhibitor gene mutations. Gastroenterology. 121: 1310–1319, 2001.
3. Sanchez, J.J.S., Børsting, C., Hallenberg, C., Buchard, A., Hernandez, A., Morling, N.: Multiplex PCR and
minisequencing of SNPs - a model with 35 Y chromosome SNPs. Forensic Sci Int. 137: 74–84, 2003.
4. Teich, N., Rosendahl, J., Toth, M., Mossner, J., Sahin-Toth, M.: Mutations of human cationic trypsinogen
(PRSS1) and chronic pancreatitis. Hum Mutat. 27: 721–730, 2006.
143
Hodnotenie farmakologickej liečby starších pacientov pomocou vybraných indikátorov
Martin Wawruch1, Martina Žikavská1, Kamil Stratený1, Ladislava Wsólová2, Magdaléna
Kuželová3, Jana Tisoňová1, Dalibor Hojsík4, Vladimír Šišovsky5, Štefan Laššán6, Viera
Kristová
1
Farmakologický ústav, Lekárska fakulta, Univerzita Komenského, Bratislava; 2Oddelenie vedeckých
a technických informácií, Slovenská zdravotnícka univerzita, Bratislava; 3Katedra farmakológie a toxikológie,
Farmaceutická fakulta, Univerzita Komenského, Bratislava; 4Ústav súdneho lekárstva, Lekárska fakulta,
Univerzita Komenského, Bratislava; 5Ústav patologickej anatómie, Lekárska fakulta, Univerzita Komenského,
Bratislava; 6Katedra pneumológie a ftizeológie, Fakulta zdravotníckych špecializačných štúdií, Slovenská
zdravotnícka univerzita, Bratislava, Slovenská republika, [email protected]
Abstrakt
V súčasnosti vystupuje do popredia čoraz viac problém hodnotenia kvality
farmakoterapie v geriatrii. Preto cieľom našej štúdie bolo hodnotiť kvalitu farmakologickej
liečby s použitím dvoch indikátorov kvality: a) používanie liečiv potenciálne nevhodných pre
starších pacientov a b) nežiaduce účinky (NÚ) farmák, ktoré mali príčinný vzťah k prijatiu na
hospitalizáciu. Do štúdie sme zaradili 600 pacientov vo veku ≥65 rokov hospitalizovaných v
nemocnici v Považskej Bystrici od 1.12. 2003 do 31.3. 2005. Na identifikovanie potenciálne
nevhodných liečiv sme použili Beersov zoznam z roku 2003. Ako NÚ vedúce k hospitalizácii
sme hodnotili tie NÚ liečiv, ktoré boli uvedené ako hlavný dôvod alebo ako jedna z príčin
prijatia do nemocnice. Pri prijatí do nemocnice sa potenciálne nevhodné liečivá vyskytli u 121
(20,2%) a pri prepustení u 120 (20,0%) pacientov. Najčastejšie sme zaznamenali digoxín
v dávke >0,125 mg/deň (okrem liečby predsieňových arytmií) a tiklopidín. NÚ, ktoré patrili
k príčinám hospitalizácie, boli dokumentované u 47 pacientov. Prevažovali NÚ A-typu
(n=43), ktoré sú dávkovo závislé a preventabilné. Hlavným nástrojom prevencie NÚ je
pravidelné prehodnocovanie farmakoterapie, rešpektovanie osobitostí individuálneho chorého
a zohľadňovanie rizika liekov.
Úvod
Hoci starší ľudia tvoria približne iba pätinu obyvateľstva Slovenskej republiky, náklady na
farmakologickú liečbu týchto pacientov predstavujú takmer tretinu všetkých financií vynaložených na
lieky (Hegyi a Krajčík, 2002; Zdravotnícka ročenka, 2004).
Starší ľudia predstavujú vysoko vulnerabilnú skupinu populácie z hľadiska rizika
farmakologickej liečby. Nežiaduce účinky sú častou príčinou hospitalizácie. Podľa údajov štúdií
orientovaných na populáciu starších pacientov 3,5-24,8% hospitalizácií sú spôsobené NÚ (Col a kol.,
1990; Lindley a kol., 1992). Citlivosť staršieho človeka na farmakoterapiu súvisí so zmenami
farmakokinetiky a farmakodynamiky liečiv, s častou polymorbiditou, so súčasným užívaním viacerých
liečiv ako aj so zmenenou compliance k farmakoterapii (Bressler a Bahl, 2003). Podľa domácich
zdrojov užívajú starší obyvatelia v domovoch dôchodcov priemerne 4,8 liekov. Iba 9,9% z týchto osôb
neužívali žiaden liek (Bartošovič a kol., 2003). Wawruch a kol. (2007) zaznamenali užívanie ≥6 liečiv
až u 62,3% hospitalizovaných pacientov pri prepustení z nemocnice.
Z uvedených dôvodov vystupuje v súčasnosti čoraz viac do popredia problém hodnotenia
kvality farmakoterapie v geriatrii. Zložitosť takejto analýzy vyplýva z nedostatku relevantných
dôkazov, ktoré by umožnili jednoznačne definovať kvalitnú alebo nekvalitnú farmakologickú liečbu
u starších pacientov.
Pre objektivizáciu hodnotenia kvality farmakoterapie boli vytvorené indikátory kvality. Ide o
merateľné parametre, pre ktoré existujú dôkazy alebo konsenzus, že môžu byť použité na hodnotenie
kvality farmakologickej liečby a jej zmien (Lawrence a Olesen, 1997). Ich použitie umožňuje
poukázať na problémy a trendy v preskripcii. V priestore Európskej Únie sa tvorbou indikátorov
kvality zaoberá expertná skupina DURQUIM (Drug Utilisation Research Quality Indicators Meeting)
(Hoven a kol., 2005). Indikátory kvality farmakoterapie sú pre oblasť geriatrie vytvárané zväčša
metódami konsenzu odborníkov, ktorí zohľadnia aktuálny stav poznania na úrovni medicíny založenej
na dôkazoch.
144
Na Slovensku je nedostatok prác zaoberajúcich sa kvalitou preskripcie liekov. Dosiaľ
publikované práce sa sústredili zväčša na ekonomické aspekty farmakoterapie, čo súvisí so snahou
regulačných orgánov o znižovanie nákladov vynaložených na lieky (Foltán a kol., 2003). Preto cieľom
našej štúdie bolo hodnotiť kvalitu farmakologickej liečby s použitím dvoch indikátorov kvality: 1)
používanie liečiv potenciálne nevhodných pre starších pacientov a 2) nežiaduce účinky liečiv, ktoré
mali príčinný vzťah k prijatiu na hospitalizáciu.
Pacienti a metódy
Do predkladanej retrospektívnej štúdie sme zaradili 600 pacientov vo veku ≥65 rokov
hospitalizovaných na Internom oddelení Nemocnice s poliklinikou v Považskej Bystrici v období od
1.12. 2003 do 31.3. 2005. Do súboru neboli zaradení pacienti, ktorí počas hospitalizácie zomreli.
Taktiež boli z hodnotenia vyradení chorí, ktorých dokumentácia neposkytovala všetky údaje potrebné
pre naše hodnotenie (napr. pacienti, ktorí boli po krátkej hospitalizácii preložení na iné oddelenie). U
všetkých pacientov sme zaznamenali liečivá, s ktorými pacient prišiel do nemocnice a farmaká, ktoré
mu boli odporučené pri prepustení z nemocnice. Do úvahy sme brali i dávkovanie jednotlivých liečiv.
Nehodnotili sme farmaká, ktoré boli podávané iba prechodne počas hospitalizácie. Taktiež sme
neanalyzovali prípravky určené na lokálnu terapiu (dermatologiká).
Všetky údaje pre našu analýzu sme čerpali z chorobopisov pacientov. Pri zbere dát sme plne
rešpektovali etické princípy s ohľadom na zabezpečenie ochrany osobných údajov.
Na identifikovanie liečiv potenciálne nevhodných pre pacientov vo veku ≥65 rokov sme
použili americký Beersov zoznam z roku 2003 (Fick a kol., 2003). Zoznam zahŕňa liečivá, ktorých
podanie starším pacientom je spojené so zvýšeným rizikom manifestácie nežiaducich účinkov, ďalej
farmaká s vysokým interakčným potenciálom a liečivá, ktoré nemajú dostatočne potvrdenú účinnosť
z hľadiska medicíny založenej na dôkazoch. Ide o medzinárodne rešpektovaný zoznam, ktorý bol
použitý v podobných štúdiách (Fialova a kol., 2005, Onder a kol., 2005). Užívanie potenciálne
nevhodných liečiv pri prijatí a prepustení z nemocnice sme porovnali McNemarovým testom (hladina
významnosti α=0,05; štatistický softvér SPSS for Windows 13. verzia).
Ako nežiaduce účinky (NÚ) vedúce k hospitalizácii sme hodnotili tie NÚ liečiv, ktoré boli
uvedené v dokumentácii pacienta ako hlavný dôvod alebo ako jedna z príčin prijatia do nemocnice.
Zaznamenali sme liečivá, ktoré boli podľa dokumentácie v príčinnom vzťahu k jednotlivým NÚ.
Kauzálny vzťah konkrétneho liečiva s nežiaducou udalosťou musel byť potvrdený „dechallenge“
testom alebo údajom o dávkovej závislosti. „Dechallenge“ testom rozumieme ústup NÚ po ukončení
podávania liečiva. Dávková závislosť znamenala vymiznutie NÚ po redukcii dávky vyvolávajúceho
farmaka. Diferencovali sme NÚ A- a B- typu. A-typ reprezentujú dávkovo závislé nežiaduce reakcie,
ktoré sú výsledkom zosilnenia farmakodynamického účinku liečiva. B-typ NÚ sú nezávislé od dávky
a nesúvisia s mechanizmom účinku farmaka. Za NÚ sme nepovažovali prípady úmyselného alebo
náhodného predávkovania, chyby v aplikácii a terapeutické omyly (Rawlins a Thompson, 1985; van
der Hooft a kol., 2006).
Výsledky a diskusia
V súbore 600 pacientov prevažovali ženy 351 (58,5%) nad mužmi 249 (41,5%). Priemerný
vek ± smerodajná odchýlka (SD) všetkých pacientov súboru bol 76,6 ± 6,5 rokov. Ženy boli staršie
(77,1 ± 6,1) ako muži (75,9 ± 7,0).
V hodnotenom súbore sa pri prijatí do nemocnice vyskytli potenciálne nevhodné liečivá u 121
(20,2%) chorých a pri prepustení u 120 (20,0%) pacientov. Porovnateľné hodnoty boli zistené
v Českej republike (25,2%), Taliansku (25,7%) a Fínsku (20,3%) (Fialová a kol., 2005).
V hodnotenom súbore sme zaznamenali ako najčastejšie nevhodné farmaká digoxín v dávke >0,125
mg/deň (okrem liečby predsieňových arytmií) a tiklopidín. K najzriedkavejšie sa vyskytujúcim patrili
pentazocín, tioridazín a amitriptylín (tabuľka 1). Digoxín je najstarším a zároveň aj jedným z najmenej
finančne nákladných liečiv používaných v terapii chronického srdcového zlyhania. Jeho
frekventovaný výskyt v našom súbore poukazuje na pretrvávajúci trend preskripcie tohto farmaka. Na
častej preskripcii tiklopidínu v našom súbore sa podieľajú limitácie zdravotných poisťovní pre
klopidogrel, ktorý predstavuje bezpečnejšiu alternatívu v porovnaní s tiklopidínom. Príčinou je vyššia
cena klopidogrelu oproti tiklopidínu.
145
Liečivo
digoxín*
tiklopidín
amiodaron
chlórdiazepoxid
karizoprodol
diazepam
fluoxetín
metyldopa
indometacín
doxazosín
prometazín
pentazocín
tioridazín
amitriptylín
výskyt pri prijatí
44
28
19
9
7
6
5
5
3
3
2
1
1
0
výskyt pri prepustení
43
28
18
9
7
7
4
5
2
3
3
1
1
1
Tab. 1. Výskyt potenciálne nevhodných liečiv pri prijatí a prepustení z nemocnice (n=600).
Vysvetlivky: hodnoty vyjadrujú frekvenciu výskytu; *digoxín v dávke >0,125 mg/deň, okrem liečby
predsieňových arytmií.
Počas hospitalizácie nedošlo k významnej zmene celkového počtu potenciálne nevhodných
liečiv pri porovnaní stavu pri prijatí a prepustení z nemocnice. Možno konštatovať, že vnímanie
potenciálneho rizika hodnotených liečiv nemocničnými lekármi (internistami) je podobné ako
u praktických lekárov, ktorí zodpovedali za liečbu pacientov mimo nemocnice (Wawruch a kol.,
2006).
Americký Beersov zoznam sme použili preto, lebo na Slovensku ani v iných krajinách strednej
a východnej Európy nie sú k dispozícii podobné zoznamy, ktoré by zohľadňovali regionálne osobitosti
preskripcie a dostupnosť registrovaných farmák v príslušnej krajine.
Nežiaduce účinky (NÚ), ktoré patrili k príčinám hospitalizácie, boli dokumentované u 47
(7,8%) z 600 pacientov hodnoteného súboru (tabuľka 2).
NÚ
pád, hypotenzia
počet
10
poruchy srdcového
rytmu
9
hyperkaliémia
8
krvácanie
alergia
7
4
GIT ťažkosti
4
hepatotoxicita
extrapyramídový
syndróm
kašeľ
rozkolísaný DM
2
1
lieková skupina / liek
ACEI
β-blokátory
Ca-antagonisty
digoxín
β-blokátory
Ca-antagonisty
amiodaron
ACEI
ACEI + K-šetriace diuretikum (spironolaktón)
K-šetriace diuretikum (amilorid)
warfarín
NSA
ATB
NSA
prokinetiká
opioidy
statín
atypické antipsychotikum
1
1
ACEI
kortikosteroidy
počet
5
3
2
3
3
2
1
5
2
1
7
2
2
2
1
1
2
1
1
1
Tab. 2. Nežiaduce účinky vedúce k hospitalizácii a liečivá, ktoré boli dané do kauzálneho vzťahu
s NÚ.
Vysvetlivky: hodnoty vyjadrujú frekvenciu výskytu; NÚ – nežiaduci účinok; ACEI – inhibítory
angiotenzín-konvertujúceho enzýmu; K-šetriace diuretikum – kálium šetriace diuretikum; Caantagonisty – blokátory vápnikových kanálov; NSA – nesteroidové antiflogistiká; ATB – antibiotiká;
GIT ťažkosti – gastrointestinálne NÚ (zhoršenie vredovej choroby žalúdka a dvanástnika, hnačka,
zápcha); DM – diabetes mellitus.
146
Najčastejšie boli zaznamenané kardiovaskulárne komplikácie farmakoterapie: pád spôsobený
poklesom krvného tlaku pri antihypertenznej liečbe a poruchy srdcového rytmu. Frekvenciu výskytu
týchto NÚ možno vysvetliť vysokou prevalenciou kardiovaskulárnych ochorení u starších pacientov
nášho súboru. Krvácanie ako NÚ vedúci k hospitalizácii bolo v našom súbore dané do kauzálnej
súvislosti s warfarínovou terapiou u 7 pacientov. V niektorých podobných štúdiách predstavovalo
krvácanie spôsobené antikoagulačnou liečbou najčastejší NÚ, ktorý bol príčinou hospitalizácie
(Gurwitz a kol., 2000; van der Hooft a kol., 2006). Relatívne nižší výskyt takýchto NÚ v našej štúdii
možno vysvetliť určitou opatrnosťou v preskripcii warfarínu u starších ľudí. Prevažná väčšina NÚ - 43
(91%) zo 47 pacientov boli A-typu, ktoré sú dávkovo závislé a preventabilné. Iba v 4 prípadoch
alergických reakcií išlo o B-typ NÚ.
Závery
Z výsledkov práce vyplýva potreba väčšej pozornosti odbornej lekárskej verejnosti ku
špecifikám farmakoterapie staršieho pacienta. Problematika potenciálne nevhodných liečiv
u pacientov vo veku ≥65 rokov nie je zatiaľ na Slovensku dostatočne propagovaná. Pre hodnotenie
kvality preskripcie v slovenských podmienkach by bolo užitočné vytvoriť zoznamy potenciálne
nevhodných liečiv, ktoré by zohľadňovali osobitosti domácej preskripcie. Snahy regulačných orgánov
o šetrenie nákladov na lieky by nemali viesť k poklesu kvality farmakologickej liečby a následne
k zníženiu kvality života starších ľudí. Preferencia lacnejších terapeutických alternatív môže viesť k
manifestácii NÚ, ktorých liečba zvyšuje náklady na zdravotnícku starostlivosť. Prevaha A-typu NÚ
v hodnotenom súbore poukazuje na možnosť prevencie väčšiny NÚ u starších ľudí. Hlavným
nástrojom prevencie NÚ je pravidelné prehodnocovanie farmakoterapie, rešpektovanie osobitostí
individuálneho chorého a zohľadňovanie rizika liekov.
Poďakovanie
Ďakujeme riaditeľovi Nemocnice s poliklinikou v Považskej Bystrici MUDr. Petrovi Krutému
za umožnenie štúdie. Práca bola podporená grantom VEGA 0314 a Európskym Sociálnym Fondom.
Použitá literatúra
1. Bartošovič, I., Krajčík, Š., Hegyi, L.: Farmakoterapia v zariadeniach sociálnych služieb pre starých ľudí. Prakt
Lek. 83(6): 340–343, 2003.
2. Bressler, R., Bahl, J.J.: Principles of drug therapy for the elderly patient. Mayo Clin Proc. 78(12): 1564–1577,
2003.
3. Col, N., Fanale, J.E., Kronholm, P.: The role of medication non-compliance and adverse drug reactions in
hospitalizations of the elderly. Arch Intern Med. 150(4): 841–845, 1990.
4. Fialova, D., Topinkova, E., Gambassi, G. et al.: Potentially inappropriate medication use among elderly home
care patients in Europe. JAMA. 293(11): 1348–1358, 2005.
5. Fick, D.M., Cooper, J.W., Wade, W.E. et al.: Updating the Beers criteria for potentially inappropriate
medication use in older adults. Arch Intern Med. 163(27): 2716–2724, 2003.
6. Foltán, V., Tesař, T. (Eds).: Lieky. Lieková politika. Farmakoekonomika. Bratislava: Propact, 186, 2003.
7. Gurwitz, J.H., Field, T.S., Avorn, J. et al.: Incidence and preventability of adverse drug events in nursing
homes. Am J Med. 109(2): 87–94, 2000.
8. Hegyi, L., Krajčík, Š.: Priority farmakoterapie vo vyššom veku. Geriatria. 8(3): 101–113, 2002.
9. Hoven, J.L., et al.: Indicators of prescribing quality in drug utilisation research: report of a European meeting
(DURQUIM, 13-15 May 2004) Eur J Clin Pharmacol. 60(11): 831–834, 2005.
10. Lawrence, M., Olesen, F.: Indicators of quality of health care. Eur J Gen Pract. 3: 103–108, 1997.
11. Lindley, C.M., Tully, M.P., Paramsothy, V., Tallis, R.C.: Inappropriate medication is a major cause of
adverse drug reactions in elderly patients. Age Ageing. 21 (4): 294–300, 1992.
12. Onder, G., Landi, F., Liperoti, R. et al.: Impact of inappropriate drug use among hospitalized older adults.
Eur J Clin Pharmacol. 61(5): 453–459, 2005.
13. Rawlins, M.D., Thompson, J.W.: Mechanisms of adverse drug reactions. In Davies DM (Ed). Textbook of
adverse drug reactions. 3rd ed. Oxford; Oxford University Press, 12–38, 1985.
14. van der Hooft, C.S., Sturkenboom, M.C.J, van Grootheest, K. et al.: Adverse drug reaction-related
hospitalisations: A nationwide study in the Netherlands. Drug Saf. 29(2): 161–168, 2006.
15. Wawruch M, Zikavska M, Wsolova L, Kuzelova M, Tisonova J, Gajdosik J, Urbanek K, Kristova V.
Polypharmacy in elderly hospitalised patients in Slovakia. Pharm World Sci. In press, 2007.
16. Wawruch, M., Zikavska, M., Wsolova, L. et al.: Perception of potentially inappropriate medication in elderly
patients by Slovak physicians. Pharmacoepidemiol Drug Saf. 15(11): 829–834, 2006.
17. Zdravotnícka ročenka Slovenskej republiky 2004. Veková štruktúra obyvateľstva.
147
Posttranscriptional regulation of the Inhibitor of Apoptosis protein cIAP1 during
cellular stress
Tong T. Zhao, Stephen M. Lewis, Martin Holčík
Apoptosis Research Centre, Children’s Hospital of Eastern Ontario, 401 Smyth Road, Ottawa, K1H 8L1 Canada
Abstract
Apoptosis is a physiological process characteristic of pluricellular organisms leading
to self-destruction of the cell. One of the hallmarks of apoptosis is the activation of caspases
that in turn cleave cellular substrates, leading to an orderly disassembly of the cell. A family
of intrinsic cellular inhibitor of Apoptosis proteins mediates competitive inhibition of caspase
activity. We report here that UV irradiation leads to downregulation of cIAP1 expression that
is due to mRNA destabilization. Four AU-rich elements are located within the 3’untranslated
region of cIAP1 mRNA and are sufficient to mediate cIAP1 mRNA instability during UV
stress. Furthermore, we have identified hnRNPA1 as one of the cIAP1 3’UTR ARE binding
proteins. HnRNP A1 is primarily nuclear protein but becomes relocalized into cytoplasm after
exposure of cells to UVC. In addition, hnRNP A1 destabilizes cIAP1 mRNA under normal
growth conditions and during UVC stress. Finally, siRNA-mediated knockdown of hnRNP
A1 attenuates the UVC–induced apoptosis suggesting that hnRNP A1 is an essential posttranscriptional modulator of cIAP1 expression and cell death.
Introduction
Apoptosis plays an important role in the maintenance of cellular homeostasis and is typified
by activation of a family of evolutionarily conserved intracellular cysteine proteases, known as
caspases. Caspases are functionally connected to each other, with initiator caspases cleaving and
activating effector caspases in a hierarchical manner (1). Controlling the caspase activity is critical for
the survival of cells and one of the mechanisms that is used to neutralize caspase activity is facilitated
by a family of proteins called the IAPs (Inhibitor of Apoptosis proteins) which are capable of directly
binding distinct caspases and inhibiting their proteolytic activity (2). In addition, the function of the
IAPs is not restricted to caspase inhibition, but also includes regulation of the cell cycle, signal
transduction, and protein degradation (3).
Given the critical role the IAPs play in the regulation of apoptosis, their expression is tightly
controlled. This is achieved at different levels of gene expression. For example, cIAP2 is regulated
transcriptionally via the NF-κB regulatory network (4). In contrast, the expression of XIAP is
regulated translationally through an internal ribosome entry site (IRES) element (5). Similarly,
expression of cIAP1 is also controlled at the level of translation. There is a short regulatory upstream
open reading frame (uORF) located in the 5’UTR of cIAP1 that exerts an inhibitory effect on the
translation of cIAP1 (6). Furthermore, cIAP1 also contains an inducible IRES element. During
endoplasmic reticulum (ER) stress, cIAP1 is translationally upregulated to delay the onset of ER stress
induced cell death (7). In this work we describe an additional control mechanism that regulates cIAP1
expression by modulating cIAP1 mRNA stability in response to UV irradiation.
We find that there are four AU-rich elements (AREs) located within the 3’UTR of cIAP1
mRNA that are sufficient to mediate cIAP1 mRNA instability during UV irradiation. In addition,
hnRNP A1 binds to the AREs in the 3’UTR of cIAP1 in a sequence specific manner. Importantly,
following UV irradiation the hnRNP A1 relocalizes from nucleus to the cytoplasm where it
destabilizes cIAP1 mRNA. Taken together, these results suggest that hnRNP A1 is an essential posttranscriptional modulator of cIAP1 expression.
Materials and methods
Human embryonic kidney cells (HEK293) were cultured in standard conditions as described
(8). Transient transfections were performed using LipofectAMINE PLUS according to the protocol
provided by the manufacturer (Invitrogen). Cells were collected for analysis 24 h after transfection.
siRNA transfections were performed using Lipofectamine 2000 according to the protocol provided by
the manufacturer (Invitrogen). Cells were collected for analysis 48 h after transfection. In the case of
148
co-transfection, 0.5µg/well of plasmid DNA was co-transfected at the same time as siRNA. UVC
irradiation experiments were performed as described (9). For the cycloheximide (CHX) experiments,
cells were treated with UVC (150mW/cm2) and 25µg/ml of CHX was added, cells were harvested at 0,
8, 24, 32, 48 hr point after addition of CHX. For the Actinomycin D experiments, cells were treated
with UVC (150mW/cm2), 10µg/ml of Act D was added and cells harvested at 0, 1, 2, 4, 8 hr time
points. For cells transfected with an siRNA, they were treated with UVC (150mW/cm2) 48 hours post
siRNA transfection. Five hours later, cells were harvested as described above. Western blot analysis
was performed using standard conditions and as described (8). Antibody complexes were detected by
direct infrared fluorescence by Odyssey infrared imaging system (LiCOR). Isolation of RNA and
quantitative RT-PCR analysis was performed using the QuantiTect SYBR Green PCR kit according to
the protocol provided by the manufacturer (Qiagen). The PCR reactions were analyzed on an ABI
Prism 7000 detection system using the ABI Prism 7000 SDS software. Quantitative PCR reactions
were carried out to detect Ct values of NEO, CAT, cIAP1 and GAPDH genes. Data was analyzed
using Microsoft Excel and is presented as 2-CT (cIAP1-GAPDH) and 2-CT (CAT-NEO). In the Actinomycin D
experiment, 2-CT (cIAP1-GAPDH) normalized to 0hr CT values (2-∆∆CT) calculation was used. RNA-affinity
chromatography, GST-fusion purification and UV-crosslinking of RNA-protein complexes was
performed essentially as described (8). Cell viability was determined using the Vi-Cell cell viability
analyzer (Beckman Coulter).
All data are expressed as mean +/- SD values. Statistical significance was assessed by two
tailed t test or one-way ANOVA (comparison of more than two groups). If not otherwise stated, all
experiments reported here represent at least three independent replications performed in triplicate.
Results and discussion
We observed that UV irradiation (150mW/cm2) induced more than a four fold decrease in
cIAP1 protein levels (A) without having any appreciable effect on the protein stability (not shown)
suggesting that posttranscriptional regulation is involved. Indeed, we observed that following UV
irradiation there was a marked difference in the steady-state levels of cIAP1 mRNA (B). To determine
if the stability of cIAP1 mRNA is altered following UV irradiation we treated cells with transcription
inhibitor Actinomycin D and determined the half-life of cIAP1 mRNA in treated and untreated cells.
UV irradiation resulted in approximately 40 % decrease in the half life of cIAP1 mRNA (C). These
findings suggest that the UV irradiation-induced down-regulation of cIAP1 is due at least in part to
decreased mRNA stability.
3’ UTR is often involved in the regulation of mRNA stability. Analysis of the 3’UTR of
cIAP1 revealed that it contains multiple putative AU-rich elements (AREs), including at least three
AUUUA motifs, which might regulate mRNA stability. Thus, it was reasonable to propose that cIAP1
mRNA instability may be due to the presence of AREs in the 3’UTR. To test this hypothesis, the full
length 3’UTR was cloned into the reporter plasmid downstream of the CAT coding region. In addition,
a 100nt fragment containing the four AREs of the cIAP1 3’UTR was also inserted downstream of the
CAT coding region, while the 3’ UTR of TNFα that is known to contain functional ARE was used as
a positive control (D, top). The expression of the reporter gene was normalized to that of Neomycin
that is expressed from the same plasmid but driven by an independent promoter. We observed that the
presence of either the full length 3’ UTR or just the ARE-containing region significantly decreased
steady state levels of CAT mRNA suggesting that the 3’UTR of cIAP1 can confer instability of a
reporter mRNA and the four AREs within the 100bp fragment are sufficient to recapitulate this effect
(D).
Since specific trans-acting factors (AUBPs) often bind to AREs and thereby control its
stability we sought to isolate these factors and identified hnRNP A1 as cIAP1 3’ UTR biding protein
(E). Importantly, the binding of hnRNP A1 to cIAP1 3’ UTR is specific since other known RNA
binding proteins TIAR, TIA-1, and hnRNP C1/2 were not detected (E). Furthermore, the binding of
hnRNP A1 is sequence specific as mutation of the cIAP1 ARE abrogated both the binding of purified
hnRNP A1 (F, top) as well as restored the stability of reporter mRNA (F, bottom).
hnRNP A1 is primarily localized in the nucleus of mammalian cells. However, it has been
reported that following UV irradiation hnRNP A1 relocalizes from nucleus into cytoplasm (10).
Indeed, we confirmed that hnRNP A1 accumulates in the cytoplasm following UV irradiation of
HEK293T cells (not shown). We further reasoned that targeted downregulation of hnRNP A1 should
lead to stabilization of cIAP1 mRNA, increased levels of cIAP1 protein and subsequent increase in the
sensitivity of cells to UV irradiation. Indeed, siRNA-mediated downregulation of hnRNP A1 markedly
149
elevated levels of cIAP1 protein (G) and steady-state levels of cIAP1 mRNA (H). More importantly,
siRNA-mediated downregulation of hnRNP A1 resulted in enhanced survival of HEK293T cells in
response to UV irradiation while the downregulation of cIAP1 resulted in increased sensitivity to UV
irradiation (I).
Conclusions
UV light is a common type of environmental stress that causes DNA damage and induces
apoptosis in mammalian cells through the mitochondrial branch of apoptotic pathway. UV irradiation
results in the modulation of expression of multiple genes that encode proteins involved in the repair of
DNA damage, regulation of cell cycle progression, and regulation of apoptosis. While the
transcriptional regulation upon UV irradiation has been extensively studied it cannot account for the
changes in the expression of all genes. We have identified a novel regulatory mechanism that controls
the expression of cIAP1, a potent modulator of apoptosis. The results presented here provide evidence
for hnRNP A1 being an important player in the post-transcriptional regulation of cIAP1 expression.
cIAP1 has been linked with several common malignancies including lung, ovarian, esophageal, and
liver carcinoma. This suggests that overall contribution of cIAP1 to human cancers may be substantial,
and the regulation of the expression of this gene should be closely examined.
Acknowledgements
We thank members of the Apoptosis Research Centre for helpful discussions and critical
comments. This work was supported by a grant from the National Sciences and Engineering Research
Council of Canada (NSERC).
150
References
1. Richter, B.W., Duckett, C.S.: The IAP proteins: caspase inhibitors and beyond. Sci STKE. PE1, 2000.
2. Holcik, M., Gibson, H., Korneluk, R.G.: XIAP: Apoptotic brake and promising therapeutic target. Apoptosis.
6: 253–261, 2001.
3. Liston, P., Fong, W.G., Korneluk, R.G.: The inhibitors of apoptosis: there is more to life than Bcl2. Oncogene.
22: 8568–8580, 2003.
4. Chu, Z.L., McKinsey, T.A., Liu, L., Gentry, J.J., Malim, M.H., Ballard, D.W.: Suppression of tumor necrosis
factor-induced cell death by inhibitor of apoptosis c-IAP2 is under NF-kappaB control. Proc Natl Acad Sci
USA. 94: 10057–10062, 1997.
5. Holcik, M., Lefebvre, C.A., Yeh, C., Chow, T., Korneluk, R.G.: A new internal-ribosome-entry-site motif
potentiates XIAP-mediated cytoprotection. Nature Cell Biol. 1: 190–192, 1999.
6. Warnakulasuriyarachchi, D., Ungureanu, N.H., Holcik, M.: The translation of an antiapoptotic protein HIAP2
is regulated by an upstream open reading frame. Cell Death Differ. 10: 899–904, 2003.
7. Warnakulasuriyarachchi, D., Cerquozzi, S., Cheung, H.H., Holcik, M.: Translational induction of the inhibitor
of apoptosis protein HIAP2 during endoplasmic reticulum stress attenuates cell death and is mediated via an
inducible internal ribosome entry site element. J Biol Chem. 279: 17148–17157, 2004.
8. Lewis, S.M., Veyrier, A., Hosszu Ungureanu, N., Bonnal, S., Vagner, S., Holcik, M.: Subcellular
relocalization of a trans-acting factor regulates XIAP IRES-dependent. Translation Mol Biol Cell. 18: 1302–
1311, 2007.
9. Ungureanu, N.H., Cloutier, M., Lewis, S.M., de Silva, N., Blais, J.D., Bell, J.C., Holcik, M.: Internal ribosome
entry site-mediated translation of Apaf-1, but not XIAP, is regulated during UV-induced cell death. J Biol
Chem. 281: 15155–15163, 2006.
10. van der Houven van Oordt, W., Diaz-Meco, M.T., Lozano, J., Krainer, A.R., Moscat, J., Caceres, J.F.: The
MKK(3/6)-p38-signaling cascade alters the subcellular distribution of hnRNP A1 and modulates alternative
splicing regulation. J Cell Biol. 149: 307–316, 2000.
151